The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019778	Escherichia coli strain NCTC86 chromosome, complete genome	5111920	200941	273770	5111920	protease,tRNA,plate,transposase	uncultured_Caudovirales_phage(20.0%)	57	NA	NA
WP_001295561.1|200941_202294_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_078045887.1|202323_204756_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|204877_205363_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|205366_206392_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|206496_206952_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|206955_207744_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|207743_208892_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|208888_209485_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|209521_213004_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|213016_213976_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|214074_216216_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|216272_216662_+	VOC family protein	NA	NA	NA	NA	NA
WP_066009595.1|216726_218025_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|218073_218334_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|218320_218521_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|218686_219232_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|219228_219651_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|219664_220375_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001336393.1|220574_221399_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|221452_223171_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|223282_223990_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|223986_224391_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_066009593.1|224508_225324_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|225363_226017_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_066009591.1|226009_227041_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	3.6e-35
WP_001140187.1|227228_227804_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|233561_234365_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_066009008.1|234361_235276_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|235516_236317_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_078045888.1|236980_238339_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_032277844.1|238410_239166_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|239199_239922_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239918_240386_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|240450_241182_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086141.1|241718_242504_+	lipoprotein	NA	NA	NA	NA	NA
WP_066009341.1|242640_243120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908066.1|243129_244044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|244087_244570_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|244593_245946_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_122545204.1|245956_249391_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240525.1|249499_250912_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_068879477.1|250916_251660_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614325.1|251656_254422_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_078045889.1|254430_255192_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246443.1|255196_256528_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|256530_257055_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_066009416.1|257051_258332_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|258356_259439_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|259402_261253_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|261256_261670_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000123970.1|263201_263426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|263460_263961_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264655_265174_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103354.1|265383_267525_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_066008979.1|267600_271833_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_001101839.1|271810_272203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068879476.1|272633_273770_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP019778	Escherichia coli strain NCTC86 chromosome, complete genome	5111920	614033	695042	5111920	protease,tRNA,integrase,head,transposase,portal,lysis,capsid,tail	Enterobacteria_phage(30.19%)	80	624178:624224	671905:671951
WP_000912385.1|614033_615419_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|615454_615976_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|616083_616296_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_078045918.1|616297_617164_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	NA	NA	NA	NA
WP_000776555.1|617634_618177_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|618396_619089_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|619119_621723_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|621701_622742_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|622752_623268_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|623270_623903_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
624178:624224	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001298992.1|624237_625401_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000206813.1|625627_625933_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001242707.1|625932_626295_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_001547114.1|626285_626822_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	1.4e-99
WP_001547115.1|626949_627774_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
WP_000135682.1|627839_628202_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000357060.1|628663_629167_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	47.6	1.2e-31
WP_000167381.1|629690_630767_-	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	59.9	3.4e-121
WP_001535858.1|630937_631642_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	59.9	3.4e-69
WP_001535859.1|631748_632012_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	50.0	4.2e-09
WP_000515828.1|632040_632592_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	2.6e-101
WP_001250269.1|632767_632947_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_066008989.1|632936_633878_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	3.6e-151
WP_001573323.1|633874_634369_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000210176.1|634368_634695_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_001547119.1|634691_635081_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.3e-67
WP_001061408.1|635100_635898_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_001547120.1|635905_636895_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.3	6.4e-191
WP_066008985.1|636912_637296_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	5.7e-55
WP_000737271.1|637484_638567_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|639155_639371_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|639370_639868_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|640084_640267_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|640357_640651_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001307652.1|641011_641206_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453576.1|641594_642140_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_000198149.1|644037_644244_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_078045919.1|644240_645842_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	6.5e-310
WP_066009462.1|645822_647142_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	4.0e-233
