The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	1405	97281	4411148	terminase,transposase,holin,tail,integrase,portal,protease,capsid	Paenibacillus_phage(88.41%)	112	18545:18563	111587:111605
WP_188318588.1|1405_1966_-	helix-turn-helix domain-containing protein	NA	A0A2I7SCV6	Paenibacillus_phage	46.2	2.2e-31
WP_077995163.1|2175_2364_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J3K6	uncultured_Caudovirales_phage	45.0	5.2e-09
WP_149867650.1|2428_2812_+	excisionase family DNA-binding protein	NA	A0A0C5AN65	Paenibacillus_phage	76.5	9.8e-23
WP_077995164.1|2829_3093_+	hypothetical protein	NA	A0A0N9SSV8	Paenibacillus_phage	61.0	4.0e-07
WP_077995165.1|3498_3807_+	hypothetical protein	NA	A0A0N9RZD8	Paenibacillus_phage	84.5	2.7e-23
WP_077995166.1|3791_4136_+	hypothetical protein	NA	A0A0N9RZD8	Paenibacillus_phage	98.2	9.3e-65
WP_155121100.1|4948_5125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995167.1|5291_5594_+	hypothetical protein	NA	A0A0N9S7X2	Paenibacillus_phage	96.0	3.5e-47
WP_077995168.1|5609_5936_+	helix-turn-helix domain-containing protein	NA	A0A0N7GFE9	Paenibacillus_phage	94.4	6.6e-52
WP_149867651.1|6071_6563_+	hypothetical protein	NA	A0A0N9SJV6	Paenibacillus_phage	44.4	1.3e-19
WP_077995170.1|6620_6809_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	83.7	9.7e-16
WP_040932746.1|6974_7352_+	hypothetical protein	NA	A0A0N9SSX1	Paenibacillus_phage	84.8	1.9e-55
WP_040932748.1|7370_7637_+	hypothetical protein	NA	A0A0N9RRC8	Paenibacillus_phage	84.1	3.7e-37
WP_077995171.1|7644_8415_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	94.9	2.5e-142
WP_077995172.1|8411_9788_+	AAA family ATPase	NA	A0A0N9SIP5	Paenibacillus_phage	84.5	2.3e-223
WP_077995173.1|9800_10196_+	hypothetical protein	NA	A0A0N9S7Y2	Paenibacillus_phage	82.6	7.5e-50
WP_077995174.1|10231_10750_+	toprim domain-containing protein	NA	A0A0N9S7Y2	Paenibacillus_phage	83.1	1.9e-77
WP_077995175.1|10809_11388_+	hypothetical protein	NA	A0A0N9SGJ9	Paenibacillus_phage	55.2	7.6e-51
WP_158676623.1|11441_11981_+	hypothetical protein	NA	A0A0N9RTM1	Paenibacillus_phage	93.7	1.1e-80
WP_077995177.1|12065_12788_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	90.2	9.3e-123
WP_077995178.1|12963_13305_+	hypothetical protein	NA	A0A7H5	Microcystis_virus	43.5	4.7e-08
WP_077995179.1|13449_13863_+	hypothetical protein	NA	A0A0N9RZF9	Paenibacillus_phage	96.4	5.0e-73
WP_077995180.1|14074_14263_+	hypothetical protein	NA	A0A0N9SIQ5	Paenibacillus_phage	71.7	4.2e-11
WP_077995181.1|14906_16466_+	DNA polymerase I	NA	A0A0N9S7Z3	Paenibacillus_phage	94.5	6.8e-288
WP_149867652.1|16434_16785_+	hypothetical protein	NA	A0A0N9SGL0	Paenibacillus_phage	60.7	1.8e-31
WP_077995183.1|16778_17906_+	hypothetical protein	NA	A0A0N9RTM8	Paenibacillus_phage	79.4	4.6e-177
WP_077995184.1|17906_18104_+	hypothetical protein	NA	A0A0N7GFF2	Paenibacillus_phage	95.4	4.7e-29
WP_077995185.1|18100_18715_+	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	96.1	2.8e-104
18545:18563	attL	GTGGAGGCAACGGTAAAAG	NA	NA	NA	NA
WP_077995186.1|18699_19719_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	81.1	4.6e-136
WP_158672766.1|19975_20227_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A0N9ST03	Paenibacillus_phage	85.5	3.2e-30
WP_077995188.1|20223_20406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995189.1|20371_22690_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	63.4	1.3e-279
WP_077995190.1|22703_23735_+	ribonucleotide-diphosphate reductase subunit beta	NA	U5Q1G6	Bacillus_phage	61.2	1.9e-121
WP_077995191.1|23746_24259_+	dUTP diphosphatase	NA	D2XR49	Bacillus_phage	53.8	2.0e-39
WP_077995192.1|24265_24562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995193.1|24558_24897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040930425.1|24897_25224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995194.1|25365_25566_+	hypothetical protein	NA	A0A0N7GFF3	Paenibacillus_phage	95.2	1.1e-28
WP_077995195.1|25562_25793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995196.1|25794_26112_+	hypothetical protein	NA	A0A0N9S804	Paenibacillus_phage	87.6	1.6e-50
WP_077995197.1|26105_26576_+	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	86.8	3.2e-76
WP_077995198.1|26572_26941_+	DUF5406 family protein	NA	NA	NA	NA	NA
WP_077995199.1|26984_28064_+	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	51.7	3.6e-62
WP_077995200.1|28047_28806_+	AAA family ATPase	NA	A0A0N9SJZ0	Paenibacillus_phage	95.5	6.2e-69
WP_188318589.1|29025_29181_+	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	88.5	3.7e-05
WP_188318590.1|29186_29432_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	82.7	1.7e-28
WP_077995202.1|29421_29874_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	77.3	4.5e-59
WP_077995204.1|31097_31862_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	97.6	1.4e-140
WP_077995205.1|32204_32399_+	hypothetical protein	NA	A0A0N9RTP7	Paenibacillus_phage	86.2	1.4e-06
WP_077995206.1|32420_32840_+	hypothetical protein	NA	A0A0N9SJZ8	Paenibacillus_phage	92.8	4.8e-71
WP_077995207.1|32829_33258_+	helix-turn-helix domain-containing protein	NA	A0A0N7GFF5	Paenibacillus_phage	99.2	8.0e-66
WP_155121103.1|34147_34312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121104.1|34415_34592_+	hypothetical protein	NA	A0A0N9SSS1	Paenibacillus_phage	94.8	2.2e-17
WP_077997491.1|35368_37054_+|terminase	phage terminase large subunit	terminase	A0A0N9RZA7	Paenibacillus_phage	97.6	5.8e-301
WP_077995210.1|37077_38562_+|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	92.1	5.7e-244
WP_077995211.1|38558_39419_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	93.4	1.6e-145
WP_077995212.1|39510_39957_+	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	73.8	2.0e-30
WP_188318591.1|39977_40145_+	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	78.2	2.4e-18
WP_077995214.1|40200_41136_+	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	94.9	2.7e-167
WP_188318592.1|41204_41663_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	95.3	1.6e-51
WP_077995216.1|41862_42288_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	92.2	3.5e-69
WP_077995217.1|42284_42659_+	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	94.4	4.7e-62
WP_077995218.1|42671_43220_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	95.1	2.9e-92
WP_077995219.1|43270_43507_+	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	91.3	2.4e-27
WP_077995222.1|45566_46040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995223.1|46390_46933_+	hypothetical protein	NA	A0A0N9SJR9	Paenibacillus_phage	64.2	1.3e-36
WP_077995224.1|46913_48371_+|tail	phage tail family protein	tail	A0A0N9RRA9	Paenibacillus_phage	94.8	1.3e-277
WP_188318593.1|48373_49183_+|tail	phage tail protein	tail	A0A0N9SIL8	Paenibacillus_phage	96.4	2.5e-140
WP_188318594.1|49146_50547_+|tail	phage tail protein	tail	A0A0N9SIL8	Paenibacillus_phage	96.8	3.5e-259
WP_158672768.1|50688_51126_+	hypothetical protein	NA	A0A0N9S7V6	Paenibacillus_phage	90.3	1.1e-67
WP_077995228.1|51113_51530_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	97.1	2.9e-68
WP_077995229.1|51522_52392_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	95.2	1.6e-161
WP_077995230.1|52678_52972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995231.1|53110_53323_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077995232.1|53325_53709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995233.1|53714_53951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995235.1|55231_55411_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077995236.1|55793_56144_-	hypothetical protein	NA	A0A2I7SCF2	Paenibacillus_phage	87.1	4.6e-51
WP_040931863.1|56188_56614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995237.1|56778_57405_-	hypothetical protein	NA	A0A0N9SJT2	Paenibacillus_phage	62.4	2.5e-39
WP_077995238.1|58258_60163_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_077995239.1|60177_61038_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_077995240.1|61027_61687_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_077995241.1|61683_62715_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_077995242.1|62724_63015_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_149867654.1|64593_64899_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077995244.1|64902_65307_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077997492.1|65343_65472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867655.1|65841_66429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995246.1|66515_66893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995247.1|67074_67557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995248.1|68168_68396_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	50.0	1.8e-08
WP_077995249.1|68459_69680_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077995254.1|74276_74648_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077995256.1|78202_78940_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149867656.1|80930_81134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155116373.1|81290_81443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484252.1|85579_86071_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_024094004.1|87194_88148_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	55.3	1.4e-94
WP_024094005.1|88137_89091_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_023484248.1|89084_89843_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.8	7.7e-19
WP_077995258.1|89934_90888_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077995259.1|91397_91655_+	YqkE family protein	NA	NA	NA	NA	NA
WP_077995260.1|91685_92825_+	lactonase family protein	NA	NA	NA	NA	NA
WP_162544749.1|93105_93261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995262.1|93381_93696_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_077995263.1|93854_94304_+	cysteine dioxygenase family protein	NA	NA	NA	NA	NA
WP_036654303.1|94485_95253_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_155121107.1|95305_95461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995264.1|95478_96144_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_077995265.1|96289_96703_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995266.1|96705_97281_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
111587:111605	attR	GTGGAGGCAACGGTAAAAG	NA	NA	NA	NA
>prophage 2
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	359221	408525	4411148	transposase	Paenibacillus_phage(72.73%)	33	NA	NA
WP_104932657.1|359221_360091_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_077995374.1|360148_360676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|360872_362096_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077995376.1|362409_362940_-	spore germination protein	NA	NA	NA	NA	NA
WP_077995377.1|363319_365779_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_077995379.1|367747_369280_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_023484737.1|370945_371773_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_077995380.1|372234_373779_-	gluconokinase	NA	NA	NA	NA	NA
WP_024094123.1|375284_375962_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995381.1|378041_378353_-	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	45.9	1.4e-11
WP_077995382.1|380322_380514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|381147_381831_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|381851_382721_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077995383.1|382895_383285_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_077995384.1|383773_386329_-	RICIN domain-containing protein	NA	A0A0K2CYN4	Paenibacillus_phage	56.1	1.9e-258
WP_077997499.1|386582_387002_+	DUF4064 domain-containing protein	NA	A0A0K2CZQ0	Paenibacillus_phage	100.0	5.7e-24
WP_077995386.1|387293_387749_-	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	35.4	2.1e-16
WP_077995387.1|387697_389926_-	RICIN domain-containing protein	NA	A0A0K2CYN4	Paenibacillus_phage	51.6	3.4e-208
WP_077995388.1|391475_392417_+	LCP family protein	NA	NA	NA	NA	NA
WP_188318605.1|393222_393444_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC05	Paenibacillus_phage	50.0	4.1e-13
WP_077995389.1|393583_393766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995390.1|393898_394102_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	94.7	4.7e-24
WP_036654824.1|394085_394358_+	hypothetical protein	NA	A0A0C5AEQ9	Bacteriophage	100.0	3.9e-42
WP_077995391.1|394361_394574_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	97.0	1.3e-29
WP_077995392.1|394924_395473_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	85.8	9.9e-77
WP_036654509.1|395715_396399_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|396419_397289_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077995393.1|399132_399933_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SCE7	Paenibacillus_phage	55.3	3.1e-18
WP_077995394.1|400796_403004_-	hypothetical protein	NA	A0A142IG93	Bacillus_phage	39.9	2.6e-19
WP_077995395.1|403343_403661_-	STAS-like domain-containing protein	NA	J7KJ12	Streptococcus_phage	46.2	1.1e-11
WP_077995375.1|403811_405035_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077995396.1|405180_406965_-	RICIN domain-containing protein	NA	Q38196	Clostridium_botulinum_phage	30.3	2.7e-06
WP_077995397.1|407301_408525_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
>prophage 3
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	411976	487518	4411148	bacteriocin,transposase	Paenibacillus_phage(36.36%)	52	NA	NA
WP_077995401.1|411976_412249_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	93.3	4.5e-30
WP_077995402.1|412452_413907_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
WP_077995403.1|414049_415642_-	SagB family peptide dehydrogenase	NA	NA	NA	NA	NA
WP_077997501.1|415666_417508_-	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_077995404.1|419695_419962_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_083041350.1|420338_420539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995405.1|421776_423726_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077997502.1|424862_425144_-	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_077995406.1|425068_425425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995407.1|425788_426115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094129.1|426252_426459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995408.1|429036_429465_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_023484627.1|429631_430021_-	DoxX family protein	NA	NA	NA	NA	NA
WP_158672774.1|431008_431386_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_051427815.1|431844_432099_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077995411.1|432131_432653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654152.1|433781_435191_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_077995412.1|436375_436714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040931545.1|436714_436921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654150.1|437313_438144_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_077995413.1|438930_440298_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_077995414.1|440492_441542_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.2e-30
WP_077995415.1|441535_441853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932705.1|441791_442673_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_036656608.1|443935_445270_-	magnesium transporter	NA	NA	NA	NA	NA
WP_077995417.1|445377_448026_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	24.8	5.2e-38
WP_149867674.1|449019_449358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940713.1|449303_449732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932634.1|451370_452240_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|452260_452944_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077995421.1|453044_455345_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_077995422.1|455930_457013_+	tyrosine recombinase XerS	NA	A0A2R2ZGM9	Clostridioides_phage	24.9	6.7e-08
WP_149867815.1|457074_458712_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.9	4.3e-59
WP_024094153.1|458998_459802_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_024094155.1|463220_463385_-	GapA-binding peptide SR1P	NA	NA	NA	NA	NA
WP_077995423.1|463673_464909_-	MFS transporter	NA	NA	NA	NA	NA
WP_077995424.1|465138_466668_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_158672775.1|467624_467786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484599.1|467807_469013_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_077995425.1|469009_470245_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_077997503.1|470407_470890_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_077995427.1|472512_474156_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_077995428.1|475559_476837_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_158672776.1|476993_477152_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158672777.1|477211_477343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|478510_479734_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077995429.1|479848_480181_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077995430.1|485461_485773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995431.1|485712_486279_-	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	22.9	1.6e-05
WP_077995432.1|486239_486593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995433.1|486529_486874_-	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	42.0	7.7e-19
WP_077995434.1|487287_487518_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	566252	575294	4411148	transposase	Paenibacillus_phage(71.43%)	8	NA	NA
WP_036654509.1|566252_566936_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932657.1|566956_567826_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_024094220.1|568013_568202_-	MarR family transcriptional regulator	NA	A0A2I7SCW2	Paenibacillus_phage	93.0	3.7e-23
WP_077995479.1|568530_568863_+	DUF4064 domain-containing protein	NA	NA	NA	NA	NA
