The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	20385	44231	3009007	protease,transposase	Enterococcus_phage(33.33%)	20	NA	NA
WP_002323589.1|20385_21534_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_077974277.1|21550_21907_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	72.3	1.2e-43
WP_002320781.1|21955_22354_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0N9RRE8	Paenibacillus_phage	33.6	2.1e-07
WP_010729833.1|22545_23313_-	replication initiation protein	NA	NA	NA	NA	NA
WP_044383777.1|23347_24571_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_010729683.1|25551_26355_+	replication initiation protein	NA	NA	NA	NA	NA
WP_002320776.1|26939_27395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729682.1|27513_28572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729681.1|28613_30563_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	NA	NA	NA	NA
WP_010729680.1|30565_34207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347431.1|34606_34945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033624104.1|35054_35276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347429.1|35295_37452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320768.1|37463_37697_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002320767.1|37686_38553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320766.1|38567_40538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|41047_41452_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323589.1|41468_42617_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_010729677.1|42823_43159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301399.1|43271_44231_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
>prophage 2
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	71769	162779	3009007	protease,tRNA,portal,terminase,transposase,tail,capsid,integrase,head	Enterococcus_phage(16.0%)	94	92462:92477	153850:153876
WP_016922336.1|71769_72369_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002350576.1|72384_72861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060799115.1|72877_73780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350574.1|73852_74047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042957131.1|74151_74580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350572.1|74814_75402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060799116.1|75401_76301_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_060799117.1|76300_77215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016922247.1|77266_77482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350568.1|77671_77926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350567.1|78104_79154_+	C39 family peptidase	NA	A0A1P8BMN5	Lactococcus_phage	42.2	3.0e-05
WP_002320840.1|79330_79561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350566.1|79563_79821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060799120.1|79940_80912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010730972.1|80921_81716_+	hypothetical protein	NA	F0PIJ0	Enterococcus_phage	33.7	1.1e-23
WP_010730971.1|81744_82863_+	hypothetical protein	NA	F0PIJ1	Enterococcus_phage	48.8	5.3e-85
WP_002321530.1|82895_83216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060799118.1|83470_84364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077974280.1|84383_86012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347491.1|86530_86731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060799203.1|86921_88091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303667.1|88953_90294_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	5.1e-66
WP_002297218.1|90557_91853_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_060799202.1|92081_93407_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	44.2	1.7e-98
92462:92477	attL	CTTAAATTTATTTACT	NA	NA	NA	NA
WP_060799201.1|93399_93747_+	hypothetical protein	NA	NA	NA	NA	NA
92462:92477	attL	CTTAAATTTATTTACT	NA	NA	NA	NA
WP_077974285.1|95168_95810_+	DNA repair protein RadC	NA	R4JMP4	Bacillus_phage	36.0	1.5e-07
WP_000868132.1|95928_97014_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
WP_001557544.1|97010_98903_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000361059.1|98909_99287_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000067268.1|99437_100220_+	aminoglycoside nucleotidyltransferase ANT(9)-Ia	NA	NA	NA	NA	NA
WP_001072201.1|100345_101077_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
WP_001092058.1|101585_102248_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002294067.1|102775_102976_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002287948.1|103229_104909_-	ribonuclease J	NA	NA	NA	NA	NA
103097:103112	attR	AGTAAATAAATTTAAG	NA	NA	NA	NA
WP_002287947.1|104910_105123_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
103097:103112	attR	AGTAAATAAATTTAAG	NA	NA	NA	NA
WP_002296290.1|105515_107246_+	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002289400.1|107242_109003_+	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296291.1|109097_109295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289401.1|109447_109933_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002289402.1|110036_110630_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289403.1|110809_111337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077974287.1|111427_112165_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	1.8e-12
WP_002289405.1|112168_113086_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289406.1|113087_114317_+	GTPase HflX	NA	NA	NA	NA	NA
WP_002330551.1|114350_115304_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002287759.1|115954_117568_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002296511.1|117708_118617_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287757.1|118799_119924_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002287756.1|119948_120128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287755.1|120150_121068_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002287754.1|121060_121894_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002287753.1|121976_123095_+	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_002321415.1|123088_124987_+	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_002321414.1|124980_126204_+	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_002287747.1|126289_128224_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	1.1e-58
WP_002287746.1|128449_129106_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287745.1|129179_129533_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287744.1|129724_130654_+	permease	NA	NA	NA	NA	NA
WP_002287743.1|130664_131501_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002287742.1|131748_132525_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002287741.1|132700_133444_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.6e-29
WP_002296509.1|133436_135017_+	ABC transporter	NA	NA	NA	NA	NA
WP_002289868.1|135267_135747_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002289867.1|135762_136515_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002296505.1|137062_137788_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002290885.1|138042_138309_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002296503.1|138305_138737_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002290887.1|138761_139067_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_002296502.1|139147_140293_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.3	2.0e-50
WP_002296501.1|140353_141001_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296500.1|141194_141488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296499.1|141531_141843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296496.1|142604_142763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296495.1|142763_143126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296494.1|143162_144011_+	bifunctional DNA primase/polymerase	NA	A0A222ZGI2	Arthrobacter_phage	28.3	5.2e-08
WP_002296493.1|144000_145476_+	helicase	NA	Q4ZD27	Staphylococcus_phage	34.9	7.3e-66
WP_002296492.1|145741_146149_+	DUF3206 domain-containing protein	NA	NA	NA	NA	NA
WP_002296491.1|146151_146367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304527.1|146370_146751_+	HNH endonuclease	NA	A0A2I7S865	Vibrio_phage	47.9	1.7e-11
WP_002296489.1|146884_147040_+	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_002296488.1|147108_147582_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_002296487.1|147578_149273_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.8	9.1e-129
WP_002317249.1|149238_149424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296486.1|149427_150603_+|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.6	3.2e-64
WP_002296485.1|150595_152119_+|capsid	phage major capsid protein	capsid	A0A1W6JPR8	Staphylococcus_phage	37.4	1.4e-48
WP_002296484.1|152174_152459_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002296483.1|152445_152781_+|head	phage head closure protein	head	V5UQC7	Enterococcus_phage	35.6	4.7e-13
WP_002296481.1|153075_153702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296478.1|155346_155781_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002296477.1|155848_157171_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_002296476.1|157324_158965_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002296474.1|159294_159765_+	DUF4809 family protein	NA	NA	NA	NA	NA
WP_002296473.1|160393_161497_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_077974289.1|161699_162779_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	4.6e-49
>prophage 3
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	265449	314216	3009007	tRNA,bacteriocin,holin,transposase	Bacillus_phage(33.33%)	43	NA	NA
WP_002289566.1|265449_265800_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002289568.1|265966_266905_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_002289570.1|266919_267750_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002296128.1|267793_268819_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002289574.1|268833_269772_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	4.2e-75
WP_002289575.1|269896_270337_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_002296133.1|270339_270942_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_002296134.1|271000_272107_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002291653.1|272316_273318_+	catabolite control protein A	NA	NA	NA	NA	NA
WP_002296135.1|273654_276000_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002296136.1|276278_277181_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.0	1.5e-21
WP_002294959.1|277393_279169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296138.1|279234_280821_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_002294955.1|281071_281296_+	YneF family protein	NA	NA	NA	NA	NA
WP_002296139.1|281437_283189_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.2	8.2e-56
WP_002296141.1|283188_284973_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	7.8e-46
WP_002296142.1|285298_286150_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002311278.1|286203_287955_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002296145.1|287958_288129_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002296146.1|288168_289071_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296147.1|289301_290705_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002296149.1|290704_292138_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002296150.1|292282_293209_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.4	5.0e-89