WP_001345004.1|647151_647484_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063265.1|647539_648565_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_074152574.1|648606_649005_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	1.2e-60
WP_000753006.1|649016_649370_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
WP_000975070.1|649381_649960_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683128.1|649956_650352_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001339397.1|650494_651172_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|651171_651519_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|651538_653110_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001552795.1|653822_654245_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.9	4.2e-59
WP_001571447.1|654226_654661_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	5.0e-63
WP_000847401.1|657212_657542_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001152612.1|657541_658240_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_021572741.1|658245_658989_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	8.6e-148
WP_000090892.1|658925_659558_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.1	2.7e-94
WP_078045920.1|659617_663031_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_021562711.1|663100_663700_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_071836836.1|663764_666161_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	55.2	3.9e-133
WP_000654154.1|666157_666439_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_001720032.1|666922_667153_+	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	63.1	1.3e-17
WP_000355612.1|667163_667457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239881.1|667650_668319_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226382.1|668857_670342_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|670528_671482_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177471.1|671994_672756_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
671905:671951	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224604.1|672938_673829_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_078045921.1|676787_679025_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000253839.1|679174_680617_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000770953.1|680606_681290_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074234.1|681446_682820_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709870.1|682977_683310_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717157.1|683325_684549_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573945.1|684560_687704_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000786319.1|687805_689182_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153148.1|689262_690510_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351487.1|690617_691271_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|691364_691733_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682509.1|691797_692046_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130654.1|692111_693230_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000956455.1|693682_693835_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001383852.1|693911_695042_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP019778	Escherichia coli strain NCTC86 chromosome, complete genome	5111920	1007114	1124477	5111920	protease,tRNA,transposase,integrase	Stx2-converting_phage(33.33%)	82	996851:996866	1026229:1026244
996851:996866	attL	TCAATCAGCGTATCAG	NA	NA	NA	NA
WP_000520781.1|1007114_1007435_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1007465_1009742_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000279872.1|1010259_1011462_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000282209.1|1011648_1013466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1014577_1014874_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1015100_1015298_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_102384962.1|1017160_1018388_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000282077.1|1019107_1019671_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_078046171.1|1020333_1025292_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000622487.1|1025288_1026725_+	hypothetical protein	NA	NA	NA	NA	NA
1026229:1026244	attR	TCAATCAGCGTATCAG	NA	NA	NA	NA
WP_024167628.1|1026829_1027036_+	methyltransferase	NA	NA	NA	NA	NA
WP_000757210.1|1027204_1029094_-	enterotoxin	NA	NA	NA	NA	NA
WP_000459228.1|1029107_1030283_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000192271.1|1030294_1031866_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000195940.1|1031979_1032384_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000072197.1|1032566_1033391_+	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_001411495.1|1034757_1034895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295538.1|1035802_1036585_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|1036890_1037811_+	ribokinase	NA	NA	NA	NA	NA
WP_000998350.1|1037838_1039155_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_068879467.1|1039166_1040180_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_078045941.1|1041122_1042661_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	95.3	2.1e-281
WP_000612591.1|1042710_1043058_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1043054_1043435_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001254932.1|1043529_1044681_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001505166.1|1046353_1046566_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000483766.1|1046921_1048268_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_066009430.1|1051671_1052901_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_102384962.1|1057274_1058502_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_077884783.1|1058487_1059453_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_066009371.1|1059468_1059903_+	adhesin	NA	NA	NA	NA	NA
WP_126722400.1|1060073_1060526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543690.1|1061051_1061399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|1063005_1064577_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1064596_1064944_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1064943_1065621_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_180964936.1|1066044_1067187_+	permease	NA	NA	NA	NA	NA
WP_032219280.1|1067183_1068422_+	TolC family protein	NA	NA	NA	NA	NA
WP_141086690.1|1068318_1069143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021527210.1|1069123_1069753_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	2.4e-18
WP_024188913.1|1069765_1070977_+	acyltransferase	NA	NA	NA	NA	NA
WP_071779209.1|1071036_1071486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066008841.1|1071542_1072514_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_078045944.1|1074841_1075207_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000555378.1|1076087_1077221_+|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_000624688.1|1078928_1079279_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|1079275_1079710_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000381395.1|1081498_1083070_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1083089_1083437_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1083436_1084114_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001122107.1|1084692_1085409_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000108735.1|1085408_1088504_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.2	3.9e-53
WP_000634203.1|1088522_1089590_-	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	39.2	1.4e-18