WP_158672784.1|569254_570496_-	hypothetical protein	NA	A0A1V0E017	Clostridioides_phage	25.6	1.4e-06
WP_077995481.1|570826_571756_-	ricin-type beta-trefoil lectin domain protein	NA	A0A0K2CYN4	Paenibacillus_phage	30.5	1.0e-09
WP_077995397.1|571926_573150_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_077995482.1|573170_575294_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	36.7	8.3e-95
>prophage 5
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	668312	754574	4411148	tRNA,transposase,protease,integrase	Paenibacillus_phage(40.74%)	86	718929:718988	755288:757009
WP_104932634.1|668312_669182_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077995505.1|669931_670696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094283.1|670731_671643_-	protein kinase PKN/PRK1, effector,flagellar motor switch protein FliG-like protein	NA	NA	NA	NA	NA
WP_024094287.1|676999_677314_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_077995506.1|677310_677784_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_036653997.1|677787_678198_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_024094289.1|678440_679226_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_036653992.1|680823_681366_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_077997509.1|681544_682873_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_023484649.1|682885_684976_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.9	1.8e-110
WP_077995507.1|685123_686233_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.4	3.7e-38
WP_077995508.1|686336_687272_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_077995509.1|687328_688489_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_024094298.1|688877_689138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094299.1|689169_689565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997510.1|689779_691303_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_024094301.1|691399_691804_-	YraN family protein	NA	NA	NA	NA	NA
WP_023484363.1|691813_692146_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_077995510.1|692142_692673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995511.1|693127_693733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995512.1|693771_693951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995513.1|694980_695862_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_077995514.1|695970_696555_-	signal peptidase I	NA	NA	NA	NA	NA
WP_023484358.1|696666_697008_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_077995515.1|697898_698420_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_023484355.1|698645_698876_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_023484354.1|698898_699171_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_023484353.1|699212_700580_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_024094307.1|700609_700972_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_077995516.1|701105_702113_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_023484350.1|702197_705776_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_077997511.1|705944_706646_-	ribonuclease III	NA	A0A167RGU4	Powai_lake_megavirus	29.6	2.1e-26
WP_024094309.1|706825_708061_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_024094310.1|708150_708384_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	38.0	6.0e-07
WP_024094311.1|708502_709243_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	36.4	5.0e-23
WP_023484345.1|709342_710278_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_188318647.1|710309_711287_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_024094313.1|711306_712293_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_023484342.1|712294_712888_-	transcription factor FapR	NA	NA	NA	NA	NA
WP_023484341.1|713060_713234_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_077995518.1|713352_713865_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_036658730.1|713952_715026_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_023484339.1|715210_716560_+	spore cortex formation factor-like protein	NA	NA	NA	NA	NA
WP_023484338.1|716570_717080_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.5	2.0e-26
WP_023484337.1|717097_717655_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_024094320.1|718203_718401_-	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	76.9	2.4e-09
WP_024094321.1|718465_718879_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	98.6	8.7e-33
718929:718988	attL	TGATATGCTCCCCTTGCGGTAGACAGTTGAAATAATAAAACTGTTTACTGTAAGGAGGAG	NA	NA	NA	NA
WP_036654509.1|718997_719681_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|719701_720571_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_024094322.1|720751_721141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995520.1|721922_722060_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077995521.1|722240_723494_-	lytic polysaccharide monooxygenase	NA	A0A2D1GD28	Mycobacterium_phage	29.3	3.8e-07
WP_104932807.1|724016_725061_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	6.0e-06
WP_077995522.1|725126_725369_-|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	98.8	8.6e-33
WP_077585229.1|725378_726047_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0K2CXQ8	Paenibacillus_phage	95.9	4.0e-128
WP_024094328.1|726046_726286_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
WP_077995523.1|726698_727010_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_149867687.1|727060_727480_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_149867688.1|727455_727914_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	29.1	5.1e-10
WP_077995527.1|729256_729607_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	60.9	5.8e-30
WP_158672787.1|729863_730154_-	hypothetical protein	NA	A0A0C5AFG5	Paenibacillus_phage	79.8	6.5e-35
WP_077995529.1|730293_730809_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_042119037.1|730891_731095_-	hypothetical protein	NA	A0A0S2SXP3	Bacillus_phage	40.0	6.8e-07
WP_158672788.1|731690_731915_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158676629.1|732178_732772_+	hypothetical protein	NA	R9VW28	Paenibacillus_phage	44.2	4.0e-39
WP_158672789.1|732791_733349_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	40.4	3.0e-28
WP_158672790.1|733358_733574_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MNZ2	Brevibacillus_phage	71.6	3.3e-20
WP_024094341.1|734593_734797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094342.1|735033_735774_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023484789.1|735924_737196_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_036658705.1|737330_738662_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_077995534.1|739071_739389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995535.1|739390_739594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484786.1|739820_740159_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_077995536.1|740155_741403_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_023484784.1|741957_743013_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_023484783.1|743041_743389_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024094350.1|744051_744414_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024094351.1|744623_746756_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.6	1.0e-164
WP_077995537.1|746963_747218_+	hypothetical protein	NA	W8CYF6	Bacillus_phage	37.2	1.5e-06
WP_077995538.1|747296_748403_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_188318610.1|748402_749086_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	2.4e-35
WP_188318611.1|750965_751154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121117.1|751452_751614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995541.1|752798_753446_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_104932621.1|753704_754574_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
755288:757009	attR	CTCCTCCTTACAGTAAACAGTTTTATTATTTCAACTGTCTACCGCAAGGGGAGCATATCAGTATTTCCTCAAAGGCTCTTCTTTCTGTGTATATCTTTTGAATTCCCCTACAAAAGGTTTTGCTTTATTTATTAGGATTCAGATACCACCGTATAGCGCTCGTTAAGATGCTGGGGATTTTCAATTTCATCCAGTACTGCGATGGCATAGTCCTCCATGCTTACAAAACTTTCACCTTTCGAATTAACAAGCAGTTGGTCCTTTCCAAGCTTGTAGGCCCCGGTCCGTTTGCCCGGTGCAAATAAAGCTGATGGACTTAGGAAGGTCCAGGTAATACCTTGGGTCTGCCGGAGTATGTCCAGATTCTTGGCTTGATTTGTAGCCGTAGCTAAATACTCTTTTGGAAAATCAGGGGTCTCAAATACTTTGGTAGTATGCTCCGCATCCACAAACAGACTTCCGGCCCCGCCCACTACAAACAATCTGGTATCCGGTGCACCTTGCAAGGCCTTGATCAAAACATTACCTGCGTCTACATGAAGATGCTCTTGCCCTGGAGCCGCGCCAAACGCATTCACCACAACATCAAAAGGTTTTAGATCCTCAGCTTTCAGATCAAATACATCTTTCTTCAGAACACGGGCACTTGTTTCTCCCAGCTTGGAAGCATTTCTCACAATAGCCGTAACCTCATGACCTCTGTCCATAGCTTCTTTCATAATACGGCTTCCTGCTTGGCCTGTTGCTCCAATAATAGCAATTTTCATTTTGAATACCTCCTGAAAATAAGTGATAGAATTTATTTAAAAACCTTGATGTAACCATCATAGTTACATCAAGAGGATTTGTCAAATTTTTTTTAGGTTTCCCCAAACGAAAATCATTCAATCAATTGAATGAGATTTGAAAAGGTTTTATGTTTCTTCAAAAACAAACCCCCTTTTCCTGTGGAAAAGAGGGTTTGTACTCTGTTACAAGCGGATCTCATTTTATTGGAAAGATACATAATTGAATCAATTTCAAATTCTGGATTATAAAATTGATTTTTCATCTAGGCCAGTTTTTGTTCGCTCACTTTAGGTTGAAATATCACACGGGAAACTCTAAGATGGTCGGTTTCCTCTACCGTTATTTCAAAGTTCCGCCAAGTAATCTTTTGGTTGGGTTTGGGTGGAACTTCGAACTGGGCATACAGCCAGCCACCAATGGTATCATAATCTTCTTGTTCCAGTTCAAGACCCAGTTCCTCTTTCACGTCCTCCACTAATACAAGGCCGTCAATCGAATAACTGCCATCCGGCCTTTTCTCAATATCCGGCCTTTCGTTGTCGAACTCATCCTGAATATCCCCGACGATTTCCTCAAGGATATCTTCTATGGTAACAAGACCGGAAGTTCCCCCGTATTCATCAATAAGAAGAGCCATTTCCGTTTTATTCTTTTGCATCAATTTGAGCAAAGAACTGATCGGCATGGAATCAGGAACACTCAAAAGCGGACGGATTAACTCGGTAATGCTGGTTAGCTCCATTTCCGTTTTGAGCAGATCCTTAATATGGACAAACCCGATAATGTTATCCTTATCAGGGTTGCAGACGGGATAACGGGTATGAAGATGCATAATGGCAATCTGCTTATTTTCTTCATAAGAACGATGTTCATACAAACAAATGATATCTGTACGCGGAATCATAATTTCCTTGGCATGTGTCTCGGTAAAAT	NA	NA	NA	NA
>prophage 6
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	890994	900339	4411148	transposase	Paenibacillus_phage(72.73%)	13	NA	NA
WP_104932657.1|890994_891864_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_036654509.1|891884_892568_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077995599.1|893024_893414_+	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	50.7	1.3e-06
WP_077995601.1|894432_895077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995602.1|895691_895895_+	hypothetical protein	NA	A0A0K2CYF6	Paenibacillus_phage	60.0	5.8e-06
WP_024094463.1|895963_896185_-	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	44.4	3.8e-11
WP_077995603.1|896283_896475_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	100.0	4.4e-24
WP_155121024.1|896478_896631_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	81.2	2.3e-07
WP_077995604.1|897232_897535_-	hypothetical protein	NA	A0A2I7SC06	Paenibacillus_phage	81.4	3.7e-33
WP_077995605.1|897941_898424_-	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	31.7	6.8e-05
WP_077995606.1|899002_899185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995607.1|899480_899891_+	helix-turn-helix transcriptional regulator	NA	F8J1E0	Lactobacillus_phage	39.8	2.3e-09
WP_077995608.1|899922_900339_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	37.0	4.6e-18
>prophage 7
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	1223426	1381446	4411148	bacteriocin,transposase,terminase,head,tail,integrase,protease,portal,capsid	Bacteriophage(42.68%)	157	1249557:1249571	1307146:1307160
WP_077995752.1|1223426_1223774_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_023482975.1|1223789_1224101_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_188318620.1|1224282_1224699_-	ribonuclease E/G	NA	NA	NA	NA	NA
WP_023482973.1|1225008_1225884_-	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_077995754.1|1225876_1226791_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_023482970.1|1228103_1228898_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_023482969.1|1228995_1229634_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_077995755.1|1229703_1230234_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_024094764.1|1232229_1232919_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_024094765.1|1233403_1233835_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995756.1|1233915_1234512_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_077995757.1|1234581_1234824_-	DUF4321 domain-containing protein	NA	NA	NA	NA	NA
WP_077997528.1|1235074_1236217_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	35.5	2.9e-22
WP_040932310.1|1236317_1237130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995758.1|1237147_1237606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995759.1|1237728_1239117_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_023484266.1|1239124_1240498_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_077995760.1|1244026_1245178_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_188318621.1|1245282_1246176_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_077997530.1|1247858_1248815_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.6	1.2e-32
WP_077995761.1|1248959_1250261_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
1249557:1249571	attL	CGTAATATCGCGGAG	NA	NA	NA	NA
WP_077995762.1|1250323_1251763_-	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_077995763.1|1253993_1254989_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_077995764.1|1256574_1257519_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_077995765.1|1257567_1258305_-	bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase	NA	NA	NA	NA	NA
WP_077995766.1|1258301_1259144_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_023484282.1|1260746_1261280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995767.1|1261417_1261819_-	adenosylmethionine decarboxylase	NA	A0A0E3FA82	Synechococcus_phage	36.4	1.5e-18
WP_023484284.1|1262191_1262779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995768.1|1263169_1263784_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_024094788.1|1266284_1268003_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	24.7	4.7e-16
WP_104932751.1|1268218_1268926_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_077995769.1|1268976_1270098_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_077995770.1|1270202_1271465_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.0	5.9e-149
WP_024094790.1|1271480_1272071_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.6	4.2e-57
WP_104932752.1|1272235_1273537_-	trigger factor	NA	NA	NA	NA	NA
WP_046655164.1|1273716_1274619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_188318622.1|1274749_1275004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995772.1|1274991_1275969_-	CapA family protein	NA	A0A2H4JC87	uncultured_Caudovirales_phage	35.0	1.3e-42
WP_024094793.1|1276195_1276309_-	DUF4023 family protein	NA	NA	NA	NA	NA
WP_149867710.1|1276363_1277584_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_077995774.1|1277586_1277868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995775.1|1277860_1278337_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_024094796.1|1278503_1278857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094798.1|1281673_1282429_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_077997532.1|1284006_1284567_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.6	5.5e-38
WP_077995776.1|1284632_1285442_+	MFS transporter	NA	NA	NA	NA	NA
WP_104932621.1|1285679_1286549_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|1286569_1287253_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932668.1|1287505_1288622_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	4.6e-153
WP_077995777.1|1288775_1289090_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_023485249.1|1289089_1289431_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_024094809.1|1289498_1290080_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995778.1|1291319_1292054_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_077995780.1|1294313_1294772_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_188318665.1|1294898_1295447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932754.1|1295377_1295572_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_149867711.1|1296348_1299681_+	hypothetical protein	NA	A0A126FC74	Lonomia_obliqua_multiple_nucleopolyhedrovirus	25.5	1.2e-34
WP_077995782.1|1299753_1300323_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023483458.1|1302145_1302352_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
WP_023482516.1|1303394_1304033_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_077995375.1|1305343_1306567_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077995783.1|1307375_1308938_-	recombinase family protein	NA	A0A0C5AJM7	Paenibacillus_phage	98.5	5.6e-290
1307146:1307160	attR	CGTAATATCGCGGAG	NA	NA	NA	NA
WP_144029589.1|1308876_1309125_-	hypothetical protein	NA	A0A0C5AF76	Paenibacillus_phage	98.8	9.8e-40
WP_077995784.1|1309169_1309628_-	transcriptional regulator	NA	A0A0C5AC66	Paenibacillus_phage	96.7	5.4e-76
WP_077995785.1|1309678_1310137_-	hypothetical protein	NA	A0A2I7SCC0	Paenibacillus_phage	98.0	2.7e-75
WP_077995786.1|1310295_1310883_-	hypothetical protein	NA	A0A0C5ABQ1	Bacteriophage	94.3	7.3e-102
WP_077995787.1|1310879_1311092_-	hypothetical protein	NA	R9VYB7	Paenibacillus_phage	85.7	8.3e-32
WP_077995788.1|1311199_1311391_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	80.0	3.4e-16
WP_077995789.1|1311440_1311806_-	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	95.8	9.9e-57
WP_155116288.1|1311852_1312002_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	100.0	5.0e-23
WP_077995790.1|1312016_1312322_-	hypothetical protein	NA	A0A0C5AEC7	Paenibacillus_phage	91.1	4.9e-49
WP_077997534.1|1312324_1313647_-	AAA family ATPase	NA	A0A0K2CY23	Paenibacillus_phage	98.6	2.4e-246
WP_149867712.1|1313612_1314281_-	hypothetical protein	NA	A0A2I7SDJ4	Paenibacillus_phage	98.6	1.9e-122
WP_023483155.1|1314462_1314777_-	hypothetical protein	NA	A0A0C5AEL1	Paenibacillus_phage	100.0	2.0e-37
WP_077995791.1|1314773_1315532_-	MBL fold metallo-hydrolase	NA	A0A0B5A2C7	Paenibacillus_phage	94.8	1.5e-139
WP_077995792.1|1315544_1316459_-	recombinase RecT	NA	A0A0C5AEK7	Bacteriophage	85.9	8.9e-147