WP_002296152.1|293422_295150_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	63.6	3.3e-211
WP_002321425.1|295164_295515_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296156.1|295606_296467_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002287322.1|296558_296987_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002287321.1|297148_297325_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002287318.1|297351_297798_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	39.5	5.3e-20
WP_002296157.1|297951_299331_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002291698.1|300036_301008_+	PhoH family protein	NA	W8D063	Erwinia_phage	49.8	3.5e-48
WP_002296158.1|301031_303224_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_002288749.1|303240_303717_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002301250.1|303700_304096_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_002288753.1|304110_305010_+	GTPase Era	NA	NA	NA	NA	NA
WP_002296160.1|305152_305965_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002296161.1|306348_307266_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002296162.1|307267_309343_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002297218.1|309466_310762_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_000997695.1|311309_312488_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002296753.1|312719_312923_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002296756.1|312922_313273_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_077974298.1|313307_314216_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	318987	383416	3009007	tRNA,transposase	Streptococcus_phage(23.08%)	54	NA	NA
WP_077974289.1|318987_320067_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	4.6e-49
WP_077974301.1|320180_321596_+	sugar transferase	NA	NA	NA	NA	NA
WP_002297171.1|321627_322764_+	glycosyltransferase family 4 protein	NA	A0A1V0SD18	Indivirus	24.8	4.5e-07
WP_002297170.1|322763_323870_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002297169.1|323875_324898_+	polysaccharide biosynthesis protein	NA	A0A0N7KVT5	Yellowstone_lake_phycodnavirus	30.8	5.3e-07
WP_002297168.1|324919_325975_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002321991.1|326592_327828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343622.1|327911_329000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297162.1|328996_330418_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_002297161.1|330510_331170_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002297160.1|331188_332772_+	3-hydroxy-3-methylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_071974461.1|332906_333485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077974303.1|333695_334868_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.7e-121
WP_002317228.1|335288_336329_+	sugar kinase	NA	NA	NA	NA	NA
WP_002297179.1|336571_337510_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	3.6e-10
WP_077974463.1|340350_340467_+	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_002337813.1|340668_341622_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296127.1|341789_343337_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287659.1|343438_343792_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|343781_343976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317192.1|344708_345641_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002317191.1|345622_347086_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002294893.1|347082_347541_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311310.1|347537_348512_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002311311.1|348952_349681_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002311312.1|349698_350895_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002311313.1|350887_351883_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002311314.1|351879_352821_+	hexose kinase	NA	NA	NA	NA	NA
WP_024635520.1|352996_353476_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002311317.1|353488_354379_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002311319.1|354365_355175_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002311321.1|355188_355590_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002317189.1|355635_356586_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002289551.1|357145_357421_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002294889.1|357528_358293_+	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002296302.1|358415_358919_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002296301.1|359327_359969_+	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_002296300.1|360138_361407_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.3	4.4e-43
WP_002296299.1|361433_362633_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002296298.1|362753_364061_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002294874.1|364531_365650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296295.1|366152_366473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288762.1|366925_367126_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002288763.1|367272_370062_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.4e-89
WP_002321579.1|370108_370636_+	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002296294.1|370656_371847_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002288767.1|371886_373185_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002288769.1|374360_375035_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002319756.1|375031_375373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288776.1|375402_375762_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002297218.1|376254_377550_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296577.1|377808_379893_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	4.9e-116
WP_077974307.1|380183_381650_+	amino acid permease	NA	NA	NA	NA	NA
WP_002297185.1|382120_383416_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 5
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	396977	448244	3009007	transposase	Streptococcus_phage(66.67%)	48	NA	NA
WP_086953915.1|396977_398317_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002286474.1|398660_399068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|399081_399483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|399484_399856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101706188.1|399891_400191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070647711.1|400196_400427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286921.1|401043_401706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286925.1|405123_405438_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
WP_002286926.1|405450_405825_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002286928.1|405834_406179_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002286930.1|406249_407602_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.6	5.9e-163
WP_002286932.1|407661_408804_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002286933.1|408828_409083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286934.1|409338_410523_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002305703.1|410519_410657_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|411402_413313_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033657400.1|413416_413641_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	8.8e-24
WP_002288934.1|413653_414154_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_002288935.1|414250_416098_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002297208.1|416100_416997_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288938.1|417046_417436_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002321772.1|417422_419768_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002296840.1|419860_421048_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002289059.1|421348_423478_+	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	3.1e-182
WP_002289057.1|423474_424482_+	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002289055.1|424498_425410_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289053.1|425537_426266_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002321361.1|426262_427672_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289051.1|427999_429121_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|429540_429777_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002343922.1|429729_430683_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002305710.1|431021_431531_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087040414.1|431623_432785_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
WP_002296809.1|433065_434046_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002296810.1|434167_435586_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_002289221.1|435656_437126_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002289220.1|437135_437603_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289219.1|437638_438511_+	ROK family protein	NA	NA	NA	NA	NA
WP_002289218.1|438591_441126_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_002289217.1|441281_442055_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289216.1|442047_442839_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002289215.1|442848_443340_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289214.1|443357_443768_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_077974315.1|443771_445172_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_002289210.1|445194_445569_+	VOC family protein	NA	NA	NA	NA	NA
WP_002285758.1|446057_446252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|446241_446595_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002299190.1|446696_448244_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	472216	571161	3009007	protease,tRNA,holin,portal,terminase,transposase,tail,capsid,integrase,head	Streptococcus_phage(17.39%)	108	498164:498185	539587:539608
WP_002293942.1|472216_472933_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288588.1|472932_474381_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288586.1|474450_474960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297641.1|474949_475675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002333083.1|475897_478018_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.3	1.7e-220
WP_002322842.1|478247_479426_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	5.1e-102
WP_002326253.1|479441_480200_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.9	6.5e-26
WP_002288577.1|480222_480708_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288576.1|480778_482032_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288575.1|482149_483499_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288574.1|483610_484957_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288573.1|485264_485651_-	YxeA family protein	NA	NA	NA	NA	NA
WP_002288571.1|485874_487320_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.2e-125