WP_000312833.1|1089586_1090243_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000228013.1|1090255_1091590_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001431807.1|1094066_1094306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154670580.1|1094587_1094842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032171640.1|1095304_1096249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068879475.1|1097708_1100555_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_078045945.1|1100675_1103192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581502.1|1103267_1103723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119727.1|1103801_1104035_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_068879456.1|1104135_1104954_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.6e-44
WP_000214307.1|1105045_1105531_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_021543704.1|1105546_1106023_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692298.1|1106085_1106307_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_000086768.1|1106325_1107009_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	35.1	9.0e-27
WP_001285602.1|1107019_1107400_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854686.1|1107480_1107864_+	toxin	NA	NA	NA	NA	NA
WP_001054233.1|1107860_1108349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839256.1|1108365_1108563_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_068879455.1|1108647_1109490_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001040187.1|1109981_1110200_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|1110484_1111189_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202175.1|1111230_1112952_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001043600.1|1112952_1114719_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537418.1|1114841_1115807_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|1116351_1116846_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077038.1|1116980_1120970_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1121128_1121740_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|1121750_1123094_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_078045946.1|1123184_1124477_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.0	7.3e-94
>prophage 4
NZ_CP019778	Escherichia coli strain NCTC86 chromosome, complete genome	5111920	1278700	1299247	5111920	transposase,integrase	Acinetobacter_phage(28.57%)	14	1278322:1278336	1293168:1293182
1278322:1278336	attL	GTGGTGAATATCATT	NA	NA	NA	NA
WP_085947771.1|1278700_1279863_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000611859.1|1280268_1281255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279860.1|1281802_1283020_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.7	6.5e-44
WP_077820283.1|1283189_1284719_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000070931.1|1284690_1284978_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_066009346.1|1285078_1286914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|1287414_1288643_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_053886234.1|1289568_1290147_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000555380.1|1291006_1292140_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_066008901.1|1292717_1294805_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	3.4e-08
1293168:1293182	attR	GTGGTGAATATCATT	NA	NA	NA	NA
WP_053886233.1|1295623_1296532_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	46.1	2.7e-55
WP_000700580.1|1296816_1297044_-	F1845 fimbrial adhesin operon transcriptional regulator DaaF	NA	NA	NA	NA	NA
WP_000544830.1|1297277_1298075_-	IS21-like element IS21 family helper ATPase IstB	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
WP_000952372.1|1298074_1299247_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
>prophage 5
NZ_CP019778	Escherichia coli strain NCTC86 chromosome, complete genome	5111920	1544961	1616715	5111920	holin,protease,integrase,head,terminase,portal,capsid,tail	Escherichia_phage(31.82%)	93	1544798:1544825	1600874:1600901
1544798:1544825	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113680.1|1544961_1546092_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	2.6e-103
WP_000113189.1|1546069_1546318_-	excisionase	NA	NA	NA	NA	NA
WP_021533631.1|1546382_1548875_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001093951.1|1548954_1549158_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|1549154_1549343_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001586950.1|1549353_1550208_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000102678.1|1550783_1551059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586951.1|1551036_1551357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171958.1|1551379_1551598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379612.1|1551757_1551913_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000753626.1|1552166_1552628_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_000702041.1|1552993_1553419_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262415.1|1553490_1554531_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_001309414.1|1554442_1554985_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450705.1|1555018_1555789_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	9.7e-86
WP_001141099.1|1555804_1556197_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|1556193_1556490_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209470.1|1556486_1556948_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	1.3e-37
WP_000403782.1|1556925_1557282_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_001224665.1|1557377_1557560_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000753053.1|1557552_1557729_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001289989.1|1557725_1558085_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000510387.1|1558085_1558301_+	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001142588.1|1558302_1558521_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000224216.1|1558522_1558786_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_000207997.1|1558796_1558964_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000350274.1|1559071_1559305_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_000967408.1|1559539_1559752_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001004956.1|1559917_1560568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|1560548_1561652_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000687431.1|1561809_1561983_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_001403449.1|1562042_1562315_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001265091.1|1562316_1563363_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_000904114.1|1563375_1563750_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|1563746_1564568_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917767.1|1564794_1564992_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000935516.1|1565142_1566192_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	96.0	2.3e-199
WP_106104550.1|1566489_1566576_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|1567064_1567277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871291.1|1567347_1567683_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_032167420.1|1567943_1569797_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	94.3	0.0e+00
WP_000284510.1|1569947_1570163_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|1570167_1570512_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|1570477_1570750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992067.1|1570855_1571389_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.1e-99
