The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017238	Burkholderia cenocepacia strain CR318 chromosome 1, complete sequence	3511146	300718	338750	3511146	holin,portal,plate,capsid,integrase,head,tail,terminase	Burkholderia_phage(95.56%)	49	300609:300654	339084:339129
300609:300654	attL	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAA	NA	NA	NA	NA
WP_078040538.1|300718_301840_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	93.5	5.4e-194
WP_078040539.1|301707_302124_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078040540.1|302728_305521_-	hypothetical protein	NA	A0A1S5NPU9	Burkholderia_phage	97.1	0.0e+00
WP_078040541.1|305523_305790_-	hypothetical protein	NA	E5E3T3	Burkholderia_phage	96.2	4.3e-33
WP_078040542.1|305786_306149_-	hypothetical protein	NA	E5E3T4	Burkholderia_phage	95.0	3.6e-59
WP_078040543.1|306153_306348_-	hypothetical protein	NA	E5E3T5	Burkholderia_phage	96.9	3.8e-23
WP_059541883.1|306594_306807_-	hypothetical protein	NA	E5E3T7	Burkholderia_phage	90.0	1.1e-31
WP_016038187.1|306893_307142_-	ogr/Delta-like zinc finger family protein	NA	E5E3T8	Burkholderia_phage	100.0	4.4e-40
WP_078040544.1|307129_307333_-	hypothetical protein	NA	E5E3T9	Burkholderia_phage	97.0	2.4e-28
WP_078040545.1|307372_307570_-	hypothetical protein	NA	E5E3U0	Burkholderia_phage	95.4	9.8e-27
WP_078040546.1|307584_307794_-	hypothetical protein	NA	E5E3U1	Burkholderia_phage	95.7	8.0e-27
WP_078041087.1|307882_308371_+	helix-turn-helix transcriptional regulator	NA	E5E3U2	Burkholderia_phage	74.2	6.0e-57
WP_078040547.1|308542_308830_+	hypothetical protein	NA	E5E3U3	Burkholderia_phage	93.3	2.5e-39
WP_078040548.1|308876_309968_-	phage late control D family protein	NA	E5E3U4	Burkholderia_phage	98.3	1.6e-198
WP_078040549.1|309964_310423_-	oxidoreductase	NA	E5E3U5	Burkholderia_phage	98.7	2.6e-78
WP_078040550.1|310444_313606_-	hypothetical protein	NA	E5E3U6	Burkholderia_phage	88.1	0.0e+00
WP_078040551.1|313608_313722_-|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	97.3	4.1e-14
WP_157130340.1|313730_314066_-|tail	phage tail assembly protein	tail	E5E3U8	Burkholderia_phage	93.6	1.4e-49
WP_157130342.1|314147_314651_-|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	98.2	2.0e-92
WP_078040554.1|314672_315845_-|tail	phage tail sheath protein	tail	E5E3V0	Burkholderia_phage	97.9	3.1e-216
WP_078040555.1|315897_316521_-|tail	tail assembly chaperone	tail	E5E3V1	Burkholderia_phage	95.7	2.3e-114
WP_078040556.1|316538_319205_-|tail	phage tail protein	tail	E5E3V2	Burkholderia_phage	85.5	0.0e+00
WP_078040557.1|319208_319763_-|tail	phage tail protein I	tail	E5E3V3	Burkholderia_phage	98.4	6.5e-100
WP_078040558.1|319755_320661_-|plate	baseplate assembly protein	plate	E5E3V4	Burkholderia_phage	99.0	6.3e-161
WP_078040559.1|320657_321020_-|plate	baseplate assembly protein	plate	E5E3V5	Burkholderia_phage	98.3	3.3e-60
WP_078041088.1|321016_321703_-|plate	phage baseplate assembly protein V	plate	E5E3V6	Burkholderia_phage	94.7	2.2e-121
WP_078040560.1|321877_322654_+	site-specific DNA-methyltransferase	NA	E5E3V7	Burkholderia_phage	98.1	1.6e-144
WP_078040561.1|322633_323101_-	phage virion morphogenesis protein	NA	E5E3V8	Burkholderia_phage	96.8	1.0e-77
WP_078040562.1|323100_323517_-|tail	phage tail protein	tail	E5E3V9	Burkholderia_phage	92.8	3.5e-66
WP_078040563.1|323509_323677_-	peptidase	NA	E5E3W0	Burkholderia_phage	87.3	8.9e-21
WP_078040564.1|323630_324071_-	protein LYSB	NA	E5E3W1	Burkholderia_phage	93.2	8.3e-66
WP_078040565.1|324067_324877_-	DUF3380 domain-containing protein	NA	E5E3W2	Burkholderia_phage	96.7	2.2e-144
WP_016038212.1|324873_325146_-|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	100.0	2.0e-41
WP_059541842.1|325147_325492_-	hypothetical protein	NA	E5E3W4	Burkholderia_phage	99.1	2.2e-50
WP_078040566.1|325507_325714_-|tail	phage tail protein	tail	E5E3W5	Burkholderia_phage	91.2	5.4e-28
WP_157130270.1|325688_325949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078040567.1|325948_326428_-|head	head completion/stabilization protein	head	E5E3W6	Burkholderia_phage	96.2	2.4e-79
WP_078040568.1|326527_327217_-|terminase	terminase	terminase	E5E3W7	Burkholderia_phage	97.8	3.1e-107
WP_078040569.1|327213_328227_-|capsid	phage major capsid protein, P2 family	capsid	E5E3W8	Burkholderia_phage	98.5	6.1e-189
WP_078040570.1|328261_329053_-|capsid	GPO family capsid scaffolding protein	capsid	E5E3W9	Burkholderia_phage	94.1	2.1e-136
WP_078040571.1|329197_330967_+|terminase	terminase ATPase subunit family protein	terminase	E5E3X0	Burkholderia_phage	99.7	0.0e+00
WP_078040572.1|330963_332034_+|portal	phage portal protein	portal	E5E3X1	Burkholderia_phage	98.8	1.0e-202