WP_002311774.1|488374_489334_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002293931.1|489586_489736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297633.1|490197_490410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287775.1|490687_492487_-	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002287776.1|492610_493207_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002325884.1|493398_494352_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296337.1|494623_494968_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002296336.1|494968_495388_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|495479_495830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021415240.1|495795_497016_-	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296332.1|497381_497948_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
498164:498185	attL	AAATCCTGTACCTTCCTTATAT	NA	NA	NA	NA
WP_002343600.1|498286_499435_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	38.9	1.6e-68
WP_002329429.1|499542_500178_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	52.6	5.1e-32
WP_077974328.1|500259_500682_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_010729725.1|500699_501023_-	helix-turn-helix transcriptional regulator	NA	Q9AZJ7	Lactococcus_phage	48.3	7.0e-14
WP_002321800.1|501314_501506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323902.1|501519_501780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073466440.1|501828_502011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002332465.1|502101_502560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350675.1|502727_503045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002329420.1|502977_503457_+	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	49.0	5.3e-34
WP_010725526.1|503473_503650_+	hypothetical protein	NA	D7RWL9	Brochothrix_phage	56.4	3.7e-09
WP_073466443.1|503858_504290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073466445.1|504389_505100_+	AAA family ATPase	NA	A8YQL5	Lactobacillus_phage	64.3	5.4e-83
WP_073466447.1|505071_506595_+	DEAD/DEAH box helicase	NA	Q9T0Y3	Lactobacillus_phage	47.9	1.4e-107
WP_047937921.1|506612_507119_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	45.2	1.1e-34
WP_073466450.1|507118_509455_+	DNA primase	NA	Q9T0Y1	Lactobacillus_phage	51.1	2.2e-226
WP_073466452.1|509769_510087_+	VRR-NUC domain-containing protein	NA	W0G8N0	Listeria_phage	64.1	4.5e-29
WP_002290675.1|510083_510245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305393.1|510241_510547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172801847.1|510546_510864_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	36.4	2.3e-09
WP_002322165.1|510887_511106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305391.1|511290_511758_+	ArpU family transcriptional regulator	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
WP_045135986.1|512141_512516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010726608.1|512552_512720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305386.1|512745_513090_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002296599.1|513094_513376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|513478_513793_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_060811415.1|513770_515465_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.8	7.9e-149
WP_002286530.1|515484_516663_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|516625_517312_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|517311_518472_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_073466483.1|518481_519357_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	73.9	1.6e-129
WP_002286523.1|519353_519665_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|519654_520008_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|519997_520399_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|520391_520796_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002297404.1|520931_522182_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305379.1|522590_523196_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.6	1.1e-33
WP_002286510.1|523215_523578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|523580_523763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305374.1|523779_527199_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	41.5	8.7e-78
WP_002305373.1|527249_527987_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_077974331.1|527996_530288_+|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	29.5	2.8e-88
WP_077974334.1|530311_532402_+	hypothetical protein	NA	A0A249XZH9	Enterococcus_phage	50.0	2.8e-87
WP_002290627.1|532418_532568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286491.1|532564_533011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|533012_533150_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|533187_533481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|533477_533702_+|holin	phage holin	holin	NA	NA	NA	NA
WP_002286484.1|533698_534724_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_002286474.1|537748_538156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|538169_538571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|538572_538944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305364.1|538979_539282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|540615_541794_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
539587:539608	attR	AAATCCTGTACCTTCCTTATAT	NA	NA	NA	NA
WP_002296918.1|542421_543867_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	1.5e-124
WP_002288533.1|544141_546037_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002288531.1|546231_546678_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002296119.1|546905_547055_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002296121.1|547142_547661_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002293906.1|547737_548694_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293905.1|548859_549666_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002320813.1|549662_550652_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002296124.1|550648_551653_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002289886.1|551784_552327_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002289885.1|552346_553045_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002293902.1|553065_553278_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_002288462.1|553277_554240_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002288461.1|554257_554653_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288459.1|554815_555181_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288458.1|555177_556989_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288457.1|557050_557218_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288452.1|557465_558455_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288451.1|558466_559951_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288449.1|559974_560955_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288447.1|561043_561868_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288446.1|561851_562394_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288445.1|562400_562865_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288444.1|562861_563878_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	7.1e-60
WP_002288442.1|564486_565188_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288439.1|565648_566878_+	arginine deiminase	NA	NA	NA	NA	NA
WP_002288437.1|566968_567988_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288434.1|568102_569050_+	carbamate kinase	NA	NA	NA	NA	NA
WP_002288432.1|569469_571161_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
>prophage 7
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	715385	754557	3009007	integrase,protease,tRNA,transposase	Streptococcus_phage(30.0%)	36	715260:715277	748419:748436
715260:715277	attL	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
WP_002288335.1|715385_716087_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002288338.1|716083_717205_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002288340.1|717219_718452_+	peptidase T	NA	NA	NA	NA	NA
WP_002288343.1|718583_719492_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_002305633.1|719526_719799_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002288347.1|719809_720856_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_002301554.1|721106_723716_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	35.0	1.6e-132
WP_002362216.1|723866_724553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288352.1|724530_725025_-	nucleoside deoxyribosyltransferase	NA	A0A1W6JK28	Lactococcus_phage	56.5	7.2e-42
WP_002288353.1|725044_726265_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288355.1|726411_728247_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	3.4e-20
WP_002288357.1|728340_729468_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_000222572.1|729524_730478_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|730633_731812_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002289415.1|732862_733276_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002303864.1|733731_734217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289418.1|734355_734571_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|734794_735595_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002289421.1|735613_737482_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289422.1|737474_737966_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289423.1|737953_738508_+	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289425.1|738525_739521_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|739662_740913_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296624.1|741321_741720_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311093.1|741703_742399_+	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296627.1|742982_743870_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002296628.1|744054_744894_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296629.1|745089_746064_+	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296631.1|746361_746718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296632.1|746720_747878_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296633.1|747903_748344_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296634.1|748503_749010_+	cysteine hydrolase	NA	NA	NA	NA	NA
748419:748436	attR	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
WP_002311095.1|749177_751091_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|751095_752097_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002296638.1|752298_752505_-	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002302440.1|753255_754557_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
>prophage 8
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	897902	961139	3009007	tRNA,transposase	Lysinibacillus_phage(11.11%)	60	NA	NA
WP_000222572.1|897902_898856_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002288890.1|899109_900816_+	fibronectin/fibrinogen-binding protein	NA	NA	NA	NA	NA