WP_077995793.1|1316461_1316659_-	hypothetical protein	NA	A0A0C5AN67	Paenibacillus_phage	93.8	8.0e-29
WP_077995794.1|1316655_1318176_-	AAA family ATPase	NA	A0A0C5AN14	Bacteriophage	83.9	8.5e-227
WP_077995795.1|1318159_1318453_-	hypothetical protein	NA	A0A0C5AJQ8	Paenibacillus_phage	95.9	3.8e-43
WP_077995796.1|1318457_1318718_-	hypothetical protein	NA	A0A0C5AN52	Paenibacillus_phage	64.4	5.5e-25
WP_077995797.1|1318753_1319164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995798.1|1319325_1319559_-	hypothetical protein	NA	A0A0C5AN13	Bacteriophage	88.3	4.9e-33
WP_077995799.1|1319555_1319798_-	hypothetical protein	NA	A0A0C5AER7	Bacteriophage	78.9	2.0e-29
WP_155121051.1|1319894_1320071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995800.1|1320054_1320327_-	hypothetical protein	NA	A0A0C5AEJ1	Bacteriophage	95.5	3.6e-43
WP_077995801.1|1320353_1321094_-	Rha family transcriptional regulator	NA	A0A2I7SDG8	Paenibacillus_phage	97.2	8.9e-129
WP_155121052.1|1321122_1321266_-	hypothetical protein	NA	A0A2I7SCU1	Paenibacillus_phage	95.7	2.7e-18
WP_077995803.1|1321463_1321682_-	helix-turn-helix transcriptional regulator	NA	A0A0C5AMZ9	Paenibacillus_phage	95.7	5.6e-31
WP_077995804.1|1321899_1322346_+	helix-turn-helix transcriptional regulator	NA	A0A0C5AN12	Bacteriophage	96.6	1.3e-71
WP_077995805.1|1322918_1323122_+	YqaE/Pmp3 family membrane protein	NA	A0A0C5AJ71	Bacteriophage	100.0	6.3e-29
WP_077995806.1|1323218_1323449_-	helix-turn-helix transcriptional regulator	NA	A0A0C5ABM0	Bacteriophage	96.0	3.0e-35
WP_077995807.1|1323923_1324115_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	96.6	1.1e-25
WP_079940410.1|1324380_1324587_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	89.7	4.2e-28
WP_077995809.1|1324678_1324921_-|transposase	transposase	transposase	A0A0C5AEQ4	Bacteriophage	96.2	7.6e-29
WP_077997536.1|1325173_1325845_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SC18	Paenibacillus_phage	93.3	6.8e-128
WP_077995810.1|1325844_1326084_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	96.2	3.1e-35
WP_024094416.1|1326119_1326278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995811.1|1326270_1326666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995812.1|1326678_1328463_-|tail	phage tail protein	tail	A0A0C5AEQ0	Bacteriophage	90.6	2.3e-69
WP_077995813.1|1330141_1330468_-	GPW/gp25 family protein	NA	A0A0C5ABJ8	Bacteriophage	98.1	7.3e-51
WP_077995814.1|1330457_1330859_-|tail	phage tail protein	tail	A0A0C5AN08	Bacteriophage	95.5	1.0e-70
WP_077995815.1|1330839_1331232_-	hypothetical protein	NA	A0A0C5AEP6	Bacteriophage	88.5	9.4e-21
WP_077995816.1|1331234_1332263_-	late control protein	NA	A0A0C5AJ59	Bacteriophage	91.8	1.3e-186
WP_077995818.1|1332465_1333743_-	hypothetical protein	NA	A0A0C5ABJ2	Bacteriophage	74.9	6.5e-119
WP_077995820.1|1334275_1334959_-	hypothetical protein	NA	A0A0C5ABJ2	Bacteriophage	91.2	7.7e-95
WP_077995821.1|1335118_1335454_-|tail	phage tail assembly protein	tail	A0A0C5AEP1	Bacteriophage	85.0	6.8e-44
WP_077995822.1|1335481_1336000_-|tail	phage major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	94.8	9.4e-85
WP_077995823.1|1336012_1337455_-|tail	phage tail protein	tail	A0A0C5AEE8	Bacteriophage	92.1	3.5e-262
WP_077995824.1|1337458_1337731_-	hypothetical protein	NA	A0A0C5ABI6	Bacteriophage	95.6	1.4e-42
WP_077995825.1|1337727_1338195_-	hypothetical protein	NA	A0A0C5AN06	Bacteriophage	97.4	2.3e-82
WP_077995826.1|1338191_1338743_-|tail	phage tail protein	tail	A0A0C5AEN6	Bacteriophage	98.9	3.1e-94
WP_077995827.1|1338739_1339051_-	hypothetical protein	NA	A0A0C5AJ53	Bacteriophage	100.0	4.8e-52
WP_155121053.1|1339047_1339197_-	hypothetical protein	NA	A0A0C5AEE3	Bacteriophage	100.0	3.0e-20
WP_077995828.1|1339210_1340239_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	99.4	1.7e-194
WP_077995829.1|1340254_1340611_-|head	head decoration protein	head	A0A0C5AN05	Bacteriophage	97.5	6.3e-56
WP_149867713.1|1340607_1340970_-	hypothetical protein	NA	A0A0C5AEN1	Bacteriophage	100.0	1.7e-56
WP_077995831.1|1340978_1341728_-|protease	Clp protease ClpP	protease	A0A0C5AEN1	Bacteriophage	96.7	3.3e-131
WP_077995832.1|1341687_1343247_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	96.3	9.2e-293
WP_077995833.1|1343243_1343465_-	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	89.0	1.8e-29
WP_077995834.1|1343481_1345344_-|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	98.7	0.0e+00
WP_077995835.1|1345327_1345840_-	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	84.0	3.4e-71
WP_036654551.1|1346987_1347191_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0C5AC70	Paenibacillus_phage	100.0	1.5e-33
WP_077995836.1|1347221_1347632_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0C5AEN7	Bacteriophage	98.5	7.2e-72
WP_077995837.1|1347660_1347864_-	hypothetical protein	NA	A0A0C5ABQ7	Bacteriophage	98.5	5.2e-31
WP_024094814.1|1348334_1349645_-	purine/pyrimidine permease	NA	NA	NA	NA	NA
WP_077995839.1|1349783_1350413_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_036654509.1|1350404_1351088_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|1351108_1351978_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077995840.1|1352054_1352441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995841.1|1352421_1353123_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_188318623.1|1353350_1353455_-	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_077997537.1|1353538_1354066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995842.1|1354149_1354986_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_104932757.1|1354972_1355989_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_077997539.1|1355993_1356770_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077995843.1|1356841_1357858_+	GDP-mannose 4,6-dehydratase	NA	M4QPK0	Synechococcus_phage	34.6	2.3e-34
WP_077995844.1|1357939_1358659_-	glycosyltransferase	NA	K7Z8A5	Megavirus	23.6	2.1e-10
WP_023482889.1|1358666_1359572_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A291LAD7	Escherichia_phage	25.7	1.2e-15
WP_077995845.1|1359568_1360369_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_077995846.1|1360394_1361381_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	33.4	1.6e-40
WP_077995847.1|1362460_1363921_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_077995848.1|1364194_1364566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995849.1|1364565_1365702_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077995850.1|1365676_1366867_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077995851.1|1366863_1367586_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	40.9	1.8e-46
WP_188318624.1|1367840_1369460_-|tail	WIAG-tail domain	tail	NA	NA	NA	NA
WP_077995853.1|1371195_1371408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995854.1|1371404_1371932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995855.1|1372108_1372486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867714.1|1372516_1372879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995857.1|1372946_1375514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654846.1|1375641_1375980_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_023482876.1|1377627_1378410_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_077995858.1|1378966_1379569_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995859.1|1379872_1380556_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	99.6	1.8e-123
WP_104932657.1|1380576_1381446_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
>prophage 8
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	1454914	1514348	4411148	tRNA,transposase,terminase,holin,head,tail,integrase,portal,coat,capsid	Paenibacillus_phage(60.78%)	79	1473939:1473955	1514356:1514372
WP_104932657.1|1454914_1455784_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_024094875.1|1455932_1456613_-	LrgB family protein	NA	NA	NA	NA	NA
WP_023483267.1|1456609_1456981_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_036654876.1|1457103_1457997_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995894.1|1458353_1458929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995895.1|1459039_1460188_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_077995896.1|1460215_1460455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155116295.1|1460477_1460630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483263.1|1460748_1461891_+	MFS transporter	NA	NA	NA	NA	NA
WP_077995897.1|1462090_1462441_+	DNA primase	NA	NA	NA	NA	NA
WP_077995898.1|1462442_1463084_-	SCO family protein	NA	NA	NA	NA	NA
WP_096761322.1|1463174_1464101_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_024094881.1|1464345_1466358_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	3.2e-11
WP_023483257.1|1466965_1467445_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_077995899.1|1467483_1467762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654885.1|1467849_1468833_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_023483255.1|1468969_1469194_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	47.8	5.6e-10
WP_042119744.1|1469320_1469506_+	DUF5325 family protein	NA	NA	NA	NA	NA
WP_036654887.1|1469698_1470685_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077995900.1|1471063_1472527_-	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_036654889.1|1472694_1473333_-	ribonuclease H family protein	NA	NA	NA	NA	NA
1473939:1473955	attL	TGTGGGCAAAATGTGGG	NA	NA	NA	NA
WP_077995901.1|1474074_1474461_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_077584997.1|1474672_1474759_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_158672803.1|1474854_1475082_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	85.1	3.0e-27
WP_077995903.1|1475550_1475736_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	82.0	3.6e-23
WP_077995904.1|1475821_1476085_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	97.7	1.4e-41
WP_077995905.1|1476213_1476597_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	99.2	1.4e-69
WP_077995906.1|1476590_1476932_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.2e-57
WP_036654509.1|1477102_1477786_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932814.1|1477938_1478574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995908.1|1478608_1479325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995909.1|1479460_1479703_-|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	96.2	1.1e-32
WP_077997545.1|1479712_1480381_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A2I7SD00	Paenibacillus_phage	96.4	2.5e-130
WP_024094328.1|1480380_1480620_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
WP_077995910.1|1480799_1481132_-	hypothetical protein	NA	A0A2I7SBZ3	Paenibacillus_phage	87.2	8.2e-50
WP_077995911.1|1481141_1481894_-	hypothetical protein	NA	A0A0K2CZJ3	Paenibacillus_phage	98.0	4.8e-82
WP_077995912.1|1481896_1483369_-|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	53.9	1.2e-124
WP_077995913.1|1483368_1484070_-	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	42.1	2.9e-44
WP_149867716.1|1484072_1485209_-	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	65.1	1.1e-16
WP_077995249.1|1485563_1486784_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077995915.1|1486842_1488639_-	tape measure protein	NA	M1IEW1	Bacillus_virus	39.8	1.3e-53
WP_104932815.1|1488659_1488959_-	phenylalanine racemase	NA	A0A097PAX1	Streptococcus_pyogenes_phage	47.4	3.7e-17
WP_077997546.1|1489072_1489375_-	segregation and condensation protein B	NA	NA	NA	NA	NA
WP_077995917.1|1489377_1489896_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	71.6	1.0e-51
WP_077995918.1|1489909_1490320_-	DUF5072 family protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	44.1	1.7e-33
WP_036658585.1|1490324_1490660_-	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	37.2	2.4e-09
WP_077995919.1|1490665_1490971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995920.1|1490967_1491288_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_077995921.1|1491290_1491839_-	hypothetical protein	NA	A7J297	Streptococcus_phage	49.2	7.2e-35
WP_077995249.1|1491917_1493138_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077995922.1|1493179_1493545_-	hypothetical protein	NA	A7J297	Streptococcus_phage	55.3	1.2e-25
WP_077995923.1|1493557_1494148_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_077995924.1|1494234_1495128_-|capsid	minor capsid protein	capsid	S5MTV5	Brevibacillus_phage	33.9	8.7e-38
WP_077995925.1|1495036_1496449_-|portal	phage portal protein	portal	A0A1P8BLJ1	Lactococcus_phage	49.3	7.4e-116
WP_188318628.1|1496449_1497871_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	69.2	3.0e-189
WP_077997548.1|1497863_1498361_-|transposase	transposase	transposase	A0A0E3U2Q7	Fusobacterium_phage	65.2	6.7e-40
WP_077995926.1|1498576_1499200_-	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_077995927.1|1499165_1499405_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	75.4	9.8e-21
WP_158672804.1|1499522_1500626_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SC33	Paenibacillus_phage	89.6	4.2e-183
WP_077995929.1|1500642_1500864_-	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	94.5	5.5e-34
WP_077995930.1|1500867_1501263_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7SC39	Paenibacillus_phage	97.7	6.9e-72
WP_188318629.1|1501243_1501648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995932.1|1501816_1504069_-	AAA family ATPase	NA	A0A2I7SC35	Paenibacillus_phage	99.9	0.0e+00
WP_077995933.1|1504073_1504403_-	hypothetical protein	NA	A0A2I7SC50	Paenibacillus_phage	99.1	1.9e-62
WP_077995934.1|1504399_1505989_-	DEAD/DEAH box helicase	NA	A0A2I7SC38	Paenibacillus_phage	98.9	1.4e-301
WP_023485397.1|1505998_1506499_-	hypothetical protein	NA	A0A2I7SC41	Paenibacillus_phage	100.0	3.1e-93
WP_051427849.1|1506523_1507222_-	hypothetical protein	NA	A0A2I7SC26	Paenibacillus_phage	100.0	5.2e-139
WP_077995935.1|1507253_1508357_-	ATP-binding protein	NA	A0A2I7SC30	Paenibacillus_phage	99.2	7.6e-209
WP_077995936.1|1508356_1509667_-	AAA family ATPase	NA	A0A2I7SC23	Paenibacillus_phage	76.4	2.5e-174
WP_077995937.1|1509727_1510438_-	hypothetical protein	NA	A0A2I7SC22	Paenibacillus_phage	98.3	5.7e-125
WP_023484471.1|1510487_1510859_-	hypothetical protein	NA	A0A2I7SC29	Paenibacillus_phage	100.0	3.4e-60
WP_051427850.1|1510888_1511173_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	100.0	3.8e-48
WP_077995938.1|1511169_1511409_-	hypothetical protein	NA	A0A2I7SC43	Paenibacillus_phage	75.9	2.2e-25
WP_077995939.1|1511424_1511679_-	hypothetical protein	NA	A0A0K2CYH1	Paenibacillus_phage	43.4	2.8e-10
WP_077995940.1|1511650_1511872_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077995941.1|1511956_1512199_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	69.3	2.4e-22
WP_077995942.1|1512323_1512656_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	55.8	2.7e-16
WP_077995943.1|1512665_1513127_+	ImmA/IrrE family metallo-endopeptidase	NA	R9TQI1	Paenibacillus_phage	64.1	8.7e-50
WP_077995944.1|1513208_1514348_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	39.6	4.2e-61
1514356:1514372	attR	TGTGGGCAAAATGTGGG	NA	NA	NA	NA
>prophage 9
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	1595097	1719569	4411148	protease,transposase,holin,integrase	Paenibacillus_phage(20.0%)	111	1596961:1596975	1726816:1726830
WP_077995988.1|1595097_1595643_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	37.4	7.0e-22
1596961:1596975	attL	GATTATATTTCATTT	NA	NA	NA	NA
WP_077995989.1|1597334_1600562_+	lantibiotic dehydratase	NA	A0A2H4PQG8	Staphylococcus_phage	24.4	1.1e-77
1596961:1596975	attL	GATTATATTTCATTT	NA	NA	NA	NA
WP_158672808.1|1600554_1601910_+	lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_077995991.1|1602198_1603515_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_077995992.1|1603803_1604787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995993.1|1605134_1606658_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_077995994.1|1606585_1607152_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_036658223.1|1607191_1607470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_188318632.1|1607574_1607889_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	46.3	3.2e-11
WP_188318633.1|1607779_1608148_+	ATP-binding cassette domain-containing protein	NA	W8CYT2	Bacillus_phage	50.9	1.2e-09
WP_077995995.1|1608265_1609063_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_149867718.1|1610930_1611959_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_158672809.1|1612261_1612651_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_077997553.1|1612626_1613379_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_188318650.1|1613475_1614660_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_036658210.1|1614694_1616254_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_024094951.1|1617019_1617268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658206.1|1617274_1617538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094953.1|1617721_1618663_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077996000.1|1618844_1619465_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_077997554.1|1619680_1620871_-	MFS transporter	NA	NA	NA	NA	NA
WP_023484416.1|1620906_1621596_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149867719.1|1621795_1622110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996002.1|1622561_1623833_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.0	1.4e-09
WP_077996004.1|1624070_1624565_-	DUF4261 domain-containing protein	NA	NA	NA	NA	NA
WP_155116244.1|1624580_1624724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996005.1|1624927_1625458_+	lysoplasmalogenase	NA	NA	NA	NA	NA
WP_149867720.1|1625452_1626217_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_104932770.1|1626487_1627228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996008.1|1627409_1627634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996009.1|1627732_1628347_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077996010.1|1628378_1630295_-	AAA family ATPase	NA	Q331U3	Clostridium_botulinum_C_phage	35.2	3.2e-05