WP_032140280.1|1571943_1572030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1572251_1572437_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736383.1|1572522_1572747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|1572945_1573146_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|1573187_1573553_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958372.1|1573843_1574407_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_001339613.1|1574403_1576065_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.1	0.0e+00
WP_000173030.1|1576128_1578066_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1578110_1578332_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_032167421.1|1578277_1580863_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_000125990.1|1580859_1581186_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1581195_1581546_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573362.1|1581542_1581989_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|1581985_1582330_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|1582394_1583111_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|1583125_1583500_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1583595_1583805_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_021520064.1|1583852_1587095_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_000807924.1|1587087_1587429_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	96.5	2.4e-60
WP_001375867.1|1587428_1588127_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	4.2e-128
WP_021565969.1|1588137_1588881_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	3.3e-147
WP_122999438.1|1588826_1589459_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.6	1.0e-101
WP_078045973.1|1589699_1593173_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_032230005.1|1593240_1593840_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_077884781.1|1593991_1596796_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q858V4	Yersinia_virus	62.8	4.4e-03
WP_066009303.1|1596798_1597332_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	86.4	6.9e-83
WP_078045974.1|1597360_1597888_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.1	1.3e-89
WP_068879450.1|1597889_1598675_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	77.4	2.8e-109
WP_001421220.1|1598902_1599085_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_134388450.1|1599283_1599952_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1600008_1600278_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_180964939.1|1600392_1600563_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	60.7	2.7e-09
WP_001079505.1|1601051_1601558_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1600874:1600901	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_078045975.1|1601603_1602104_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1602189_1602369_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1602749_1603556_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_066009309.1|1603555_1604749_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983871.1|1604760_1606122_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_078045976.1|1606122_1607718_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_078045977.1|1607717_1609280_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1609371_1609416_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1609553_1610435_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1610431_1611052_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_078045978.1|1611079_1612975_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|1613185_1614061_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1614100_1614691_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559286.1|1614687_1615446_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|1615665_1616715_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP019778	Escherichia coli strain NCTC86 chromosome, complete genome	5111920	2359422	2367561	5111920	transposase	Stx2-converting_phage(50.0%)	11	NA	NA
WP_000381395.1|2359422_2360994_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_078046020.1|2361013_2361361_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.3e-45
WP_001339397.1|2361360_2362038_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000855059.1|2362421_2362895_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001186774.1|2362910_2363387_+	RadC family protein	NA	NA	NA	NA	NA
WP_023356553.1|2363449_2363671_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	5.5e-10
WP_001360327.1|2363833_2364202_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854765.1|2364291_2364666_+	toxin	NA	NA	NA	NA	NA
WP_000976829.1|2364662_2364869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|2364881_2364995_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001445980.1|2366019_2367561_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.3	1.1e-128
>prophage 7
NZ_CP019778	Escherichia coli strain NCTC86 chromosome, complete genome	5111920	2498939	2508380	5111920		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292788.1|2498939_2500076_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001375261.1|2500072_2502073_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2502197_2502659_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2502698_2503169_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2503215_2503935_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2503931_2505617_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2505838_2506570_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2506629_2506737_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2506717_2507449_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_078046029.1|2507453_2508380_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	8.2e-23
>prophage 8
NZ_CP019778	Escherichia coli strain NCTC86 chromosome, complete genome	5111920	3107700	3120874	5111920		Escherichia_phage(50.0%)	12	NA	NA
WP_068879478.1|3107700_3110262_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	1.7e-30
WP_001141322.1|3110367_3111024_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3111074_3111842_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|3112037_3112946_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|3112942_3114205_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|3114201_3114840_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3114844_3115621_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|3115709_3117074_+	GntP family transporter	NA	NA	NA	NA	NA
WP_066009455.1|3117143_3118151_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.2e-32
WP_001272592.1|3118213_3119353_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3119492_3120119_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3120112_3120874_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 9
NZ_CP019778	Escherichia coli strain NCTC86 chromosome, complete genome	5111920	3345405	3395815	5111920	protease,tRNA,transposase,integrase	Enterobacteria_phage(50.0%)	48	3356833:3356848	3391283:3391298
WP_001309720.1|3345405_3346164_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_078046069.1|3346249_3347812_-	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_000105566.1|3347961_3348882_-	agmatinase	NA	NA	NA	NA	NA
WP_000715527.1|3349017_3349749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3349894_3351871_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3351879_3352011_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3352146_3352362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3352665_3353820_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3354256_3355651_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3355727_3356225_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3356319_3357027_+	deoxyribonuclease I	NA	NA	NA	NA	NA
3356833:3356848	attL	ATTGCGCGCACCTACT	NA	NA	NA	NA
WP_001222509.1|3357106_3357838_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3357850_3358801_+	glutathione synthase	NA	NA	NA	NA	NA