WP_002288888.1|900973_901876_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002321477.1|901872_902565_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002288886.1|902607_903249_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002299722.1|903286_903556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101706180.1|903528_904218_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002288882.1|904224_904941_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002288880.1|904937_905870_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002288879.1|905866_906643_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_002288878.1|906696_909882_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_002288877.1|909886_910963_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.4	5.2e-61
WP_002288875.1|910967_912248_-	dihydroorotase	NA	NA	NA	NA	NA
WP_002288872.1|912266_913193_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	33.0	3.6e-26
WP_002288870.1|913205_914489_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	37.3	3.2e-65
WP_002295862.1|914502_915042_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_002295861.1|915276_916188_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.1	2.4e-11
WP_002295859.1|916184_916649_-	signal peptidase II	NA	NA	NA	NA	NA
WP_002295857.1|916653_917352_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002295856.1|917338_917725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295854.1|917871_919542_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_002303804.1|919724_919958_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	49.2	5.6e-13
WP_002295850.1|920056_920488_-	EbsA family protein	NA	NA	NA	NA	NA
WP_002295847.1|920566_920980_+	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_002295845.1|921017_922166_-	cation transporter	NA	NA	NA	NA	NA
WP_002295844.1|922287_922884_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002296111.1|923083_925726_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.4	9.7e-69
WP_002289191.1|926113_926545_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002289190.1|926589_927939_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	31.7	3.6e-51
WP_002289189.1|928008_929172_-	RDD family protein	NA	NA	NA	NA	NA
WP_002289192.1|929300_929624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296108.1|929806_931156_-	amino acid permease	NA	NA	NA	NA	NA
WP_002289187.1|931224_932178_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_002289186.1|932279_933470_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	33.3	3.7e-52
WP_002289185.1|934114_934798_-	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	2.5e-13
WP_002289184.1|934878_936375_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_002289183.1|936420_937587_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_077974362.1|938184_938604_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_002299695.1|938693_939233_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_002289604.1|939296_939944_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	37.5	1.7e-22
WP_002289606.1|939933_942315_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_002289611.1|942611_943145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296097.1|943270_943948_-	endonuclease III	NA	NA	NA	NA	NA
WP_002289610.1|943954_944653_-	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	42.5	4.9e-12
WP_002296096.1|944920_946105_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_002289545.1|946110_946554_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296094.1|946779_947067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289543.1|947237_948590_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002289542.1|948862_949309_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_002297218.1|949498_950794_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296093.1|951066_951993_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	57.2	2.7e-98
WP_002297185.1|952250_953546_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002295819.1|953654_954542_-	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	43.2	4.5e-18
WP_016171142.1|954723_955677_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002295818.1|955854_957852_-	transketolase	NA	NA	NA	NA	NA
WP_002295816.1|957953_958205_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_002296572.1|958351_958975_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	59.4	2.2e-16
WP_002297436.1|959154_959373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287525.1|959569_960718_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|960734_961139_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
>prophage 9
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	1063610	1072671	3009007		Synechococcus_phage(16.67%)	9	NA	NA
WP_002288010.1|1063610_1064189_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
WP_002288011.1|1064185_1065238_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288013.1|1065260_1066700_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288015.1|1066684_1068907_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288017.1|1068907_1069579_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002295474.1|1069580_1069835_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288021.1|1069834_1070563_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002297115.1|1070818_1071196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288023.1|1071375_1072671_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
>prophage 10
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	1113019	1177484	3009007	protease,tRNA,transposase	Streptococcus_phage(15.0%)	60	NA	NA
WP_002297218.1|1113019_1114315_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289257.1|1114602_1115343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289258.1|1115472_1116420_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002289259.1|1116548_1117313_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002297001.1|1117316_1117706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289260.1|1117840_1118383_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_002289266.1|1118530_1119163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296999.1|1119296_1119422_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002289262.1|1119555_1120449_-	DUF1803 domain-containing protein	NA	NA	NA	NA	NA
WP_002289263.1|1120630_1121557_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_002289264.1|1121641_1122403_-	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_002289265.1|1122646_1124878_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.5	2.4e-169
WP_002320956.1|1125154_1127605_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	9.2e-98
WP_002303746.1|1127616_1129662_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.3	2.4e-115
WP_002296996.1|1129827_1130262_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_002296995.1|1130388_1131027_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_002296994.1|1131158_1132034_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_002290223.1|1132115_1132907_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_002288421.1|1132924_1134325_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.8	1.7e-43
WP_002288419.1|1134338_1134887_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_002287107.1|1135296_1136547_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002288415.1|1136706_1137612_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	9.4e-32
WP_086953915.1|1138922_1140262_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002320953.1|1140750_1142127_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_002288411.1|1142095_1144174_-	type I DNA topoisomerase	NA	A0A167R9A0	Powai_lake_megavirus	38.5	1.2e-101
WP_002303743.1|1144295_1145153_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002296990.1|1145208_1145976_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.5	2.7e-27
WP_002296988.1|1145968_1146829_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002288405.1|1147088_1147487_+	VOC family protein	NA	NA	NA	NA	NA
WP_002320949.1|1147765_1148266_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002294418.1|1148348_1148900_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002288398.1|1149051_1149279_-	YozE family protein	NA	NA	NA	NA	NA
WP_002288397.1|1149275_1149794_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288396.1|1149813_1150527_-	YpmS family protein	NA	NA	NA	NA	NA
WP_002288395.1|1150529_1151426_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288394.1|1151583_1152426_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.2	6.5e-19
WP_002288393.1|1152557_1153211_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002288392.1|1153273_1153801_-	dihydrofolate reductase	NA	A0A1D6X864	Bacillus_phage	37.1	6.7e-22
WP_002294416.1|1153820_1154768_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	7.1e-123
WP_002288390.1|1154779_1156666_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.6e-52
WP_002324658.1|1156830_1158903_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002290188.1|1158915_1159191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1159585_1160881_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002290187.1|1161074_1161530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294414.1|1161683_1162892_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.7	1.5e-45
WP_002290045.1|1163003_1163336_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002294412.1|1163483_1164359_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.3	5.9e-63
WP_002289878.1|1164440_1165022_-	YpiB family protein	NA	NA	NA	NA	NA
WP_002289879.1|1165027_1166287_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002294410.1|1166288_1167335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290178.1|1167569_1167845_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	69.7	1.8e-26
WP_002296982.1|1168087_1169398_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_002294406.1|1169579_1170809_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002303123.1|1170943_1171624_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002294404.1|1171672_1172308_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002303122.1|1172373_1173777_-	ATP-dependent DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.4	6.5e-64
WP_002305295.1|1173763_1174795_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002294401.1|1174825_1175047_+	ferredoxin	NA	NA	NA	NA	NA
WP_002294400.1|1175211_1175949_-	thioesterase	NA	NA	NA	NA	NA
WP_002302440.1|1176182_1177484_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
>prophage 11
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	1185658	1239332	3009007	transposase	Streptococcus_phage(18.18%)	44	NA	NA
WP_002302440.1|1185658_1186960_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002297218.1|1187096_1188392_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002322512.1|1188458_1188932_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_002290060.1|1189036_1189900_-	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_002321398.1|1190095_1192195_-	TFIIB-type zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002289498.1|1192414_1193524_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.9	9.8e-39
WP_002289497.1|1193547_1195389_-	DNA primase	NA	A0A1S5RH70	Helicobacter_phage	32.1	1.2e-49
WP_002303731.1|1195570_1197886_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.2	9.2e-39
WP_002289459.1|1198070_1198931_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_002303352.1|1198989_1199511_-	lysozyme family protein	NA	A0A0N9SIT8	Bacillus_phage	38.1	4.6e-15