WP_077996011.1|1630554_1631841_+	MFS transporter	NA	NA	NA	NA	NA
WP_077996012.1|1632068_1632401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036658190.1|1632719_1632989_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077997555.1|1633021_1633315_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_023483432.1|1633566_1633857_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077996013.1|1633853_1636364_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036658187.1|1636468_1636765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|1637867_1639091_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077996014.1|1639246_1640695_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
WP_023483464.1|1640829_1641216_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_077996015.1|1641237_1641696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121056.1|1642387_1642537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867721.1|1642526_1643735_-	DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	36.5	1.7e-68
WP_077996017.1|1643982_1644144_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155121057.1|1644608_1644761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996018.1|1644750_1645359_-	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	34.5	1.1e-31
WP_077996019.1|1645401_1646106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996021.1|1647051_1647492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996022.1|1647624_1647996_-	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	42.0	1.8e-13
WP_077996023.1|1648263_1648563_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_149867722.1|1648596_1649031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996025.1|1649466_1650996_-	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	32.4	5.7e-37
WP_042118705.1|1651007_1651571_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_036658506.1|1651714_1651879_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_077996026.1|1651895_1653884_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_036658128.1|1653880_1654108_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_077996027.1|1655685_1656843_+	MFS transporter	NA	NA	NA	NA	NA
1655762:1655776	attR	AAATGAAATATAATC	NA	NA	NA	NA
WP_036658123.1|1657101_1657614_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1655762:1655776	attR	AAATGAAATATAATC	NA	NA	NA	NA
WP_077996028.1|1657631_1657904_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077997556.1|1658046_1658970_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	1.4e-30
WP_077996029.1|1659484_1659847_-	hypothetical protein	NA	A0A2I7SCG2	Paenibacillus_phage	80.0	9.9e-49
WP_104932772.1|1659860_1660310_-	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	80.8	5.0e-58
WP_077996030.1|1660890_1661865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996031.1|1661816_1662632_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	37.4	1.1e-36
WP_077996032.1|1662876_1663251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996033.1|1663226_1664141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|1664173_1665397_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997558.1|1665511_1665700_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	58.9	6.5e-12
WP_051428085.1|1665683_1665875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996034.1|1665927_1666674_-	ADP-ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	40.9	1.7e-31
WP_077996035.1|1669398_1670445_-	aminomethyl transferase family protein	NA	NA	NA	NA	NA
WP_077996036.1|1670447_1673240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996037.1|1673236_1673725_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_024093465.1|1673731_1674019_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_023484175.1|1674141_1674888_-	3-oxoacyl-ACP reductase FabG	NA	W8CYX9	Bacillus_phage	46.1	4.9e-10
WP_077996038.1|1674880_1675831_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_036655264.1|1675827_1676247_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024093462.1|1676252_1677407_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996039.1|1677582_1678530_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.5e-24
WP_042118638.1|1678922_1679975_+	Fic family protein	NA	NA	NA	NA	NA
WP_024093460.1|1680410_1682294_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.4	3.6e-94
WP_158672810.1|1683012_1683810_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_077996042.1|1683814_1684693_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_077996043.1|1687461_1688361_-	DUF91 domain-containing protein	NA	NA	NA	NA	NA
WP_188318666.1|1688510_1691675_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_104932817.1|1691735_1692362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996045.1|1692489_1693950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_188318634.1|1693934_1694375_-	DUF2399 domain-containing protein	NA	NA	NA	NA	NA
WP_077996047.1|1694371_1695238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121059.1|1695463_1695601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996048.1|1695889_1699240_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	22.9	2.0e-18
WP_158672811.1|1699250_1699661_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_077995375.1|1699742_1700966_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077996050.1|1700958_1701792_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_077996051.1|1701848_1703306_-	SAM-dependent DNA methyltransferase	NA	A0A1W6JNK1	Staphylococcus_phage	28.6	4.2e-21
WP_077584997.1|1703856_1703943_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_149867724.1|1704116_1704626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996053.1|1705322_1708496_-	type 2 lantipeptide synthetase LanM family protein	NA	NA	NA	NA	NA
WP_077996054.1|1708597_1708819_-	mersacidin/lichenicidin family type 2 lantibiotic	NA	NA	NA	NA	NA
WP_077996055.1|1708919_1710074_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996056.1|1710079_1710778_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	3.1e-14
WP_077996057.1|1710793_1711804_-	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	28.9	1.2e-22
WP_051428052.1|1711800_1712049_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_188318635.1|1712254_1712419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997560.1|1714894_1716832_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.2	1.0e-11
WP_158672813.1|1717148_1717433_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077996060.1|1717446_1718118_-	antA/AntB antirepressor family protein	NA	O48391	Streptococcus_phage	68.8	9.8e-18
WP_149867726.1|1718904_1719276_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158672814.1|1719401_1719569_-|transposase	transposase	transposase	NA	NA	NA	NA
1726816:1726830	attR	GTCGGTAAAGTACAG	NA	NA	NA	NA
>prophage 10
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	1813153	1863856	4411148	tRNA,transposase,holin	Paenibacillus_phage(43.75%)	54	NA	NA
WP_077996096.1|1813153_1814323_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_077996097.1|1814351_1814939_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_024093346.1|1815219_1815648_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024093345.1|1815928_1816558_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996098.1|1816601_1817495_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_036657132.1|1818163_1819312_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.6	8.9e-27
WP_077996099.1|1819735_1821037_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_077996100.1|1822061_1823069_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_024093340.1|1823732_1824347_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	62.6	7.5e-73
WP_077996101.1|1824464_1827083_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996102.1|1827143_1828130_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024093337.1|1828126_1828903_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996103.1|1828918_1829866_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	3.8e-23
WP_079940453.1|1830025_1830235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585258.1|1830583_1830739_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	46.0	9.8e-06
WP_036655317.1|1831050_1831353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996105.1|1832778_1833120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485170.1|1833344_1833737_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_036655319.1|1833831_1834737_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996106.1|1834729_1835656_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.9	1.0e-36
WP_023485173.1|1835860_1836667_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	45.2	1.3e-53
WP_077585259.1|1837113_1837542_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_023485175.1|1837686_1838040_-	DUF3905 domain-containing protein	NA	NA	NA	NA	NA
WP_077996107.1|1838043_1838910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996108.1|1839027_1839750_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_023485178.1|1839752_1840271_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_077996109.1|1840277_1840943_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_077996110.1|1840997_1841288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485180.1|1841546_1842233_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_077996111.1|1842372_1843395_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_077996112.1|1843391_1843928_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077996113.1|1844223_1844538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932657.1|1844557_1845427_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_036654509.1|1845447_1846131_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077996114.1|1846197_1846458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996115.1|1846547_1847033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996116.1|1847189_1848458_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	60.2	1.4e-28
WP_042118522.1|1848556_1848919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996117.1|1848997_1849330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867728.1|1849314_1849779_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996119.1|1850779_1851373_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_158672815.1|1851479_1851716_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	2.6e-26
WP_077995375.1|1851780_1853004_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077996122.1|1853765_1854449_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
WP_024093255.1|1854636_1855338_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	7.3e-32
WP_077996123.1|1855327_1856707_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	31.9	1.7e-19
WP_024093253.1|1856864_1857386_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_077996124.1|1857459_1857942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996125.1|1857992_1858724_-	VOC family protein	NA	NA	NA	NA	NA
WP_077996126.1|1859123_1859915_+	YwmB family TATA-box binding protein	NA	NA	NA	NA	NA
WP_077996127.1|1859911_1860814_-	EamA family transporter	NA	NA	NA	NA	NA
WP_051427941.1|1861145_1862129_-	phosphotransferase	NA	NA	NA	NA	NA
WP_036654509.1|1862282_1862966_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|1862986_1863856_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
>prophage 11
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	1873462	1917210	4411148	transposase,bacteriocin,holin	Paenibacillus_phage(44.44%)	38	NA	NA
WP_077996132.1|1873462_1873867_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	55.3	5.1e-30
WP_077996133.1|1874085_1874334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093234.1|1874488_1874740_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158672816.1|1874805_1875399_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077995375.1|1875573_1876797_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077996135.1|1877436_1878645_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_077996136.1|1878634_1878862_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_077995249.1|1879211_1880432_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077996137.1|1880473_1880743_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024093230.1|1880745_1880916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483551.1|1880922_1881348_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996138.1|1882669_1883908_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_023483554.1|1884035_1884869_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077996139.1|1885316_1886123_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_077996140.1|1886305_1887484_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_077996141.1|1887532_1889893_-	UvrD-helicase domain-containing protein	NA	A0A1E1ETV1	Acanthamoeba_castellanii_mimivirus	25.5	2.9e-08
WP_036657148.1|1890136_1890592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996142.1|1890648_1891587_+	MFS transporter	NA	NA	NA	NA	NA
WP_077996143.1|1893706_1894975_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996144.1|1894967_1895873_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	4.7e-23
WP_077995375.1|1896175_1897399_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077996145.1|1898825_1899692_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_024093219.1|1899818_1900133_-	cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_077996146.1|1900137_1900755_-	cytochrome (ubi)quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_077996147.1|1902747_1903755_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_023483567.1|1904293_1904878_+	guanylate kinase	NA	A0A0K2FM14	Brevibacillus_phage	28.3	2.9e-10
WP_036655364.1|1905155_1906292_+	conserved virulence factor C family protein	NA	NA	NA	NA	NA
WP_023483569.1|1906467_1907457_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_077996149.1|1907781_1908087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996150.1|1908197_1908887_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104935376.1|1908802_1909765_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	50.6	3.1e-57
WP_077996153.1|1910016_1911990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996154.1|1912285_1912642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996155.1|1912638_1913334_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.9	1.2e-18
WP_024093206.1|1914191_1914569_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_188318637.1|1914933_1915101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655372.1|1916573_1916756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996157.1|1916910_1917210_+|bacteriocin	uberolysin/carnocyclin family circular bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 12
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	1935634	1943330	4411148	tRNA	Pneumococcus_phage(33.33%)	6	NA	NA
WP_077996172.1|1935634_1936153_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.1	2.2e-49
WP_024093191.1|1936179_1936917_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	41.8	4.2e-54
WP_077996173.1|1936909_1937395_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	68.2	7.7e-57
WP_077996174.1|1937391_1938063_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	58.3	1.4e-67
WP_077996175.1|1938611_1940315_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.3	4.0e-76
WP_077996177.1|1941347_1943330_+	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	32.7	2.0e-42
>prophage 13
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	1965075	2028496	4411148	transposase,protease,integrase	Paenibacillus_phage(35.71%)	51	1987324:1987383	2000568:2002290
WP_077995397.1|1965075_1966299_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_188318639.1|1966724_1967231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655414.1|1967872_1968178_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_077996189.1|1968187_1968517_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_077996190.1|1968864_1969731_-	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_077996191.1|1969720_1971160_-	menaquinone biosynthesis decarboxylase	NA	NA	NA	NA	NA
WP_024093162.1|1972482_1974405_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_077996192.1|1974537_1975341_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_036655420.1|1975356_1976223_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	28.9	4.2e-13
WP_077996193.1|1976198_1977032_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	33.7	2.4e-21
WP_077997564.1|1977067_1977637_-	Gx transporter family protein	NA	NA	NA	NA	NA
WP_077997565.1|1977614_1978013_-	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_077996194.1|1978293_1979361_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_036655424.1|1979808_1981038_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158672820.1|1981563_1983162_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_158672821.1|1983235_1983634_-|transposase	transposase	transposase	A0A2I7RFB5	Vibrio_phage	34.5	9.9e-10
WP_077996198.1|1984222_1984567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996199.1|1985084_1985474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995782.1|1985458_1986028_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077996200.1|1986600_1987083_+	hypothetical protein	NA	NA	NA	NA	NA
1987324:1987383	attL	TGAACTGACCCCTGTCAAGTAGACAGTGTAAAAAACAAAAAAAGTTGTGGCACTAACCAT	NA	NA	NA	NA
WP_104932621.1|1987402_1988272_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|1988292_1988976_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077996201.1|1989424_1989739_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	41.6	4.0e-14
WP_158672822.1|1989830_1990250_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077996203.1|1990788_1991208_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996204.1|1991214_1991868_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_188318640.1|1997120_1998878_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	7.0e-15