WP_157130271.1|332620_332995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078040573.1|334019_334337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078040574.1|334381_335470_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	90.3	1.6e-190
WP_078040575.1|335475_336180_-	nuclease	NA	E5E3X9	Burkholderia_phage	95.8	8.5e-121
WP_078040576.1|336176_336686_-	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	92.9	2.0e-87
WP_157130272.1|336780_337704_-	hypothetical protein	NA	A0A1D8EX18	Mycobacterium_phage	42.5	2.4e-59
WP_078040578.1|337700_338750_-	site-specific DNA-methyltransferase	NA	A0A1D8EX39	Mycobacterium_phage	52.9	2.5e-100
339084:339129	attR	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAA	NA	NA	NA	NA
>prophage 2
NZ_CP017238	Burkholderia cenocepacia strain CR318 chromosome 1, complete sequence	3511146	517240	582230	3511146	protease,plate,transposase	uncultured_Mediterranean_phage(33.33%)	60	NA	NA
WP_006477151.1|517240_517954_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012327769.1|518242_522946_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_078040612.1|523031_524498_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_078040613.1|524852_526346_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_011546620.1|526342_526927_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011546619.1|527000_528302_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_011546618.1|528327_529590_-	MFS transporter	NA	NA	NA	NA	NA
WP_078040614.1|529718_530495_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011546616.1|530491_532261_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_078040615.1|532880_534017_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027809254.1|534049_534247_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_006477140.1|534285_535101_+	thiazole synthase	NA	NA	NA	NA	NA
WP_078040616.1|535097_536225_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_006477138.1|536309_537131_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	3.1e-21
WP_006486220.1|537127_537895_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_006477136.1|537919_538489_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_078041091.1|538520_539483_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_027809257.1|539594_540224_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011546610.1|540220_540496_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011694114.1|540688_541615_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	32.4	2.6e-21
WP_023476193.1|541671_542433_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006477131.1|542488_542728_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_006477130.1|542742_544092_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_006477129.1|544088_544742_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_006477128.1|544766_546083_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011546607.1|546226_547300_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011546606.1|547365_547953_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_006485349.1|548013_548634_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_011546605.1|548630_549272_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_006477123.1|549435_550191_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_006751800.1|550297_551071_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011546604.1|551070_551487_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_011546603.1|551483_551849_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_006477118.1|551919_552312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011546602.1|552343_552709_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_006477115.1|552802_553033_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006477114.1|553059_553599_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006477113.1|553640_554429_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.8	2.3e-26
WP_077178475.1|554634_555840_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.3	1.9e-11
WP_069232106.1|555861_556608_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_006491868.1|556826_557447_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012327783.1|557446_558829_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_006477108.1|558850_559609_+	cytochrome c1	NA	NA	NA	NA	NA
WP_006400565.1|559703_560315_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011546600.1|560386_560908_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	48.7	4.8e-20
WP_011546589.1|561324_561528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069232107.1|561633_562434_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_078040617.1|562790_565982_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	1.1e-55