WP_002289461.1|1199788_1200550_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002294379.1|1200575_1203167_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_002289463.1|1203354_1204542_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	28.5	1.3e-33
WP_002289464.1|1204909_1205266_+	YxeA family protein	NA	NA	NA	NA	NA
WP_002294378.1|1205506_1206511_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002289273.1|1206676_1207528_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	1.4e-53
WP_002289275.1|1207544_1207790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289272.1|1207976_1208681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289271.1|1209010_1211452_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_077974289.1|1211748_1212828_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	4.6e-49
WP_002289270.1|1213029_1214184_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_002289269.1|1214205_1214958_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002294372.1|1215321_1217988_-	cation-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	30.1	1.6e-82
WP_002289473.1|1218328_1219780_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002289472.1|1220108_1220924_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_002289474.1|1221217_1221493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289471.1|1221919_1222375_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002289470.1|1222454_1223204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289468.1|1223204_1223531_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289467.1|1223678_1224119_-	universal stress protein	NA	NA	NA	NA	NA
WP_002296967.1|1224199_1225597_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002294365.1|1225749_1227021_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296966.1|1227147_1227867_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288275.1|1228244_1229219_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_002288276.1|1229271_1229877_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002288278.1|1229970_1230723_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_002288318.1|1230736_1230997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288281.1|1231018_1232380_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288285.1|1232452_1232752_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|1233161_1234412_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002291790.1|1234554_1234887_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002297183.1|1234886_1236749_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|1236973_1237927_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|1238153_1239332_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	1269961	1332867	3009007	protease,tRNA,transposase	Lysinibacillus_phage(28.57%)	54	NA	NA
WP_002297185.1|1269961_1271257_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_060799217.1|1271426_1271606_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002295352.1|1271663_1272233_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_002295354.1|1272418_1273321_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295355.1|1273355_1275140_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002304759.1|1275213_1276176_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002303521.1|1276343_1279658_-	DNA polymerase III subunit alpha	NA	R4TB75	Streptomyces_phage	33.0	1.8e-149
WP_002295359.1|1279888_1280074_+	YjzD family protein	NA	NA	NA	NA	NA
WP_077974372.1|1280135_1281332_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002295362.1|1281501_1282938_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.0	3.8e-43
WP_002296740.1|1283230_1284040_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002297218.1|1284216_1285512_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002302928.1|1285747_1287901_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_002287653.1|1288295_1289144_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287651.1|1289367_1291308_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.2	3.3e-114
WP_002287649.1|1291644_1291824_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_002287647.1|1291870_1293694_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.1	6.5e-64
WP_002287644.1|1293971_1296251_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002287642.1|1296343_1296991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287641.1|1297169_1297889_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002287640.1|1298019_1299171_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002287639.1|1299387_1300128_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_033582077.1|1300131_1300455_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_002287635.1|1300511_1301105_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002287632.1|1301088_1301739_-	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	33.2	4.9e-22
WP_002287630.1|1301748_1302060_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_002302927.1|1302075_1303185_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_002287626.1|1303181_1303709_-	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_002287624.1|1303888_1304674_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_002287623.1|1304666_1305536_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_002287622.1|1305536_1306916_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002287621.1|1306923_1307343_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002302926.1|1307367_1307844_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002287619.1|1307846_1309082_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_002287617.1|1309100_1309838_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	4.1e-17
WP_002287616.1|1309849_1310767_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002287614.1|1310873_1311098_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_002287612.1|1311150_1312113_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002287610.1|1312122_1312563_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287608.1|1312868_1313834_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_002287607.1|1313890_1314121_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_002287606.1|1314206_1315094_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002287605.1|1315182_1316406_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002287604.1|1316422_1317502_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_077974373.1|1317666_1318971_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.4	1.2e-48
WP_002297185.1|1319097_1320393_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002287603.1|1320655_1322383_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	35.9	9.3e-20
WP_002287602.1|1322382_1322649_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_002287598.1|1323127_1325362_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	5.1e-127
WP_002290825.1|1325509_1325830_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002295394.1|1326455_1328036_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.4	5.1e-33
WP_002295395.1|1328436_1329813_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002290821.1|1329940_1331059_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002297185.1|1331571_1332867_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 13
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	1353084	1401498	3009007	protease,holin,portal,terminase,plate,transposase,tail,capsid,integrase,head	Enterococcus_phage(27.27%)	64	1379179:1379195	1403923:1403939
WP_002347285.1|1353084_1354380_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002287105.1|1354535_1355510_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002287107.1|1355919_1357170_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1357455_1357713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305693.1|1357944_1358376_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_000997695.1|1360085_1361264_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|1361433_1362772_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_077974374.1|1362816_1363836_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.7	1.1e-60
WP_002286683.1|1363832_1364057_-|holin	phage holin	holin	NA	NA	NA	NA
WP_002303476.1|1364053_1364347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002327992.1|1364383_1364521_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002332429.1|1364522_1364969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164853016.1|1364965_1365115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077974376.1|1365128_1367171_-|plate	BppU family phage baseplate upper protein	plate	A0A096XSZ6	Enterococcus_phage	46.5	7.7e-82
WP_002290629.1|1367188_1368013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071244211.1|1368016_1369066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342059.1|1369062_1369935_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_077974380.1|1369938_1376673_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	36.6	2.0e-17
WP_002337251.1|1376867_1377176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371755.1|1377221_1377689_-	Ig domain-containing protein	NA	C9E2K1	Enterococcus_phage	43.9	8.1e-19
WP_077974382.1|1377761_1378349_-|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	41.0	1.6e-35
WP_077974383.1|1378409_1378820_-	hypothetical protein	NA	A0A059T681	Listeria_phage	48.0	1.6e-23
WP_073357564.1|1378816_1379221_-	hypothetical protein	NA	A0A2H4J7V9	uncultured_Caudovirales_phage	38.5	7.7e-18
1379179:1379195	attL	CTTGGATTGTTTCTTGA	NA	NA	NA	NA
WP_073357576.1|1379236_1379608_-|head,tail	phage head-tail adapter protein	head,tail	A0A059T6F2	Listeria_phage	55.4	1.2e-28
WP_002371763.1|1379588_1379867_-	hypothetical protein	NA	A0A1W6JQ66	Staphylococcus_phage	48.2	1.8e-13
WP_071244203.1|1379942_1381103_-|capsid	phage major capsid protein	capsid	D2XR18	Bacillus_phage	39.7	8.3e-65
WP_002371767.1|1381107_1381812_-|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	45.9	9.5e-48
WP_073357563.1|1381798_1382971_-|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	46.6	6.8e-83
WP_158182303.1|1383014_1384097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073357561.1|1384131_1385775_-|terminase	terminase large subunit	terminase	A0A1S5SF58	Streptococcus_phage	65.3	1.8e-206
WP_073357560.1|1385771_1386131_-	hypothetical protein	NA	A0A2H4JAH7	uncultured_Caudovirales_phage	67.2	5.2e-34
WP_071244186.1|1386291_1386552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077974384.1|1386542_1386854_-	HNH endonuclease	NA	A0A1S5SFB3	Streptococcus_phage	59.2	6.3e-28
WP_077974385.1|1386854_1387427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010722450.1|1387467_1387752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071244178.1|1387748_1387976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060809366.1|1388016_1388277_-	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	50.0	1.0e-15
WP_060809367.1|1388266_1388455_-	hypothetical protein	NA	F0PII8	Enterococcus_phage	83.3	2.2e-20
WP_002318885.1|1389014_1389431_-	autolysin	NA	C9E2P5	Enterococcus_phage	68.1	4.8e-47