WP_036654509.1|1998974_1999658_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|1999678_2000548_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077996206.1|2000687_2004383_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	30.8	2.3e-76
2000568:2002290	attR	ATGGTTAGTGCCACAACTTTTTTTGTTTTTTACACTGTCTACTTGACAGGGGTCAGTTCACTCGCATGGAGGCTTTTCCCTTTATGTTTCGAAAAAATGACTTCTAAGCGGGAGGAAACTATGTTTACGGTAAAAAAACAATATCATTCAAGTCATCAGTCACTGCCTGTGCTGCAAATTCCTTTGGATGCCGCACGGCATGTCAGAACATATAAATATACCCAAACGGAAAACTCTGTTCCTTCTGCAATCAACCGGTTGTTGGCAGACCACAAGGACCTTCAGGTCCTCCTGCTGACAGCCTATTTTTCTTGGATGTACCGGTTATCCGGTGAAAAAGAACTGGCTGCCGGCATAGAAGGGAAAAGCGGAACCCTCTTCCCTCTTAAGCTCTCTTTGGAGAACATTCACACTTTTGAGGCTCTGGAAGAACTAATTCGAAACCAATTGGCCGGAATCCCGGAACAATCCGAAAACTTTGAAGAAGAAGCCCTTCAAACAGACACTTTCTTTCTGTGCCATTCCGGATTTCCGGAGAACGAGGAAAAAGGCCCCATTATCAGTTGGCTGGTCCGGGTGAATACGAAAGGAAAATTCTCTATCCTAATCCGGTATGATGCTTCCCTGCTCAGTCCAGATTCTGTGAAACGCTTCTCTTCCTATTTTCTAACCCTGCTTCAAGCTGCGGGAAACCGACCGGATCAGCGGATTAACAGTGTGGACATCTTGACGGATGAAGACCTGAATATGTATCAGAAGCTGAACCGGACTGAAACTCCTTATCCTGAGAATCAGACGATACACGGGATGTTCGAACAAGCCGCCAGCCGCTTTCCCGAACATCTTGCCCTGGCTTCACAACAAGAAGAATATACATATGCGGCACTAAACCGAAGAGCCAATCAAATCGCTCATCTTCTCCTTGAAAAAGAGGTAAGGAAGGGTGACTTTGTTACCATTTTTATGGACCGGAGTCTGGAAACTATCATCAGTCTGCTTGGCATTATGAAAGCGGGCGGTGTCTACGTCCCGGTAGACCCTGATCACCCTGAAGAACGAAATAGCTATATTGTGGAAGATACCCGTTCCGCTTTTATCCTGACTAAACAGATTTACGCGGATAAGGCCAGACATCTGAGTACTCCCATAACGTCAGTAAAGGAAATTGTACCAATAGATAGCAAAGATTTGGACAACTATCCTGCCGACAATCCGGGTGTCCATGTAGATCCGGATGACTTGGCTTATATTATTTACACTTCCGGATCGACGGGCAAACCGAAAGGAGCGCTTATTGCCCATAGAGGCGTGGTAAATCTGGGATTTGTCGTGAAAGAACAGTGCGGAATCAGTGAGCGGGAGGTCCTGACACAATTTGCCACGTACAGCTTTGATGCTTCTGTGTGGGATACGATCGGAGCCCTGTTTTTCGGTGCGAAGCTGTACCTGCTTTCCGCGGAAGAGAGAGTATCGGTTGAGGAATTCGCTGATGCCATCGAGCGGACAGGGACAACTATTATCACCATTTTACCGACCGTCTTTTTCAATCAGCTGGCCACCTACCTCTCAGATGAGGGGTATACCAAACTGAAAAAAGTCAAGCTGATTACCGTAGCAGGGGAAGCCCTGTATGGTGAACTCGTCCGTTCCGTCCAGCGGAAGTTCGGAGAGCATATTGAGATCATCAACGTCTATGGGCCTACGGAATGTACGGTCTGTACTA	NA	NA	NA	NA
WP_023485438.1|2004447_2004870_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_036655428.1|2004887_2005760_-	PTS N-acetylgalactosamine transporter subunit IID	NA	NA	NA	NA	NA
WP_024093152.1|2007214_2007940_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036655432.1|2008171_2008600_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996207.1|2008961_2009150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996208.1|2009194_2009404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996210.1|2010355_2010622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996211.1|2010610_2011579_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_077996212.1|2011633_2012221_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	36.8	1.2e-11
WP_077996213.1|2012416_2015584_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_023485427.1|2015580_2016036_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996214.1|2016864_2017575_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_077996215.1|2017694_2019734_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.3	1.4e-11
WP_077585116.1|2020193_2020301_+	TipAS antibiotic-recognition domain-containing protein	NA	NA	NA	NA	NA
WP_077996216.1|2020802_2021129_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_077996217.1|2021854_2022904_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	41.2	2.6e-25
WP_077996218.1|2023336_2024566_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_188318641.1|2024902_2025223_-	lectin	NA	NA	NA	NA	NA
WP_024093143.1|2025514_2025700_+	sporulation killing factor	NA	NA	NA	NA	NA
WP_077996220.1|2025773_2026988_+	sporulation killing factor system radical SAM maturase	NA	NA	NA	NA	NA
WP_077996221.1|2027002_2028496_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 14
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	2499030	2544570	4411148	transposase,protease	Paenibacillus_phage(35.29%)	43	NA	NA
WP_104932621.1|2499030_2499900_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|2499920_2500604_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077996441.1|2500775_2501543_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	7.5e-22
WP_024092908.1|2501539_2501950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036657321.1|2502160_2502574_+	flagellar protein	NA	NA	NA	NA	NA
WP_024092910.1|2502682_2502943_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_158672701.1|2502975_2503479_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_077996443.1|2503491_2505051_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_077996444.1|2505063_2505969_+	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_077996445.1|2505979_2506543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996446.1|2506626_2507079_+	flagellar assembly protein FliW	NA	NA	NA	NA	NA
WP_077996447.1|2507086_2507326_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	49.0	1.0e-06
WP_077996448.1|2507740_2509210_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.6	6.5e-123
WP_077996449.1|2511030_2512212_+	flagellin	NA	NA	NA	NA	NA
WP_077996450.1|2512363_2512738_+	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_077996451.1|2512764_2514321_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_077996452.1|2514343_2514745_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_077996453.1|2514728_2515067_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_036654509.1|2515157_2515841_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|2515861_2516731_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_023485092.1|2517138_2517336_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	66.1	4.9e-18
WP_023485093.1|2517657_2518206_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_158672702.1|2518616_2519048_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077996455.1|2519980_2520490_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_077996458.1|2521785_2524293_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_096761233.1|2524336_2525452_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	3.2e-05
WP_077997600.1|2525585_2526401_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	32.0	1.6e-30
WP_077996459.1|2526609_2527692_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_077996460.1|2527765_2528992_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_077997601.1|2529049_2529334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932621.1|2529405_2530275_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|2530295_2530979_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077996461.1|2531044_2531569_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_077996462.1|2531622_2532837_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.1	4.8e-31
WP_104932623.1|2532833_2533799_+	ornithine carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	29.1	1.0e-23
WP_077996464.1|2533824_2535051_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_077996465.1|2535138_2536548_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_052337357.1|2536721_2538173_-	VanW family protein	NA	NA	NA	NA	NA
WP_077996466.1|2538590_2539277_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.5	3.8e-25
WP_077996467.1|2539266_2540187_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996468.1|2540339_2541611_+	peptidoglycan DD-metalloendopeptidase family protein	NA	S5M424	Bacillus_phage	44.3	1.4e-20
WP_036657328.1|2541711_2543145_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.7	2.1e-25
WP_077996469.1|2543283_2544570_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 15
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	2862375	2927163	4411148	transposase,bacteriocin	Paenibacillus_phage(43.75%)	60	NA	NA
WP_077996638.1|2862375_2862630_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077996640.1|2863113_2864214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121069.1|2864463_2864640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996641.1|2864804_2865311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996642.1|2865329_2865656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996644.1|2866571_2867453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996645.1|2867475_2868408_+	type III-B CRISPR module RAMP protein Cmr1	NA	NA	NA	NA	NA
WP_077996646.1|2868407_2870081_+	type III-B CRISPR-associated protein Cas10/Cmr2	NA	NA	NA	NA	NA
WP_077996647.1|2870080_2871076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172422807.1|2871196_2872114_+	type III-B CRISPR module RAMP protein Cmr4	NA	NA	NA	NA	NA
WP_042118428.1|2872097_2872502_+	type III-B CRISPR module-associated protein Cmr5	NA	NA	NA	NA	NA
WP_149867747.1|2872575_2873334_+	type III-B CRISPR module RAMP protein Cmr6	NA	NA	NA	NA	NA
WP_188318664.1|2873629_2873794_+	hypothetical protein	NA	A0A1X9I5T2	Streptococcus_phage	54.5	2.5e-07
WP_077996650.1|2875234_2875906_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	3.6e-12
WP_024093118.1|2875902_2876073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996651.1|2878035_2878524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996653.1|2879975_2881232_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_077996654.1|2881399_2882587_+	alanine racemase	NA	NA	NA	NA	NA
WP_172423825.1|2882830_2883103_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_023485406.1|2883106_2883457_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	6.9e-15
WP_104932789.1|2883628_2885833_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_077997616.1|2886034_2886601_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_023485404.1|2886998_2887457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093128.1|2887541_2887769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996655.1|2888024_2888588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996656.1|2888557_2889223_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	39.5	2.2e-33
WP_096761197.1|2889531_2889639_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_077996657.1|2889800_2890157_-	hydrolase/acyltransferase	NA	NA	NA	NA	NA
WP_077996658.1|2890255_2890726_+	SprT family protein	NA	NA	NA	NA	NA
WP_077996659.1|2892436_2893201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996660.1|2893500_2894091_+	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	24.9	1.1e-12
WP_077996661.1|2894102_2894393_+	hypothetical protein	NA	E2ELK3	Clostridium_phage	50.5	1.5e-18
WP_188318551.1|2894392_2894551_+	hypothetical protein	NA	A0A2H4J054	uncultured_Caudovirales_phage	60.9	4.3e-09
WP_036655918.1|2894706_2894943_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.6	6.0e-31
WP_077996662.1|2895620_2895866_+|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	93.8	2.2e-31
WP_149867748.1|2896226_2896628_+	hypothetical protein	NA	D2XR29	Bacillus_phage	45.1	3.3e-21
WP_036655919.1|2897351_2897798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996665.1|2898875_2899559_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.8	6.9e-120
WP_077996666.1|2900132_2901407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996667.1|2905573_2906545_+	hypothetical protein	NA	A0A2I7SCU7	Paenibacillus_phage	78.9	2.9e-143
WP_077996668.1|2906604_2907624_+	hypothetical protein	NA	A0A2I7SDE4	Paenibacillus_phage	61.5	1.9e-60
WP_077996669.1|2907640_2908048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932629.1|2908404_2909521_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	2.1e-153
WP_158672710.1|2909775_2910819_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077996671.1|2911154_2911565_+	YjdF family protein	NA	NA	NA	NA	NA
WP_023484396.1|2911692_2912118_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079940510.1|2912360_2913035_+	MFS transporter	NA	NA	NA	NA	NA
WP_077996673.1|2913035_2913500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484400.1|2914563_2914992_+	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	54.8	8.4e-23
WP_051427985.1|2915090_2915573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997618.1|2916221_2916419_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077996674.1|2918426_2920547_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_023485400.1|2920590_2921031_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_023485401.1|2921032_2922181_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_077996675.1|2922848_2923916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121070.1|2924177_2924342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867749.1|2924640_2925543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996677.1|2925920_2926172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996678.1|2926192_2926429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932636.1|2926974_2927163_+|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	62.5	1.9e-11
>prophage 16
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	2979643	3039462	4411148	tRNA,transposase,bacteriocin	Paenibacillus_phage(37.5%)	57	NA	NA
WP_023484860.1|2979643_2980369_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_023484862.1|2982133_2983372_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_023484863.1|2983638_2984139_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	3.4e-15
WP_023484864.1|2984184_2984385_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_023484865.1|2984424_2984784_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_077996712.1|2985272_2987018_+	biosynthetic-type acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	31.0	3.3e-65
WP_077996713.1|2987017_2987509_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_077996714.1|2987741_2988731_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_077996715.1|2988765_2990313_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	40.2	1.1e-08
WP_024095284.1|2990402_2990636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996716.1|2990648_2991176_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_077996717.1|2991172_2991874_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	1.6e-18
WP_149867754.1|2991866_2992904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995249.1|2993249_2994470_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077996720.1|2994974_2995310_-|bacteriocin	uberolysin/carnocyclin family circular bacteriocin	bacteriocin	NA	NA	NA	NA
WP_024095277.1|2997578_2998124_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_077997624.1|2998271_2998664_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_024095275.1|3000716_3000917_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_024095273.1|3001104_3001530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932657.1|3001644_3002514_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_036654509.1|3002534_3003218_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_036654509.1|3003554_3004238_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|3004258_3005128_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_023484880.1|3005234_3006215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996722.1|3006412_3007231_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_077996723.1|3007223_3008336_+	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_077996724.1|3008548_3009454_+	PAS-domain containing protein	NA	NA	NA	NA	NA
WP_104932621.1|3009525_3010395_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|3010415_3011099_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077996725.1|3011218_3011668_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_052337463.1|3011808_3012348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996726.1|3014170_3015526_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.1	5.3e-55
WP_077996727.1|3015566_3016673_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_024095265.1|3017289_3017679_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_023484889.1|3017900_3018335_+	universal stress protein	NA	NA	NA	NA	NA
WP_077996728.1|3018947_3019904_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.0	2.3e-121
WP_023484892.1|3019958_3020444_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	42.5	1.1e-31
WP_077996729.1|3020512_3020821_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_023484894.1|3020841_3021042_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	40.0	6.3e-05
WP_077997625.1|3023617_3024241_-	YcnI family protein	NA	NA	NA	NA	NA
WP_023484897.1|3024330_3025008_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036657484.1|3025004_3025811_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_077996730.1|3025957_3026341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996732.1|3027064_3027349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996733.1|3027521_3029207_+	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_077996734.1|3029516_3029873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996735.1|3030099_3030762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996736.1|3031075_3031270_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	37.3	8.0e-05
WP_024095256.1|3031669_3032371_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_077996738.1|3032728_3033961_+	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_077996739.1|3033985_3035224_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024095255.1|3035361_3035526_+	rubredoxin	NA	NA	NA	NA	NA
WP_077996740.1|3035597_3036305_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996741.1|3036580_3037234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996742.1|3037350_3038532_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_149867755.1|3038696_3038882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996743.1|3039339_3039462_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	3168450	3259253	4411148	transposase,terminase,head,holin,integrase,tail,portal,protease,capsid	Paenibacillus_phage(71.83%)	109	3173634:3173693	3241407:3243128
WP_077995397.1|3168450_3169674_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_023485364.1|3171448_3171820_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_023485363.1|3171896_3173408_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_077996802.1|3173431_3173668_+	hypothetical protein	NA	NA	NA	NA	NA