WP_024174106.1|3358909_3359473_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3359472_3359889_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_078046070.1|3359992_3360985_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3361002_3361707_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_078046071.1|3361724_3362291_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3362287_3362578_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|3362585_3363179_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239947.1|3363171_3364308_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|3364620_3365607_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_078046072.1|3365651_3366155_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_078046073.1|3366154_3367456_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745254.1|3367511_3368519_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394103.1|3368635_3369682_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984795.1|3369857_3370577_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001178592.1|3370597_3370738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107564.1|3370760_3371087_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3371086_3371806_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001309725.1|3371966_3373019_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3373046_3373322_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|3373386_3374466_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3374667_3375924_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_078046074.1|3375972_3378108_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|3378500_3379208_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001522333.1|3379565_3380744_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	52.8	1.3e-121
WP_188318441.1|3381957_3384642_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.3	9.7e-258
WP_113328817.1|3384822_3385854_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001522329.1|3387116_3387599_-	Dr family adhesin structural subunit	NA	NA	NA	NA	NA
WP_066009557.1|3387800_3387974_-	DraP	NA	NA	NA	NA	NA
WP_001522328.1|3388352_3388796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522324.1|3388811_3391394_-	AfaC-I/III family usher protein	NA	NA	NA	NA	NA
3391283:3391298	attR	AGTAGGTGCGCGCAAT	NA	NA	NA	NA
WP_001522323.1|3391433_3392231_-	Dr fimbrial biogenesis chaperone DraB	NA	NA	NA	NA	NA
WP_001522322.1|3392484_3392790_-	AFA-III adhesin operon transcriptional regulator AfaA	NA	NA	NA	NA	NA
WP_001522321.1|3393590_3393848_+	Dr hemagglutinin AFA-III operon transcriptional regulator AfaF	NA	NA	NA	NA	NA
WP_001522318.1|3394286_3394529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171844376.1|3394602_3395815_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
>prophage 10
NZ_CP019778	Escherichia coli strain NCTC86 chromosome, complete genome	5111920	4921052	4996820	5111920	holin,tRNA,transposase,integrase	Enterobacteria_phage(14.29%)	59	4913998:4914013	4970869:4970884
4913998:4914013	attL	CGGGCGGCTTCAACAG	NA	NA	NA	NA
WP_000416392.1|4921052_4923908_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|4923907_4924351_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4924704_4926216_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|4926482_4927583_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001422763.1|4927582_4928665_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_032230423.1|4928783_4930286_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	3.6e-84
WP_066009171.1|4930363_4931362_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_066009173.1|4931428_4932748_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|4932812_4933577_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001422766.1|4933600_4934632_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896741.1|4934848_4935412_+	gluconokinase	NA	NA	NA	NA	NA
WP_000061766.1|4935415_4936435_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
WP_000142490.1|4936864_4937791_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001223819.1|4937780_4939400_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_001082109.1|4939702_4940614_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.6	5.5e-48
WP_001143292.1|4940699_4940993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202280.1|4941360_4942233_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000886597.1|4942477_4944301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000236931.1|4944293_4947263_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	32.9	7.3e-81
WP_000643690.1|4947356_4948553_-	DNA cytosine methyltransferase	NA	A0A191SAU1	Nostoc_phage	30.8	2.2e-36
WP_141086595.1|4948825_4949350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000950585.1|4949359_4950397_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_068879494.1|4950380_4951049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099275.1|4951924_4952221_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001104341.1|4952850_4953927_+	Fic family protein	NA	NA	NA	NA	NA
WP_001825864.1|4953977_4954607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078046153.1|4955517_4956342_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_066009509.1|4956507_4958064_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_078046154.1|4958063_4958753_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001215043.1|4958864_4959029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416151.1|4960998_4962030_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916805.1|4962300_4962744_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705930.1|4962759_4963047_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_078046155.1|4963059_4964316_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|4964562_4964817_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
WP_000107474.1|4965238_4966252_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998350.1|4966263_4967580_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|4967607_4968528_-	ribokinase	NA	NA	NA	NA	NA
WP_078046156.1|4968833_4969616_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171844377.1|4970468_4971697_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	4.1e-171
4970869:4970884	attR	CTGTTGAAGCCGCCCG	NA	NA	NA	NA
WP_001422798.1|4972150_4972279_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145474.1|4972459_4973116_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625669.1|4973361_4974639_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|4974701_4976699_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_012601883.1|4978186_4979131_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001300030.1|4979195_4980146_-	virulence factor VirK	NA	NA	NA	NA	NA
WP_001825888.1|4980150_4981239_-	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_160371899.1|4981241_4982084_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000177057.1|4983548_4983806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175459.1|4984363_4985131_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	4.9e-13
WP_000684856.1|4985131_4986088_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125187.1|4986084_4987083_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|4987079_4987982_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188260.1|4988026_4990351_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068914.1|4990437_4991391_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|4991387_4991909_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|4992829_4993087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|4993837_4995196_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|4995434_4996820_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