WP_060809368.1|1389508_1389805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060809369.1|1389801_1390005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060809370.1|1390028_1390334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060809371.1|1390330_1390552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371781.1|1390552_1390891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060809372.1|1390887_1391301_-	hypothetical protein	NA	A0A2H4J466	uncultured_Caudovirales_phage	34.2	2.5e-11
WP_002311440.1|1391297_1391471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060809373.1|1391467_1391785_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	36.4	4.6e-10
WP_172801849.1|1391784_1392084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323159.1|1392086_1392248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321420.1|1392262_1392622_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	1.1e-18
WP_002323158.1|1392618_1393470_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_077974387.1|1393486_1394317_-	phage replisome organizer N-terminal domain-containing protein	NA	C9E2N2	Enterococcus_phage	45.5	4.0e-53
WP_077974388.1|1394319_1395006_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	68.6	7.0e-88
WP_002286557.1|1395011_1395683_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|1395675_1396017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|1396194_1396893_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|1396979_1397450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296610.1|1397492_1397672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325021.1|1397702_1397951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002315391.1|1397962_1398148_-	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	56.7	8.4e-12
WP_002337457.1|1398433_1398808_+	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	44.6	6.9e-21
WP_070676686.1|1398812_1399241_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_077974389.1|1399331_1400246_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_077974390.1|1400361_1401498_+|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	37.1	1.7e-54
1403923:1403939	attR	CTTGGATTGTTTCTTGA	NA	NA	NA	NA
>prophage 14
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	1529056	1537528	3009007		Streptococcus_phage(66.67%)	9	NA	NA
WP_002288083.1|1529056_1531246_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
WP_077974401.1|1531560_1532163_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.0	4.9e-53
WP_002294035.1|1532216_1533338_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288078.1|1533446_1534319_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002288076.1|1534387_1534735_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288073.1|1534727_1535552_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288071.1|1535587_1536526_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002292340.1|1536539_1536869_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_002294039.1|1536883_1537528_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
>prophage 15
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	1959516	2021654	3009007	tRNA,transposase	Staphylococcus_phage(18.18%)	53	NA	NA
WP_077974303.1|1959516_1960689_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.7e-121
WP_002305330.1|1960782_1962420_+	membrane protein	NA	NA	NA	NA	NA
WP_002294728.1|1962564_1963305_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_077974433.1|1963495_1964131_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002294732.1|1964277_1965519_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002302657.1|1965716_1966715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302655.1|1966727_1968746_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_002294735.1|1968805_1969522_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002294738.1|1969748_1970291_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_002294740.1|1970295_1970523_-	cation transporter	NA	NA	NA	NA	NA
WP_002302653.1|1970601_1972482_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	2.2e-99
WP_002302651.1|1972670_1973285_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002302649.1|1973426_1973987_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002312639.1|1976933_1977803_-	ROK family protein	NA	NA	NA	NA	NA
WP_002317128.1|1977822_1978944_-	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_002312636.1|1978945_1979341_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002312634.1|1979359_1980157_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002312633.1|1980158_1980947_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002312631.1|1980960_1981437_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002323457.1|1981508_1984166_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_002317125.1|1984184_1984589_-	type I restriction-modification system subunit M N-terminal domain-containing protein	NA	A0A2H4PQP4	Staphylococcus_phage	41.4	4.7e-15
WP_002313258.1|1984820_1985078_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_002324517.1|1985202_1985535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087043335.1|1986067_1987230_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_010706118.1|1987298_1987505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077974435.1|1987667_1989302_-	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	28.8	8.2e-42
WP_002312624.1|1989305_1990679_-	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	23.4	1.1e-12
WP_002312623.1|1990694_1990934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323671.1|1991115_1993791_-	DUF927 domain-containing protein	NA	A0A2H4J8K1	uncultured_Caudovirales_phage	28.0	2.5e-24
WP_002312619.1|1993973_1994897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301399.1|1995354_1996314_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002312618.1|1996484_1997489_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002312617.1|1997559_1997856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296258.1|1997848_1998142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312616.1|1998287_1998839_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002312614.1|1999012_1999312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323668.1|1999338_1999647_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002312610.1|1999763_2000723_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002312609.1|2000866_2001643_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002298781.1|2001740_2002388_-	HAD family phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.4	4.5e-12
WP_002312607.1|2002387_2003218_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002298779.1|2003217_2003967_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298777.1|2003980_2004445_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002312606.1|2004494_2004956_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298774.1|2004937_2005912_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301399.1|2006047_2007007_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287852.1|2012938_2014339_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_002287851.1|2014351_2015863_-	glutamate:gamma-aminobutyrate antiporter	NA	NA	NA	NA	NA
WP_002287847.1|2017515_2018091_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	54.5	4.4e-51
WP_014748620.1|2018133_2018331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287845.1|2018672_2019065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287844.1|2019492_2020185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287843.1|2020484_2021654_-|transposase	IS256-like element ISEfa13 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	2297367	2362956	3009007	integrase,protease,transposase	Streptococcus_phage(14.29%)	58	2297178:2297193	2357391:2357406
2297178:2297193	attL	GAAAAATGCTTTTGCT	NA	NA	NA	NA
WP_002289035.1|2297367_2299860_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	38.3	9.0e-125
WP_002289033.1|2300080_2301004_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_002304804.1|2301009_2302263_+	U32 family peptidase	NA	Q6DW11	Phage_TP	32.9	1.3e-42
WP_002289031.1|2302396_2303743_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_001015311.1|2303929_2304610_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002304811.1|2304683_2305673_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_002289388.1|2305808_2306615_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	1.3e-08
WP_002289390.1|2306611_2307517_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289394.1|2307534_2308503_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002295964.1|2309230_2312848_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.7	1.5e-48
WP_002288141.1|2312905_2316580_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.9	6.5e-63
WP_002288139.1|2317174_2318200_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002303706.1|2318474_2320160_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002288135.1|2320173_2321457_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002288134.1|2321526_2322396_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002288133.1|2322392_2323229_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288131.1|2323254_2324322_+	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002288129.1|2324318_2325146_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002288127.1|2325190_2326216_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002288124.1|2326212_2328396_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_002288122.1|2328395_2329526_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	51.6	1.6e-73
WP_002288121.1|2329522_2330200_+	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	23.2	1.6e-07
WP_002288119.1|2330283_2330811_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288144.1|2331011_2331698_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_002288118.1|2331777_2333316_+	gluconokinase	NA	NA	NA	NA	NA
WP_002297290.1|2333435_2333903_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_002295975.1|2334421_2334865_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002287505.1|2334880_2335273_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_010729268.1|2335360_2336587_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_074394656.1|2336658_2336817_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010729270.1|2337508_2338228_+	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.7	1.6e-18
WP_010729271.1|2338229_2339072_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_010729812.1|2339068_2340019_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297302.1|2340033_2340267_+	iron-dependent repressor	NA	NA	NA	NA	NA
WP_074394433.1|2340597_2341182_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729275.1|2341311_2341980_+	cobalt ABC transporter permease	NA	NA	NA	NA	NA
WP_002303655.1|2341990_2343406_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.8e-20
WP_002302405.1|2343423_2343993_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002302406.1|2344102_2345857_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_031316216.1|2345816_2347583_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.1	3.5e-30
WP_002297316.1|2348105_2348375_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002297318.1|2348389_2348569_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297319.1|2348600_2348978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297320.1|2348998_2349148_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002304819.1|2349171_2350155_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_002322279.1|2350184_2350307_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002297324.1|2350324_2351848_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002304820.1|2351871_2352111_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297325.1|2352303_2352765_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.5e-12