3173634:3173693	attL	TGATATGCTCCCCTTGCGGTAGACAGTTGAAATAATAAAACTGTTTACTGTAAGGAGGAG	NA	NA	NA	NA
WP_036654509.1|3173702_3174386_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|3174406_3175276_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077996804.1|3175474_3175891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996805.1|3176155_3176467_+	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_077996806.1|3176453_3176819_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077996807.1|3176865_3177507_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077996808.1|3177642_3178749_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_077996809.1|3178768_3179998_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_024093280.1|3180216_3180666_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.3	8.5e-42
WP_077996810.1|3180837_3181410_+	DUF1802 family protein	NA	NA	NA	NA	NA
WP_077996811.1|3181590_3182424_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.3	2.2e-06
WP_024093282.1|3182491_3183787_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_077996812.1|3183783_3185010_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.5	2.5e-112
WP_023485352.1|3184996_3185434_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A218MKD1	uncultured_virus	31.2	1.1e-12
WP_023485351.1|3185458_3186856_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_077997632.1|3186937_3188104_-|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	37.2	3.6e-60
WP_077996813.1|3188186_3188819_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	67.6	3.2e-79
WP_077996814.1|3188971_3189220_+	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	68.0	4.6e-21
WP_077997633.1|3189253_3189526_+	group-specific protein	NA	A0A1B1P7U4	Bacillus_phage	57.1	1.8e-23
WP_077996815.1|3189610_3189865_+	hypothetical protein	NA	A0A0C5AER7	Bacteriophage	91.5	1.3e-34
WP_077996816.1|3189861_3190233_+	hypothetical protein	NA	R9VW30	Paenibacillus_phage	90.0	8.5e-56
WP_077996817.1|3190229_3190454_+	hypothetical protein	NA	A0A0K2CZE0	Paenibacillus_phage	72.5	7.8e-20
WP_158672717.1|3190450_3190621_+	hypothetical protein	NA	A0A0K2CZS8	Paenibacillus_phage	92.0	8.2e-22
WP_077996818.1|3190625_3190814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996819.1|3190810_3191488_+	ORF6N domain-containing protein	NA	A0A2I7SCV5	Paenibacillus_phage	84.5	1.8e-59
WP_077996820.1|3191502_3191766_+	hypothetical protein	NA	A0A0C5AFB6	Paenibacillus_phage	70.1	5.7e-30
WP_155121034.1|3191944_3192112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996821.1|3192200_3193091_+	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	57.8	6.8e-83
WP_077996822.1|3193053_3193857_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	40.0	5.4e-47
WP_077996823.1|3193906_3194308_+	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	73.5	3.9e-46
WP_077996824.1|3194332_3194665_+	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	92.7	1.6e-53
WP_077996825.1|3194713_3195604_+	DnaD domain protein	NA	A0A0K2CY85	Paenibacillus_phage	86.5	2.7e-124
WP_077997634.1|3195494_3196316_+	ATP-binding protein	NA	A0A0K2CYY7	Paenibacillus_phage	96.8	8.6e-117
WP_077996826.1|3196433_3196664_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	98.6	9.7e-34
WP_077996827.1|3196644_3197166_+	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	53.5	1.5e-50
WP_077996828.1|3197347_3197578_+	hypothetical protein	NA	R9TMG2	Paenibacillus_phage	66.2	6.1e-20
WP_077996830.1|3198138_3198507_+	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	77.3	1.4e-13
WP_077996831.1|3198513_3198747_+	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	69.8	1.7e-14
WP_158672718.1|3198739_3199150_+	hypothetical protein	NA	A8ASP1	Listeria_phage	39.4	8.9e-14
WP_077996833.1|3199139_3199376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996834.1|3199403_3199841_+	transcriptional regulator	NA	A0A0K2CYZ6	Paenibacillus_phage	95.9	2.5e-70
WP_077996835.1|3200046_3200388_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	100.0	8.4e-58
WP_077996836.1|3200398_3201862_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.1	1.3e-123
WP_104932795.1|3202003_3202303_+	DUF3310 domain-containing protein	NA	E5DV94	Deep-sea_thermophilic_phage	42.9	4.8e-09
WP_077996839.1|3202483_3202798_+	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	86.5	8.3e-44
WP_077996840.1|3202784_3203126_+	HNH endonuclease	NA	A0A0K2CYS9	Paenibacillus_phage	98.2	4.4e-59
WP_077996841.1|3203259_3203577_+|terminase	phage terminase small subunit P27 family	terminase	A0A0C5AMZ2	Paenibacillus_phage	89.5	1.7e-44
WP_077996842.1|3203551_3205285_+|terminase	terminase large subunit	terminase	A0A0K2CZH9	Paenibacillus_phage	63.5	1.1e-214
WP_077996843.1|3205303_3206563_+|portal	phage portal protein	portal	A0A0A7RUE7	Clostridium_phage	22.9	4.9e-18
WP_158676621.1|3206519_3207101_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	34.0	4.4e-14
WP_158672719.1|3207112_3208297_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_158672720.1|3208298_3208595_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J6E5	uncultured_Caudovirales_phage	40.7	2.9e-14
WP_158672721.1|3208572_3208890_+|head	phage head closure protein	head	A0A0C5AE87	Paenibacillus_phage	92.4	2.2e-52
WP_077996848.1|3208889_3209318_+	hypothetical protein	NA	A0A0C5AJ13	Paenibacillus_phage	94.4	3.0e-68
WP_188318556.1|3209343_3209697_+	DUF3168 domain-containing protein	NA	A0A0C5AEH4	Paenibacillus_phage	82.1	1.8e-47
WP_077996850.1|3209698_3210133_+|tail	phage major tail protein, TP901-1 family	tail	A0A2I7SCY9	Paenibacillus_phage	95.8	2.0e-72
WP_077996851.1|3210132_3210477_+	hypothetical protein	NA	R9VWU7	Paenibacillus_phage	50.9	1.0e-23
WP_077996852.1|3210436_3210751_+	hypothetical protein	NA	A0A0C5AE91	Paenibacillus_phage	69.0	1.2e-26
WP_077996853.1|3210805_3213442_+|tail	phage tail tape measure protein	tail	A0A0C5AJ16	Paenibacillus_phage	95.9	8.0e-249
WP_158672724.1|3213438_3214314_+|tail	phage tail family protein	tail	A0A0C5AEI0	Paenibacillus_phage	46.0	5.0e-70
WP_158672725.1|3214316_3215447_+	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	33.8	1.7e-59
WP_077996856.1|3215451_3216639_+	hypothetical protein	NA	E2ELJ8	Clostridium_phage	48.7	8.8e-54
WP_188318557.1|3216707_3217418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996857.1|3217430_3217616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996858.1|3217633_3217816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672726.1|3217808_3217964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094415.1|3218004_3218244_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	100.0	2.8e-36
WP_077996859.1|3219187_3219430_+|transposase	transposase	transposase	A0A0C5AN23	Paenibacillus_phage	93.8	4.3e-32
WP_104932634.1|3220691_3221561_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|3221581_3222265_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077996860.1|3222692_3223286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996861.1|3223528_3224131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996863.1|3224484_3224886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121080.1|3224872_3225013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996864.1|3225162_3226032_+	hypothetical protein	NA	A0A2I7SC02	Paenibacillus_phage	45.3	1.3e-09
WP_024093293.1|3226294_3226534_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	96.2	4.1e-35
WP_077996865.1|3227281_3227527_+|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	88.9	2.8e-31
WP_077996866.1|3227713_3229111_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_104935363.1|3230143_3232747_+	RICIN domain-containing protein	NA	A0A0K2CYN4	Paenibacillus_phage	56.8	4.6e-265
WP_077996868.1|3233522_3235085_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_036654509.1|3235454_3236138_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_149867761.1|3236158_3236863_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	4.7e-103
WP_077996870.1|3236859_3237027_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	100.0	1.1e-23
WP_077996871.1|3237491_3237656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996872.1|3238948_3239569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932621.1|3239823_3240693_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|3240713_3241397_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_188318558.1|3241487_3242717_+	MFS transporter	NA	D0R099	Streptococcus_phage	22.6	3.4e-08
WP_077996875.1|3244404_3245037_+	hypothetical protein	NA	NA	NA	NA	NA
3241407:3243128	attR	CTCCTCCTTACAGTAAACAGTTTTATTATTTCAACTGTCTACCGCAAGGGGAGCATATCAAGATACAAAGGCTTTTTTAGTTTGCTTTTAGGAGCATTCTTTTCTAATATAGGTCATTCTATTGCTTTAATATCAATAATTTGGATGATTTATCAGAAGACTAATGATCCGTTTACAATTGTAGTAACACTAATTTGTTTAGAAGTTCCTACTATTGTATTTGGGCCGATTTTAGGTGTTCTATTAGATAAGTATAGAACTTCTATGCTTATGGGAATTGCAAATTTATCTAGAAGCGTCCTTTTTGTGTTTTTGATATTTATACCACTTAAAAATTATATAACGTATAGCGTTTTCTTTATATTGTTGACTATTTCAAGCTCTGTTATACCTATTACAAGGTCAGGAGAATATGTTCTATTAAATAAATTAATCCCAAAAGAAAAATTGGTAAGTGCAAATTCTATAATGAATATACAGTTTGATTTGGCTTTTACATTTGGACCTATGTTAGGTGGAGGGCTTATGGTTATTAACATAGGTAATAGTATTTTCATCATAAATGCTATTTTCTTGTTTTGCTCATCTATTTTATACTTTTTTGTAAAAGAACAAGAGTTAAGTGAAAAATGTACAGATGACCTAAAAAATAAAAAAGCATCGATCAAATCAAAGGAATGGTGGCAAGAATTTATTGAAGGAATCAAATTTATAAAATCTAATAAAACTATATTATATTTAGTGTTTATCAATTTCCTTTGGAATTTTTCAATTTGGGGAACTAGCCCAACTTTATCCCCTGTATATGCAAGGGATTACTTAAATATTGGTGCTGAAGGCTACGGTATGTTAGCTGCTACTAGCTCAGTAGGTATTATAGTAGGTTCATTTTTAGTTGGATTGAAGAAAATCAATTATCCTCCTACAACTATAGTGTTTATTTCTATTGCTTTGCATTCACTTTTATATAGCTTATTAGCTACTCAAAATCAATTAATAGGAGCAATAACTGTCAGTGTTTTAGGGGGAATTATGTCAGCTCCAGCTATGATATATCATCGAACCGCTTTACAAACTATAGTACCAGAAGAAAAAATGGGAAGGATATTCACAGTAAGTTCTACAGCAGGTGCTGCAGGGTTTCCAATAGGCAATTTTCTTGCAGCATATTCTATAGAGATTTTAGGTAAGCAAAGCATGATATGGGCTTTTGTTATTAATGGCAGTTTAGTGCTTCTACTATCTATTTTGTTTTTAACAAGTATCAATTATAAAGGTGGTAATTATGGTATCACATCAAATGATGATTAATTTAAATTTATATAAGCAATCTCTGTATGTTCCTACAAAATTCTCACAAAAGAGTGATATGGAAAAGATTCTAAAACAAGTAGTTTGTATACAATTGGATACCATTCAATGGTTGCCGCTAACCTAGTCCAATTTGTACCGATCCAATTAAATTGTTTCCAATAGTTCCATCCTAAGTATTTTCCGTTATCATCATATGTTAAGACTCTAACAGCGTACTCTTTTCCCGCAAGAACAGGATTTCCATCAGTGTCCAATACTGCATCATTATTAGCTGCATGAGTAGGTGTGATTGGAAATGTAAAAACCATTAACATTGCTACTATATAAGTTGAATCAATATTCTTAGCAAACCTTGGCAAGGAAAAAGGAACCATTTGTCGAATAAGAAACAGATCAAGAATAGACAAG	NA	NA	NA	NA
WP_104932796.1|3245130_3245277_+|holin	putative holin-like toxin	holin	A0A0K2CYN9	Paenibacillus_phage	100.0	2.8e-18
WP_077997637.1|3247905_3248943_+	amidinotransferase	NA	NA	NA	NA	NA
WP_077996877.1|3249369_3249570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672728.1|3250132_3250333_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	52.4	3.1e-12
WP_155121082.1|3250434_3250608_+	hypothetical protein	NA	A0A0C5AMZ7	Paenibacillus_phage	90.7	7.1e-13
WP_077996879.1|3250651_3250906_+	hypothetical protein	NA	A0A2I7SDE4	Paenibacillus_phage	86.4	9.4e-22
WP_077996880.1|3251051_3251459_+	hypothetical protein	NA	A0A2I7SDE8	Paenibacillus_phage	94.0	3.4e-66
WP_077995249.1|3251803_3253024_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077996881.1|3254101_3254290_-	hypothetical protein	NA	A0A2I7SC09	Paenibacillus_phage	78.7	9.1e-22
WP_077996882.1|3255107_3255512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996883.1|3255493_3255790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121084.1|3256326_3256491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996884.1|3256725_3257661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996885.1|3257684_3258074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121085.1|3258070_3258208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093300.1|3258926_3259253_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	3270610	3326235	4411148	coat,transposase,holin	Paenibacillus_phage(43.75%)	49	NA	NA
WP_104932652.1|3270610_3271474_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	2.8e-134
WP_077996122.1|3271496_3272180_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
WP_077585196.1|3272360_3272573_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_024093310.1|3272845_3273112_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_040932682.1|3273153_3273723_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_077996892.1|3274115_3274412_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	70.6	3.5e-12
WP_023484389.1|3274641_3275547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158225767.1|3275669_3275804_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024093313.1|3276750_3276948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996893.1|3277643_3278249_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.5	6.1e-51
WP_077996894.1|3278380_3278875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036657847.1|3279112_3279502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|3279666_3280350_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|3280370_3281240_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077996895.1|3281631_3282180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996896.1|3282206_3282461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996897.1|3282865_3285181_+	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	24.7	4.9e-32
WP_023483454.1|3285958_3286627_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996898.1|3286912_3288565_+	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_077996899.1|3288555_3289626_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_077996900.1|3291250_3292645_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_023483448.1|3292710_3293361_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_077996901.1|3293362_3294367_+	sugar kinase	NA	NA	NA	NA	NA
WP_158672833.1|3294340_3294472_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077996902.1|3294570_3296403_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_077996903.1|3296422_3297301_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_077996904.1|3299239_3299704_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_036658101.1|3299733_3300048_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_104932653.1|3300056_3301157_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_077996906.1|3301537_3303067_-	glycosyltransferase	NA	A0A0N7G7L1	Chrysochromulina_ericina_virus	32.4	5.9e-42
WP_077996907.1|3303284_3304151_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	31.4	1.1e-08
WP_077996908.1|3304266_3305406_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_077996909.1|3305402_3306044_+	acetyltransferase	NA	NA	NA	NA	NA
WP_077996910.1|3306061_3306784_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077996911.1|3307178_3307817_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_036656232.1|3310017_3310296_-	HU family DNA-binding protein	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
WP_023483458.1|3310396_3310603_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
WP_077997638.1|3312188_3314036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121046.1|3315068_3315212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932654.1|3315602_3316720_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	100.0	2.4e-154
WP_155116254.1|3316994_3317138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996914.1|3318037_3318478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996916.1|3318853_3319312_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_077996917.1|3320275_3320998_-	NTP transferase domain-containing protein	NA	H9NC64	Sphingomonas_phage	40.6	7.8e-45
WP_158672730.1|3321242_3321425_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_188318660.1|3322091_3322901_+	hypothetical protein	NA	A0A024B055	Bacillus_phage	43.6	3.3e-12
WP_077997639.1|3323205_3324087_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_188318661.1|3324791_3325520_+	C40 family peptidase	NA	D2KRB9	Lactobacillus_phage	33.0	1.6e-10
WP_023484075.1|3325836_3326235_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	43.5	1.1e-21
>prophage 19
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	3396285	3499050	4411148	tRNA,transposase,bacteriocin,tail,portal,coat	Brevibacillus_phage(23.33%)	102	NA	NA
WP_077585079.1|3396285_3396441_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077996959.1|3396823_3397228_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_023483403.1|3399100_3399745_+	KinB-signaling pathway activation protein	NA	NA	NA	NA	NA
WP_024095116.1|3403499_3404360_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	30.4	4.2e-21
WP_024095115.1|3404427_3405126_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_023483398.1|3405165_3405762_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_077996960.1|3405763_3406312_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	38.1	8.9e-17
WP_024095113.1|3406418_3406649_-	alpha/beta-type small acid-soluble spore protein	NA	A0A217EQS5	Bacillus_phage	41.8	1.6e-07
WP_024095112.1|3406761_3407232_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_077996961.1|3410841_3411138_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_077996962.1|3411288_3412152_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_077996963.1|3412316_3412802_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_077996964.1|3412843_3414298_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	45.2	2.7e-12
WP_077996965.1|3414526_3416266_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.8	3.8e-13
WP_172422976.1|3417211_3419833_+	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	33.3	3.1e-99
WP_036655218.1|3419855_3420149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996967.1|3420357_3420903_-	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_036655213.1|3421189_3422206_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_024095101.1|3422419_3422986_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_149867766.1|3423089_3423941_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.1	1.3e-06
WP_077996969.1|3423924_3425589_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.3	3.8e-10