WP_011546584.1|570699_571275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027809805.1|571810_572128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012327796.1|572215_572998_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_078040618.1|572994_574341_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_006477097.1|574443_575055_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011546581.1|575428_576064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006484395.1|576110_576626_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006477094.1|576641_578132_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006477093.1|578202_578706_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_047899649.1|578768_579254_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_069232114.1|579330_581166_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011694123.1|581129_582230_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NZ_CP017238	Burkholderia cenocepacia strain CR318 chromosome 1, complete sequence	3511146	903401	916516	3511146		Hokovirus(12.5%)	11	NA	NA
WP_006476838.1|903401_905354_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.8	1.6e-148
WP_006476837.1|905610_906747_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	5.0e-22
WP_078040675.1|906751_908674_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VNU7	Pandoravirus	37.5	4.7e-57
WP_006476834.1|908802_909618_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.7	6.7e-37
WP_011544643.1|909661_910348_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	29.5	1.2e-07
WP_078040676.1|910344_910887_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_012327944.1|910922_912479_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.8	1.2e-23
WP_006476830.1|912484_913162_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_011544645.1|913173_913959_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_054927386.1|914161_915217_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SEW4	Cyanophage	45.0	2.2e-72
WP_054927387.1|915316_916516_-	Tet(A)/Tet(B)/Tet(C) family tetracycline efflux MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	24.3	2.6e-05
>prophage 4
NZ_CP017238	Burkholderia cenocepacia strain CR318 chromosome 1, complete sequence	3511146	1312180	1323979	3511146	tail,holin	Burkholderia_virus(30.77%)	16	NA	NA
WP_157130293.1|1312180_1312783_-	hypothetical protein	NA	A0A291AUJ5	Sinorhizobium_phage	48.8	2.7e-11
WP_078040796.1|1312785_1313133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078040797.1|1315310_1315517_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	59.7	3.1e-15
WP_078040798.1|1315526_1316576_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	48.5	5.5e-84
WP_078040799.1|1316652_1316937_+|holin	holin	holin	C7BGD7	Burkholderia_phage	93.6	3.3e-39
WP_078040800.1|1316939_1317434_+	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	84.1	2.2e-75
WP_078040801.1|1317430_1317925_+	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	60.1	6.7e-40
WP_078040802.1|1318095_1318884_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	90.5	5.5e-145
WP_078040803.1|1318919_1319627_-	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	43.7	4.0e-38
WP_078040804.1|1319629_1320232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078040805.1|1320579_1321083_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	43.2	3.0e-19
WP_078040806.1|1321086_1321500_-	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	52.9	7.9e-18
WP_043887003.1|1321590_1322217_-	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	47.3	1.8e-45
WP_157130296.1|1322359_1322689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078040808.1|1322728_1323418_+	DUF159 family protein	NA	C7BGE4	Burkholderia_phage	53.0	2.2e-65
WP_078041111.1|1323541_1323979_-	DUF4326 domain-containing protein	NA	A0A1S6UAA8	Serratia_phage	48.4	2.4e-17
>prophage 5
NZ_CP017238	Burkholderia cenocepacia strain CR318 chromosome 1, complete sequence	3511146	2188745	2195055	3511146	tail,holin	uncultured_Caudovirales_phage(42.86%)	7	NA	NA
WP_078040952.1|2188745_2189240_-	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	58.9	1.5e-39
WP_078040953.1|2189236_2189731_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	86.0	2.6e-76
WP_034188712.1|2189733_2190018_-|holin	holin	holin	C7BGD7	Burkholderia_phage	93.6	5.6e-39
WP_078040954.1|2190094_2191144_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	46.9	2.3e-82
WP_078040955.1|2191153_2191360_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	3.1e-15
WP_078040956.1|2191334_2192213_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.5	1.2e-34
WP_078041127.1|2194752_2195055_-	hypothetical protein	NA	A0A1B2LRV6	Wolbachia_phage	39.0	1.3e-06