WP_002317220.1|2352959_2353178_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297326.1|2353295_2354912_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_077828743.1|2356768_2356924_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002311665.1|2357219_2357552_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2357391:2357406	attR	AGCAAAAGCATTTTTC	NA	NA	NA	NA
WP_002304825.1|2358065_2358257_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297333.1|2358350_2358737_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002297334.1|2359430_2360636_+	YSIRK-targeted surface antigen transcriptional regulator	NA	NA	NA	NA	NA
WP_002332818.1|2360652_2361087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|2361768_2362956_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
>prophage 17
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	2378182	2389943	3009007		Streptococcus_phage(88.89%)	10	NA	NA
WP_002297345.1|2378182_2379094_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
WP_002297346.1|2379112_2380117_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297347.1|2380113_2382237_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_010729283.1|2382241_2384689_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.9	0.0e+00
WP_002297349.1|2384675_2385065_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_002297350.1|2385124_2385628_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_033658092.1|2385640_2385865_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002286940.1|2385968_2387879_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_002317225.1|2388624_2388762_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002297353.1|2388758_2389943_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
>prophage 18
NZ_CP019208	Enterococcus faecium strain 2014-VREF-41 chromosome, complete genome	3009007	2925951	2992532	3009007	integrase,tRNA,transposase	Streptococcus_phage(21.43%)	55	2983576:2983591	2993328:2993343
WP_002297404.1|2925951_2927202_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287122.1|2927611_2928493_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.3	1.3e-73
WP_002294021.1|2928792_2929170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287124.1|2929775_2930390_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002294022.1|2931162_2932902_+	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002287126.1|2933058_2934243_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_002287127.1|2934353_2934557_+	CsbD family protein	NA	NA	NA	NA	NA
WP_002287128.1|2934657_2935320_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	2.5e-21
WP_002287129.1|2935332_2936835_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287130.1|2937382_2939062_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002287132.1|2939188_2939668_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_002287133.1|2939886_2940567_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002287134.1|2940574_2941906_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002287135.1|2941920_2942883_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_002287137.1|2942993_2943332_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002287139.1|2943410_2944118_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_077974461.1|2944282_2945578_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002287140.1|2945742_2947224_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002287143.1|2947532_2948069_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287145.1|2948146_2949517_+	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002287147.1|2949583_2949919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305494.1|2949999_2950857_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002287154.1|2950963_2951479_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_002287235.1|2951572_2951827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287155.1|2951795_2953181_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002287156.1|2953217_2953895_+	YutD family protein	NA	NA	NA	NA	NA
WP_002287159.1|2953902_2954667_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_002287161.1|2954668_2955328_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_002287163.1|2955357_2955867_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.1	1.5e-39
WP_002287165.1|2955978_2956977_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	54.1	2.6e-30
WP_002297404.1|2957301_2958552_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287167.1|2958960_2959545_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.4	2.0e-27
WP_002311494.1|2959621_2960815_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002287231.1|2960878_2961259_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002287172.1|2961332_2961695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|2967693_2968989_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_086956687.1|2969390_2970553_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287966.1|2970761_2971136_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002287965.1|2971249_2971879_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002296289.1|2972509_2972674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294080.1|2972968_2974297_+	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	38.1	7.3e-73
WP_002287963.1|2974498_2975332_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002287962.1|2975347_2976085_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_002287961.1|2976239_2977208_-	asparaginase	NA	NA	NA	NA	NA
WP_002287960.1|2977439_2978273_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_002287959.1|2978306_2979146_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287958.1|2979171_2979732_+	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	45.1	2.3e-28
WP_002287957.1|2979930_2981652_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002287956.1|2981816_2982959_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002287955.1|2982974_2984186_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
2983576:2983591	attL	GAGTGGAAATTGAAGC	NA	NA	NA	NA
WP_002287954.1|2984758_2985406_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287953.1|2985798_2988444_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002294071.1|2988753_2990067_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287951.1|2990056_2990710_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002300186.1|2991446_2992532_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	28.3	1.2e-12
2993328:2993343	attR	GAGTGGAAATTGAAGC	NA	NA	NA	NA
>prophage 1
NZ_CP019209	Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence	215998	1701	68564	215998	transposase	Streptococcus_phage(36.36%)	57	NA	NA
WP_002319817.1|1701_2382_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002321606.1|2641_3247_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	33.2	1.2e-19
WP_000824191.1|3291_3459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|3492_3792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|3832_4450_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_002304891.1|4774_5170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|5249_7601_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_002297185.1|7826_9122_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.8	5.3e-44
WP_000751236.1|9951_10404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325565.1|10534_11215_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_002300494.1|11316_12636_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|12632_13286_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_010729371.1|13573_14848_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.6	1.2e-56
WP_032494987.1|14902_16468_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.6	2.4e-19
WP_002285758.1|16601_16796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|16785_17139_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|17240_18788_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002288609.1|19179_20112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288608.1|20151_21813_-	hyaluronate lyase	NA	NA	NA	NA	NA
WP_002305865.1|21809_24791_-	glycoside hydrolase family 42	NA	L0N6M2	Herpes_simplex_virus	28.8	2.2e-122
WP_002304880.1|24918_26832_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002304878.1|26861_27473_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_010729380.1|27523_28996_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002289655.1|29019_29931_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002304874.1|29942_30881_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002340467.1|31109_32684_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.0	9.4e-11
WP_002302980.1|32661_33390_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729381.1|33772_35047_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002299919.1|36640_36970_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_002299921.1|36959_37232_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002299923.1|37682_38486_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002299925.1|38463_39588_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	1.0e-22
WP_002299926.1|39603_40419_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_014748799.1|40408_41299_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002299928.1|41365_42655_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010729383.1|44003_45482_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	3.1e-125
WP_077974474.1|45471_46671_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	24.7	1.3e-25
WP_002298085.1|46800_48177_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|48176_48833_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|48842_50120_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087121905.1|50369_51531_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_010729386.1|51561_52011_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_002298088.1|52166_52709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331383.1|53702_54383_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_002292681.1|55053_55602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292680.1|55602_56460_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002292678.1|57021_57351_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002314366.1|57427_57700_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002297422.1|57699_57963_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002336205.1|59107_60283_-	MFS transporter	NA	NA	NA	NA	NA
WP_002314387.1|60285_62535_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002338109.1|62631_63486_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002323400.1|64569_65505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290394.1|66063_66381_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002323399.1|66381_66636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|66994_67399_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323589.1|67415_68564_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