WP_104932621.1|3425692_3426562_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|3426582_3427266_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_023483383.1|3427371_3428562_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_077996970.1|3428710_3428974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042119273.1|3429322_3430111_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996971.1|3430217_3431807_+	OPT/YSL family transporter	NA	NA	NA	NA	NA
WP_024095092.1|3432902_3433841_+	DUF1177 domain-containing protein	NA	NA	NA	NA	NA
WP_077997644.1|3433923_3434586_+	AroM family protein	NA	NA	NA	NA	NA
WP_077996972.1|3435681_3435939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996973.1|3436471_3436783_+	hypothetical protein	NA	F8WQ63	Bacillus_phage	46.7	4.4e-13
WP_077996974.1|3437147_3439478_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_077996975.1|3439538_3440396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996976.1|3440804_3441116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095080.1|3441265_3441427_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024095079.1|3441889_3442147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482424.1|3442256_3443312_+	nucleoid-associated protein	NA	A0A0A8WF33	Clostridium_phage	25.0	6.3e-11
WP_077996977.1|3443326_3444064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996978.1|3444168_3444807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996979.1|3444859_3445336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997645.1|3445653_3446016_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	40.7	7.9e-14
WP_077996980.1|3446116_3446572_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023482429.1|3448508_3448937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996983.1|3448911_3449094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996984.1|3449094_3450429_+|tail	phage tail sheath family protein	tail	A0A0A7S087	Clostridium_phage	46.4	1.7e-109
WP_077996985.1|3450430_3450892_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	60.3	2.1e-48
WP_077996986.1|3450911_3451334_+|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	41.8	4.4e-24
WP_149867767.1|3451705_3451957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996988.1|3451953_3453750_+	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	42.1	1.5e-126
WP_077996989.1|3453749_3454259_+	hypothetical protein	NA	S5MUH0	Brevibacillus_phage	47.8	8.4e-38
WP_149867768.1|3454255_3454390_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077996990.1|3454394_3455363_+	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	59.8	1.7e-111
WP_077996991.1|3455362_3455650_+	DUF2577 domain-containing protein	NA	S5MC71	Brevibacillus_phage	39.3	1.5e-15
WP_077996992.1|3455652_3456075_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	48.5	2.5e-27
WP_077997646.1|3457132_3457702_+	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	42.3	2.7e-32
WP_077996993.1|3457698_3457977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996994.1|3457980_3459753_+	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	45.2	3.2e-15
WP_077996995.1|3459765_3460161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121041.1|3460153_3460312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996996.1|3460350_3460590_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.7	6.3e-36
WP_104932656.1|3461510_3461741_+|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	100.0	3.9e-27
WP_155121040.1|3461887_3462055_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	78.1	6.2e-06
WP_077996997.1|3463500_3464523_+	lactate dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.5	6.3e-16
WP_077996998.1|3464704_3464911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995249.1|3465039_3466260_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_158672732.1|3466472_3467744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997000.1|3468425_3468773_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_077997648.1|3468823_3469168_-	DUF2512 family protein	NA	NA	NA	NA	NA
WP_023484507.1|3469352_3469556_+|coat	spore coat-like protein	coat	NA	NA	NA	NA
WP_024093574.1|3469574_3469877_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_023484509.1|3470703_3471843_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_077997001.1|3472027_3472381_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_023484510.1|3472392_3472824_+	EutP/PduV family microcompartment system protein	NA	NA	NA	NA	NA
WP_036655167.1|3473058_3473631_+	ANTAR domain-containing response regulator	NA	NA	NA	NA	NA
WP_077997002.1|3473623_3475048_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_077997003.1|3475189_3476620_+	ethanolamine ammonia-lyase reactivating factor EutA	NA	NA	NA	NA	NA
WP_077997004.1|3476649_3478014_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_077997005.1|3478035_3478986_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_023484516.1|3479004_3479658_+	ethanolamine utilization microcompartment protein EutL	NA	NA	NA	NA	NA
WP_077997006.1|3479669_3480410_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_077997007.1|3480560_3482024_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_036655161.1|3482073_3482361_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_077997008.1|3482505_3483333_+	cobalamin adenosyltransferase	NA	NA	NA	NA	NA
WP_077997009.1|3483344_3483983_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_024093587.1|3484001_3484685_+	putative ethanolamine utilization protein	NA	NA	NA	NA	NA
WP_036655159.1|3484697_3484970_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_036655157.1|3484962_3485508_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_077997010.1|3485527_3486643_+	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
WP_077997011.1|3486981_3487833_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_024093592.1|3487960_3488125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093593.1|3488172_3488334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655155.1|3489269_3489464_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077997012.1|3489797_3490265_+	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	30.5	3.5e-22
WP_144029556.1|3491190_3491493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997013.1|3491509_3492034_+	VanZ family protein	NA	NA	NA	NA	NA
WP_077997014.1|3492103_3492517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997015.1|3492789_3493092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997016.1|3493476_3493914_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_077997017.1|3494502_3495558_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	30.5	1.7e-16
WP_077997019.1|3495954_3496593_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_077997020.1|3496881_3497943_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_077997021.1|3497997_3499050_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
>prophage 20
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	3633965	3704412	4411148	transposase,protease,holin,integrase	Paenibacillus_phage(42.11%)	61	3633193:3633252	3702770:3704491
3633193:3633252	attL	TGATATGCTCCCCTTGCGGTAGACAGTTGAAATAATAAAACTGTTTACTGTAAGGAGGAG	NA	NA	NA	NA
WP_104932621.1|3633965_3634835_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077997100.1|3634915_3635431_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_077997101.1|3635759_3636284_+	DUF1572 family protein	NA	NA	NA	NA	NA
WP_077997102.1|3636471_3637122_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	29.3	7.5e-07
WP_036657973.1|3637282_3637534_+	YqzE family protein	NA	NA	NA	NA	NA
WP_079940316.1|3637584_3638598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997104.1|3638719_3639739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997651.1|3641707_3642550_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_024094992.1|3642666_3643515_-	D-amino-acid transaminase	NA	NA	NA	NA	NA
WP_149867772.1|3647059_3647602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036657983.1|3649224_3649404_+	DUF3973 domain-containing protein	NA	NA	NA	NA	NA
WP_077997106.1|3649967_3650582_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	55.1	5.6e-60
WP_077997107.1|3651324_3652074_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_077997108.1|3652628_3653060_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_036657987.1|3653230_3653893_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3T7R5	Bacillus_phage	51.9	1.3e-51
WP_077997109.1|3655403_3655799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158672736.1|3659813_3660800_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	25.7	1.7e-05
WP_077995375.1|3661365_3662589_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997111.1|3662772_3663969_+	MFS transporter	NA	NA	NA	NA	NA
WP_077997112.1|3664871_3665576_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_023483185.1|3665771_3666725_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A097BYJ7	Leuconostoc_phage	26.3	1.2e-05
WP_077997113.1|3668822_3669188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997114.1|3669298_3670081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997115.1|3670121_3670685_-	signal peptidase I	NA	NA	NA	NA	NA
WP_077997116.1|3670884_3671805_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_077997117.1|3672116_3674240_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	25.5	3.3e-11
WP_023483179.1|3674725_3675640_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	45.5	1.8e-70
WP_024094971.1|3675666_3677235_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_077997118.1|3677459_3678383_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077997119.1|3678568_3679564_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077997652.1|3679910_3680423_+	FUSC family protein	NA	NA	NA	NA	NA
WP_077997120.1|3680521_3681100_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_077997121.1|3681251_3682685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997122.1|3682714_3683704_-	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	40.0	2.4e-49
WP_158672737.1|3683991_3684483_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_077997124.1|3684622_3685252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997125.1|3685248_3686307_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077997126.1|3686363_3687302_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.0	7.8e-21
WP_077997127.1|3687294_3688074_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077997128.1|3688261_3689611_+	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	35.1	4.1e-71
WP_155121036.1|3689614_3689755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997129.1|3689738_3689951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997130.1|3690041_3690569_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_188318565.1|3691010_3691661_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_077997132.1|3691627_3692968_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_077997133.1|3692960_3694103_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_024094960.1|3694081_3694444_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_023483163.1|3694483_3694840_+	glycine-rich SFCGS family protein	NA	NA	NA	NA	NA
WP_158672739.1|3694843_3695182_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_036658006.1|3695202_3695988_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_023483159.1|3696696_3697803_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_023483158.1|3697806_3698541_+	oxo-acid lyase	NA	NA	NA	NA	NA
WP_024094956.1|3698770_3698926_-|integrase	phage integrase family protein	integrase	A0A0K2CZ62	Paenibacillus_phage	88.2	4.5e-19
WP_077997135.1|3698939_3699272_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	78.3	1.0e-44
WP_149867773.1|3699293_3699485_-	hypothetical protein	NA	A0A0K2CZ62	Paenibacillus_phage	76.2	1.6e-21
WP_077584997.1|3699730_3699817_+|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_077997137.1|3700369_3700585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995249.1|3700643_3701864_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077997138.1|3702035_3702242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|3702838_3703522_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|3703542_3704412_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
3702770:3704491	attR	TGATATGCTCCCCTTGCGGTAGACAGTTGAAATAATAAAACTGTTTACTGTAAGGAGGAGCATTTTTTCATGTCCCATAAAGCAAAAGTATCAGGATCAGAAAAGATTGCAGCTGTTGAAAAGTATTTACGTGGAGAAGATTCGCTTAATCATTTAGCAGCACTTCTTGATGTACGCCATTCATCCGTTAGGCAATGGCTTCAGACTTACCAGTCGCTAGGCCCAAACGGATTGCTTCAAACATCACAGAATGCATCTTACTCCGCAGAGTTAAAAAGAATAGCTGTCGAGGACTATTTGGCTGGCGGCGGTTCTCACATGGATATTTGTAAAAGATATGGCATTAAGTCAACTTGCCAATTGCGGGATTGGATTCTGAAGTATAATAGTCATGAGAAGTTGAACACTTCCGGAACGGGAGGAGTGCCGATCATGACAAAAGGACGAACAACTACTTACGATGAGAGAGTTGAAATCGTCAGATTCTGCATTGAACATCAACACAATTATGCCCAGACAGCTGATAAATTCCAGGTATCCTATCAGCAAGTTTATTCATGGACAAATAAATACTTAACATCTGGTGTGGATGCACTTCAGGACAGACGCGGGAAAAGAAAATCTGAGGATGAGATGTCCGAAGTGGAGAAACTAAGGGCTCAGAATAAGCTGTTACAGGCTGAGAACAGAAGGAAGCAGATGGAGATCGATTTGCTAAAAAAGTTGGACGAGATCGAAAGGAGGCGGTTCTAAGCCAGGTAAGGTATGAAACGATATACCTTGCAATACGCGGGCTCCGTGAAACGAAGTCATATCCCATATGTCAATTATGTGATCTTATTGGGATCCAACGTTCATCGTATTATAAATGGATCAACCGGAAAGAAAGTATTAATGAGATCTTTAATAAAGCGTTGCTTCCCATGATTAAAGATGCCTACGAGGAAAAGGATGGCATCCTTGGATATCGCCAGATGACCATTAAACTAAACCGGGAACGCCATGTAACTGTCAATCATAAGCGAATATACAGACTTATGGGCATCCTAGGCCTTAAATCGGTATGCCGCAGGAAGCGAAAAAACTACATCCATTCCACACCTGAAATTACGGCGGAAAATATCCTGAACAGAGACTTTGAATCCTCTGAGTTTGGTACGAAATGGCTCACAGATGTGACTGAAATGAAGTATGGCAACCAAAACAAGGCTTATCTTAGTGCAATCCTTGATTTGTCGGATAAAAGCATTGTTTCTTTTGTGGTAGGGCATTCCAACAACAATGAACTTGTATTTAAAACTTTTGATATCGCCCATATGACTTATCCTGACGCTACACCCCTCTTTCACAGTGACCGGGGTTTCCAATATACATGTAAAATCTTCAAGAAAAAACTAGACGATGCAGGTATGATCCAAAGCATGTCCAGGGTATCCAGATGTATAGATAATGGCCCAATGGAATCATTCTGGGGAATGATGAAATCCGAAATGTATTATCTTCGTAAGTTCTATACATATGAGGAACTGGAAGCAGCCGTGATAGAATACATCGATTACTACAATACTCGTCGATACCAGAAAAGACTTAATTGTATGACGCCGTTGGAATATAGGCAATACCTTCTAAGTTCAGCAGCATAGAAAATGGCACCAACCATGTATGGTTAGTGCCACAACTTTTTTTGTTTTTTACACTGTCTACTTGACAGGGGTCAGTTCA	NA	NA	NA	NA
>prophage 21
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	3821372	3828124	4411148		uncultured_Mediterranean_phage(50.0%)	6	NA	NA
WP_023482600.1|3821372_3821810_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.3	1.6e-21
WP_023482602.1|3823869_3824535_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.3	3.4e-39
WP_077997196.1|3824569_3825802_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.3	5.6e-112
WP_024093718.1|3825833_3826304_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.9	6.2e-43
WP_077997197.1|3826731_3827514_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.3	1.3e-08
WP_036658393.1|3827482_3828124_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.9	8.2e-14
>prophage 22
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	3987285	4027621	4411148	transposase,protease	Paenibacillus_phage(77.78%)	38	NA	NA
WP_077995397.1|3987285_3988509_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_158672748.1|3988573_3989539_+	hypothetical protein	NA	S5W9C6	Leptospira_phage	41.5	1.1e-09
WP_077997274.1|3989609_3989978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997275.1|3989974_3990235_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_077997276.1|3990284_3990593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997277.1|3990570_3990897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867784.1|3990976_3991279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997661.1|3991185_3991449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997279.1|3991461_3991767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|3992006_3993230_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997280.1|3994139_3994754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_188318571.1|3994792_3995062_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_077997282.1|3995058_3995835_+	RHS repeat-associated core domain-containing protein	NA	S5W9C6	Leptospira_phage	37.2	3.5e-11
WP_149867785.1|3999028_3999328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|3999684_4000908_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997286.1|4001508_4001913_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077997287.1|4001923_4002655_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_077997288.1|4003727_4004744_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_036654509.1|4004810_4005494_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|4005514_4006384_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077997289.1|4006500_4007355_+	alpha amylase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_077997290.1|4007351_4008500_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_188318572.1|4008506_4009028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_188318573.1|4009024_4009615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997291.1|4009645_4011091_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_024093827.1|4011565_4011796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867786.1|4012112_4012451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997294.1|4012786_4013362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997662.1|4015213_4016740_-	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_077997296.1|4018636_4019878_+	arginine deiminase	NA	NA	NA	NA	NA
WP_077997663.1|4019895_4020894_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_042118868.1|4022419_4023373_+	carbamate kinase	NA	NA	NA	NA	NA
WP_024093834.1|4023411_4024098_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_023482955.1|4024153_4024651_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_077997297.1|4025085_4025406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|4025510_4026194_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932634.1|4026214_4027084_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_023482953.1|4027195_4027621_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 23