>prophage 6
NZ_CP017238	Burkholderia cenocepacia strain CR318 chromosome 1, complete sequence	3511146	2853781	2908278	3511146	integrase,tRNA,protease,transposase	Stx2-converting_phage(16.67%)	50	2845440:2845458	2879101:2879119
2845440:2845458	attL	AGCCGCGTGCGGCGAGCGC	NA	NA	NA	NA
WP_157062223.1|2853781_2854183_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012339754.1|2854179_2854521_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	66.7	1.2e-35
WP_012339753.1|2854572_2856123_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.1	4.0e-155
WP_157130321.1|2856260_2856656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078041036.1|2856734_2857823_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_157130348.1|2857819_2859532_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_078041135.1|2859786_2860788_+	DUF4917 family protein	NA	NA	NA	NA	NA
WP_078041038.1|2860925_2861213_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_078041039.1|2861221_2862565_-	DUF3396 domain-containing protein	NA	NA	NA	NA	NA
WP_078041136.1|2862603_2863869_-	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_078041040.1|2863894_2866747_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	3.4e-11
WP_078041041.1|2866942_2867341_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078041137.1|2867759_2868371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085962331.1|2868534_2869769_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	2.4e-102
WP_157130323.1|2869861_2870698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078041043.1|2870786_2871206_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_157130325.1|2872788_2873433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078041045.1|2873463_2874651_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011546000.1|2874944_2875133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011546001.1|2875115_2876153_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
WP_006478058.1|2876260_2877292_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_011546002.1|2877584_2878769_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.3	6.2e-23
WP_011546003.1|2878782_2879238_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
2879101:2879119	attR	GCGCTCGCCGCACGCGGCT	NA	NA	NA	NA
WP_006478055.1|2879263_2879935_-	YukJ family protein	NA	NA	NA	NA	NA
WP_006478054.1|2880158_2880875_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	8.0e-10
WP_006478053.1|2880874_2881651_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_006478052.1|2881674_2882844_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_006478051.1|2882863_2883814_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_011546005.1|2884025_2884679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006488968.1|2884949_2885930_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_006488950.1|2885932_2886388_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011546007.1|2886523_2887297_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004186391.1|2887534_2887768_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_006478046.1|2887785_2887953_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_011546008.1|2888129_2889716_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_011546009.1|2889813_2890695_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_006478043.1|2890691_2891828_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_006478042.1|2892138_2893335_-	aminotransferase	NA	NA	NA	NA	NA
WP_011694366.1|2893550_2894936_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011546011.1|2894954_2896220_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_011546012.1|2896216_2896879_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	38.9	9.7e-26
WP_011546013.1|2897001_2897994_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_011546014.1|2898097_2900935_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.3	3.3e-83
WP_006478035.1|2900937_2901438_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011694367.1|2901506_2902718_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.4	4.6e-42
WP_011546016.1|2902771_2903218_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	63.7	3.5e-48
WP_011546017.1|2903276_2904047_-	membrane protein	NA	NA	NA	NA	NA
WP_041489239.1|2904183_2905563_-	amino acid permease	NA	NA	NA	NA	NA
WP_011694369.1|2905666_2907967_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	40.4	2.5e-161
WP_006398529.1|2907963_2908278_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
>prophage 1
NZ_CP017239	Burkholderia cenocepacia strain CR318 chromosome 2, complete sequence	3097552	2882673	2933237	3097552	tail,integrase,transposase,holin	Bacillus_virus(20.0%)	46	2886204:2886220	2921649:2921665