>prophage 2
NZ_CP019209	Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence	215998	74209	121493	215998	transposase,holin	Streptococcus_phage(40.0%)	51	NA	NA
WP_002297404.1|74209_75460_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305801.1|75869_78242_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002347152.1|78302_79763_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_002305772.1|79773_81978_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	50.7	6.1e-117
WP_002303309.1|81993_82143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303311.1|82218_82812_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_002303312.1|82824_83724_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002303313.1|83726_84212_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	59.3	5.8e-44
WP_002316074.1|84352_84556_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002295623.1|84630_84891_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	1.2e-11
WP_002347218.1|85327_85534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296238.1|85533_85785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300851.1|85799_86237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303117.1|86229_86937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120991.1|87317_87497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000388479.1|87627_87897_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000588503.1|87889_88147_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002347142.1|88605_88761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001809248.1|88784_89609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261742.1|89773_90388_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	3.8e-16
WP_002303116.1|90625_91048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299573.1|91057_91261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299575.1|91471_92056_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_010861579.1|92244_92925_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
WP_077974489.1|93149_94940_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_010729807.1|94952_95585_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
WP_077974475.1|95789_96017_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_014748823.1|96085_96352_+	antitoxin	NA	NA	NA	NA	NA
WP_002389879.1|96341_96611_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
WP_002302440.1|96789_98091_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002296127.1|98316_99864_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002287659.1|99965_100319_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|100308_100503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729749.1|100581_101874_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002336724.1|102636_103605_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002288615.1|103615_104431_+	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_010729750.1|104498_105209_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288620.1|105244_106486_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_002296840.1|106543_107731_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002298077.1|108265_109666_+	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002322961.1|109698_109866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350223.1|110731_111592_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002350224.1|112012_112945_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002339141.1|112987_113599_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.2	1.7e-56
WP_002339142.1|113618_114839_+	PAS domain-containing protein	NA	A0A2P0ZL82	Lactobacillus_phage	58.5	3.9e-57
WP_002336713.1|114896_115577_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_002331328.1|116072_116294_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002342384.1|116309_117152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729753.1|117214_119017_+	3'-5' exoribonuclease	NA	A0A0A7RWA3	Clostridium_phage	30.4	7.6e-33
WP_010729754.1|119075_119984_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002301399.1|120533_121493_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	5.0e-31
>prophage 3
NZ_CP019209	Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence	215998	137265	209405	215998	integrase,transposase	Bacillus_phage(28.57%)	57	148461:148487	189234:189260
WP_044383156.1|137265_137946_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.2e-109
WP_002326556.1|138397_138988_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	33.1	8.3e-21
WP_077974478.1|139841_141011_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_077974303.1|141168_142341_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.7e-121
WP_077974289.1|142707_143787_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	34.9	3.9e-48
WP_002301108.1|144281_144836_+|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_077974490.1|145712_145919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172801850.1|146140_146998_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
148461:148487	attL	ATTTACACAAAATTATTGACGCTCCCA	NA	NA	NA	NA
WP_073466303.1|148853_150053_+	MFS transporter	NA	NA	NA	NA	NA
WP_073466287.1|151916_152675_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077974480.1|152858_153767_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_073466326.1|153891_154827_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_073466327.1|154823_156269_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002336650.1|156296_156752_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005880910.1|156770_157745_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002329840.1|158499_159183_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	6.5e-126
WP_002290378.1|159764_160790_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002335321.1|161083_162193_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047929206.1|163187_164012_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002341308.1|164043_165354_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_010728938.1|165501_165651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010728938.1|165664_165814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002290371.1|165827_167087_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002290370.1|167096_167969_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002290368.1|167980_168811_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002324534.1|168850_171034_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_073466380.1|171094_172315_+	oligo-1,6-glucosidase	NA	NA	NA	NA	NA
WP_002324531.1|172311_173772_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002290357.1|175276_175486_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_002290356.1|175478_175628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002324528.1|175781_176447_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	31.1	3.9e-19
WP_002290352.1|176730_177816_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002290351.1|178149_178383_+	addiction module antitoxin	NA	NA	NA	NA	NA
WP_002329899.1|178379_178787_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	38.9	4.0e-14
WP_002287870.1|179923_180442_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_086953888.1|181620_182782_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_065305738.1|183280_183757_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289252.1|183769_185272_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002289253.1|185285_185975_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_077974484.1|186135_186954_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065305739.1|188028_189207_+|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002330944.1|191053_192304_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
189234:189260	attR	ATTTACACAAAATTATTGACGCTCCCA	NA	NA	NA	NA
WP_002298736.1|192322_193249_-	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_002301128.1|193327_194323_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|194338_195508_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|195523_196258_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956687.1|197028_198191_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_086953915.1|198448_199787_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002301811.1|200178_201471_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|201744_202005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002346943.1|202255_203434_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
WP_073120200.1|203785_204082_+|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	59.2	6.7e-19
WP_002287876.1|205030_205426_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_002287875.1|205435_206284_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_002287874.1|206298_207126_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_002349114.1|207137_207998_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_002300493.1|208235_209405_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP019210	Enterococcus faecium strain 2014-VREF-41 plasmid p41-2, complete sequence	45501	4255	17176	45501	transposase	Streptococcus_phage(30.0%)	16	NA	NA
WP_001015311.1|4255_4936_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000947691.1|5348_6842_-	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000429439.1|7453_8407_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
WP_001196543.1|8378_8654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199136.1|8846_9101_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_002322130.1|9211_9466_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	50.0	4.1e-09
WP_086953888.1|9506_10668_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_073120187.1|10769_11342_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_002303206.1|11814_12387_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_000599739.1|12402_13008_-	cell filamentation protein	NA	NA	NA	NA	NA
WP_001015311.1|13205_13886_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002288897.1|13981_14605_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
WP_000774078.1|14875_15388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357244.1|15394_15913_-	YfbU family protein	NA	NA	NA	NA	NA
WP_002349227.1|16074_16287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015311.1|16495_17176_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
>prophage 2
NZ_CP019210	Enterococcus faecium strain 2014-VREF-41 plasmid p41-2, complete sequence	45501	27739	36176	45501	transposase	Streptococcus_phage(28.57%)	9	NA	NA
WP_001015311.1|27739_28420_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000402347.1|28514_29123_-	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_001079845.1|29128_30160_-	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_001059542.1|30152_31121_-	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_002305818.1|31335_32490_-	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001280781.1|32467_33163_-	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002323245.1|33314_34487_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001226076.1|34708_35284_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.8	9.0e-20
WP_001015311.1|35495_36176_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