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	4031962	4105663	4411148	coat,tRNA,bacteriocin,transposase	Paenibacillus_phage(66.67%)	49	NA	NA
WP_077997664.1|4031962_4032202_+|bacteriocin	uberolysin/carnocyclin family circular bacteriocin	bacteriocin	NA	NA	NA	NA
WP_077997302.1|4032526_4034020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997303.1|4034066_4034606_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_077997305.1|4035177_4035846_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.3e-14
WP_077997665.1|4036205_4037729_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077997306.1|4037825_4038803_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077997307.1|4038810_4039821_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_077997308.1|4041186_4042368_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.9	7.7e-26
WP_104932668.1|4042523_4043641_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	4.6e-153
WP_077997309.1|4043753_4044590_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_188318662.1|4044652_4045495_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_042119509.1|4049319_4049589_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
WP_077997311.1|4050008_4050575_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_077997312.1|4050571_4050808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997313.1|4050930_4052037_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_077997314.1|4052378_4055087_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_077997315.1|4055083_4055353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997316.1|4055386_4055809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997317.1|4057064_4057598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867788.1|4058100_4058853_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077997319.1|4060219_4060519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121090.1|4060825_4060975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997321.1|4065327_4066164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997666.1|4066893_4067646_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_077997322.1|4068389_4068755_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_077997323.1|4070492_4071815_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155121091.1|4072100_4072262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997324.1|4075375_4076851_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077997325.1|4076847_4078020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867789.1|4078070_4078499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997328.1|4079276_4080548_+	immune inhibitor A	NA	NA	NA	NA	NA
WP_077997330.1|4081690_4081969_-	DUF2653 family protein	NA	NA	NA	NA	NA
WP_023482849.1|4081968_4082400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997331.1|4083077_4083668_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_042119138.1|4083690_4084026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_188318574.1|4087639_4088026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482840.1|4089822_4090785_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_023482839.1|4090882_4091452_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_079940585.1|4091552_4092983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036656949.1|4097909_4098689_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077997333.1|4098676_4099639_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_077997334.1|4099716_4099956_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_077997335.1|4100104_4101766_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_077997336.1|4101828_4102071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867793.1|4102103_4102535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997337.1|4103442_4103829_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_036654509.1|4104090_4104774_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077997338.1|4104944_4105418_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.3	3.6e-75
WP_077997339.1|4105429_4105663_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	100.0	6.6e-38
>prophage 24
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	4120712	4179939	4411148	transposase,integrase	Paenibacillus_phage(47.37%)	56	4113423:4113439	4185127:4185143
4113423:4113439	attL	TAAAAACATTCATAATC	NA	NA	NA	NA
WP_104932621.1|4120712_4121582_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|4121602_4122286_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_158672752.1|4123871_4124114_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158672753.1|4124022_4124304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104935368.1|4124356_4124677_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077997348.1|4124721_4125048_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077997349.1|4125116_4125536_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2SXP1	Bacillus_phage	61.4	4.8e-39
WP_046655237.1|4125615_4125966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052337438.1|4128641_4129733_+	LCP family protein	NA	NA	NA	NA	NA
WP_077997668.1|4129833_4130064_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	49.3	4.4e-10
WP_024094581.1|4130560_4130827_+	hypothetical protein	NA	A0A2I7SCW2	Paenibacillus_phage	72.7	1.9e-28
WP_077997351.1|4130972_4131590_-	transcriptional repressor LexA	NA	E5DV74	Deep-sea_thermophilic_phage	35.6	5.3e-18
WP_036656935.1|4131868_4132114_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036654904.1|4132294_4132480_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_077997352.1|4132506_4133301_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_023484144.1|4133406_4133949_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_149867797.1|4134225_4137735_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	46.7	5.2e-09
WP_023484146.1|4137839_4138796_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_077996122.1|4141245_4141929_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
WP_077997354.1|4142019_4142985_-	ETX/MTX2 family pore-forming toxin	NA	A0A2I7SC07	Paenibacillus_phage	58.2	9.6e-83
WP_149867798.1|4144630_4144840_+	hypothetical protein	NA	A0A0C5AFE4	Paenibacillus_phage	73.8	3.4e-17
WP_077997356.1|4145195_4147481_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_188318575.1|4147477_4147705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_188318576.1|4147701_4148862_+	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_077997358.1|4149021_4149825_+	Fpg/Nei family DNA glycosylase	NA	W5S5H6	Pithovirus	23.7	3.0e-05
WP_077997359.1|4149824_4150694_+	deoxyribonuclease IV	NA	A0A1V0SCI4	Indivirus	28.9	1.2e-23
WP_077997360.1|4150729_4151062_+	cell division protein FtsJ	NA	NA	NA	NA	NA
WP_077997361.1|4151167_4151872_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.5	2.1e-10
WP_077997362.1|4151864_4153028_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_077997363.1|4153051_4153240_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_077997364.1|4153283_4153760_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_077995375.1|4154188_4155412_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997365.1|4155532_4156618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483043.1|4157855_4158770_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_188318577.1|4158786_4159644_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_036654710.1|4159673_4159892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051427880.1|4159960_4160899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997366.1|4160910_4161519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867800.1|4161481_4163152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483047.1|4163121_4163826_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_077997368.1|4163833_4164349_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_077997369.1|4164361_4165015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867801.1|4165372_4166101_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_077997372.1|4166240_4167797_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	5.7e-53
WP_036656764.1|4167822_4168113_+	Dabb family protein	NA	NA	NA	NA	NA
WP_077997373.1|4169505_4171419_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	4.9e-54
WP_036656763.1|4171449_4173069_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.9	2.4e-54
WP_077997374.1|4173151_4173397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867802.1|4173378_4173684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997376.1|4173706_4174045_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_077997377.1|4174123_4174507_+	kinase-associated lipoprotein B	NA	NA	NA	NA	NA
WP_077997378.1|4175977_4176625_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_077997379.1|4176614_4177481_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.0e-19
WP_077997380.1|4177477_4177861_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_051427858.1|4178335_4178518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|4178715_4179939_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
4185127:4185143	attR	GATTATGAATGTTTTTA	NA	NA	NA	NA
>prophage 25
NZ_CP019794	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 chromosome, complete genome	4411148	4207703	4270475	4411148	tRNA,transposase	Streptococcus_phage(22.22%)	49	NA	NA
WP_077997391.1|4207703_4209158_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.1	3.4e-124
WP_077995375.1|4209578_4210802_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_036654468.1|4210982_4211711_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	2.1e-34
WP_077997392.1|4211732_4212587_+	transporter substrate-binding domain-containing protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	28.6	4.2e-13
WP_077997393.1|4212660_4213314_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_023483359.1|4213383_4213992_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_077997672.1|4214151_4214862_-	amidohydrolase	NA	NA	NA	NA	NA
WP_077997394.1|4215262_4215901_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_077997673.1|4217394_4218042_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_023482520.1|4218833_4219679_+	DegV family protein	NA	NA	NA	NA	NA
WP_077997395.1|4219762_4220602_+	DegV family protein	NA	NA	NA	NA	NA
WP_024093883.1|4220743_4220935_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_155121094.1|4220994_4221156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997397.1|4221131_4221959_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_149867804.1|4222110_4222470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997398.1|4222445_4222841_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_023482525.1|4223352_4223850_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_024093888.1|4224028_4225534_+	spore germination protein	NA	NA	NA	NA	NA
WP_077997400.1|4225548_4226646_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_077997401.1|4226642_4227782_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_077997674.1|4228393_4229689_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_077997402.1|4229740_4231144_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_077997403.1|4231171_4232506_+	CoA-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.7	4.7e-11
WP_077997404.1|4232948_4233734_+	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_188318578.1|4233761_4234988_+	isochorismate synthase DhbC	NA	NA	NA	NA	NA
WP_077997406.1|4235007_4236633_+	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_077997407.1|4236666_4237593_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_077997408.1|4244758_4244959_+	MbtH family protein	NA	NA	NA	NA	NA
WP_077997409.1|4248275_4248554_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_077997410.1|4248574_4249045_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_077997411.1|4249077_4249674_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_077997412.1|4249677_4250559_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_077997675.1|4250548_4251250_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_077997413.1|4251291_4253490_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_077997414.1|4253848_4255612_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_188318579.1|4255834_4256026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997415.1|4256932_4257718_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	27.8	4.5e-14
WP_077997416.1|4258933_4261360_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	67.1	0.0e+00
WP_077997417.1|4261476_4261944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997418.1|4262019_4263951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997419.1|4263952_4264174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997420.1|4264533_4265022_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_077997421.1|4265033_4265417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997422.1|4265428_4266040_+	hypothetical protein	NA	A0A2K9L5M2	Tupanvirus	36.4	5.4e-23
WP_104932677.1|4266754_4267111_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	35.4	4.4e-09
WP_158672755.1|4267340_4267565_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077997424.1|4267712_4268912_+	MFS transporter	NA	NA	NA	NA	NA
WP_158672756.1|4269286_4269592_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_104932679.1|4269833_4270475_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP019795	Paenibacillus larvae subsp. pulvifaciens strain ATCC 13537 plasmid pPLP1, complete sequence	60858	878	54866	60858	integrase,transposase	Paenibacillus_phage(25.0%)	55	3770:3786	59230:59246
WP_077997683.1|878_1157_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	51.7	1.4e-15
WP_077997684.1|1266_1473_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.6e-19
WP_077996502.1|1829_2513_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.4e-117
WP_077997685.1|2650_3079_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	92.8	7.3e-59
WP_077997686.1|3075_3402_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.1	2.3e-57
WP_077997687.1|3516_4434_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	57.0	2.6e-93
3770:3786	attL	GAAGGGAACAAATATGG	NA	NA	NA	NA
WP_077997688.1|4580_4832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997689.1|4797_5058_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A125RQ76	Bacillus_phage	54.7	2.4e-20
WP_077997690.1|5260_5989_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_077997691.1|6088_6709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997692.1|7040_7688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997693.1|7645_8620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997694.1|9041_10001_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077997695.1|10189_11077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867821.1|11439_11706_+	hypothetical protein	NA	A2I2Z6	Vibrio_virus	48.2	4.4e-06
WP_149867822.1|13215_13536_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077997698.1|13658_14042_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077997699.1|14129_14990_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_077997700.1|15263_15752_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_077997701.1|15831_17883_+	catalase	NA	A0A2K9L572	Tupanvirus	40.8	1.8e-115
WP_077995397.1|18613_19837_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_079940845.1|20737_20935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997702.1|20883_21261_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_077997703.1|23271_23673_+	hypothetical protein	NA	A0A2H4PB09	Aphanizomenon_phage	43.0	1.6e-12
WP_077997704.1|23733_23904_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_077997705.1|24095_24434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997706.1|24488_24896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997707.1|24962_25466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672848.1|25618_26581_+	DUF3895 domain-containing protein	NA	NA	NA	NA	NA
WP_077997709.1|27149_28205_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	29.5	7.9e-14
WP_077997710.1|30292_31375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997711.1|31601_32939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997712.1|32951_33317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997713.1|33794_34190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867823.1|34488_35163_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_149867824.1|35495_35948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997716.1|35944_37702_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_077997717.1|37849_38938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997718.1|38954_39824_-	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_077997719.1|40240_40870_+	SAF domain-containing protein	NA	NA	NA	NA	NA
WP_077997720.1|40866_42408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997721.1|42397_43690_+	CpaF family protein	NA	NA	NA	NA	NA
WP_077997722.1|43694_44555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997723.1|44558_45425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121121.1|45441_45594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997724.1|45603_45957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997725.1|45959_46430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997726.1|46443_46800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997727.1|46818_47778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997729.1|48109_50488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158676630.1|50710_51412_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	33.1	7.8e-18
WP_077997731.1|51433_52027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997732.1|52108_53224_+	toprim domain-containing protein	NA	A0A0K1LMQ9	Caulobacter_phage	26.0	1.9e-13
WP_077997733.1|53410_53806_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	63.6	1.3e-41
WP_077997734.1|53810_54866_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	29.5	7.9e-14
59230:59246	attR	GAAGGGAACAAATATGG	NA	NA	NA	NA