WP_078041798.1|2882673_2885013_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_006480304.1|2885289_2885559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011548893.1|2885713_2886706_+	membrane protein	NA	NA	NA	NA	NA
2886204:2886220	attL	ACTGGCTGTTCGCCGGC	NA	NA	NA	NA
WP_069231775.1|2886760_2888233_-	OprD family porin	NA	NA	NA	NA	NA
WP_143275938.1|2888400_2889516_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.4	2.4e-16
WP_077178593.1|2889416_2890409_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	2.1e-16
WP_006480300.1|2890410_2891313_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006480299.1|2891326_2892265_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_077178592.1|2892276_2893890_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011548888.1|2894069_2894648_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_027805944.1|2895145_2896666_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.7	2.8e-44
WP_011694889.1|2896786_2896993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077178623.1|2897074_2898199_-	OpgC domain-containing protein	NA	NA	NA	NA	NA
WP_077178591.1|2898618_2899518_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_077178590.1|2899536_2899833_-	acylphosphatase	NA	NA	NA	NA	NA
WP_011353724.1|2899985_2900993_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_077178589.1|2901101_2902505_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_077178588.1|2902621_2903809_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011548881.1|2904211_2905153_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011548880.1|2905165_2906326_+	adenosyl-hopene transferase HpnH	NA	NA	NA	NA	NA
WP_006485063.1|2906482_2906743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011548879.1|2906908_2907388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077178586.1|2907477_2908530_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1C9LZZ3	Mycobacterium_phage	39.4	9.3e-31
WP_077178585.1|2908770_2909148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006480283.1|2909636_2909990_+	DOPA 4,5-dioxygenase family protein	NA	NA	NA	NA	NA
WP_077178584.1|2910108_2910549_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_157130398.1|2911661_2912895_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	2.4e-102
WP_006480281.1|2913350_2913971_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_006480280.1|2914178_2914385_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_012339209.1|2914397_2916476_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_078041800.1|2916975_2917263_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_078041801.1|2917790_2918477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078041802.1|2918615_2918861_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157130399.1|2919454_2921158_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_006413567.1|2922960_2923167_-	CsbD family protein	NA	NA	NA	NA	NA
2921649:2921665	attR	GCCGGCGAACAGCCAGT	NA	NA	NA	NA
WP_048995399.1|2923345_2923771_-	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_006413535.1|2925005_2925179_-	CsbD family protein	NA	NA	NA	NA	NA
WP_006413551.1|2925320_2925791_-	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_006413603.1|2927783_2928053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078041804.1|2928158_2928377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130401.1|2928970_2929546_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_078041807.1|2930053_2930863_+	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_078041808.1|2930950_2931205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130403.1|2931397_2931535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078041809.1|2931649_2932237_+	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
WP_157130405.1|2932420_2933237_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP017240	Burkholderia cenocepacia strain CR318 chromosome 3, complete sequence	1056196	570307	576672	1056196		Escherichia_phage(42.86%)	7	NA	NA
WP_011549809.1|570307_571093_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.5	2.7e-11
WP_011549810.1|571089_571809_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.4	2.8e-18
WP_011695034.1|571805_573203_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.5	8.3e-27
WP_011695035.1|573303_574200_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.8	1.7e-97
WP_011695036.1|574196_574778_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.5	2.4e-49
WP_011549811.1|574774_575659_+	dTDP-4-dehydrorhamnose reductase	NA	K7QJU0	Escherichia_phage	33.6	1.1e-27
WP_011695037.1|575655_576672_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	45.2	1.0e-79
