The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014687	Acetobacter persici strain TMW2.1084 chromosome, complete genome	3230507	226117	285324	3230507	tRNA,protease,transposase,integrase	Bacillus_phage(14.29%)	53	217554:217569	271295:271310
217554:217569	attL	TCAGGGTGCCGGAAAT	NA	NA	NA	NA
WP_099050323.1|226117_227184_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_077929790.1|227282_227771_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_157762925.1|228003_228384_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_077929791.1|228447_229461_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_077929792.1|233029_233728_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_077929793.1|233732_235106_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	22.9	8.2e-11
WP_077929794.1|235429_237028_-	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_099050324.1|237672_239024_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077929795.1|239633_239918_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_157762926.1|240043_240223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077929797.1|240374_241526_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	33.3	2.3e-46
WP_157762927.1|241702_243367_-	recombinase family protein	NA	R9TP69	Rhizobium_phage	35.4	7.7e-88
WP_077929798.1|243762_245145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077929799.1|247032_247797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077931587.1|247941_248175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157762928.1|249172_249340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077929801.1|249381_249930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077929802.1|249942_250455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077929803.1|250518_250917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077929804.1|251057_251357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167552524.1|251370_251541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077929805.1|251779_252451_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_077929806.1|252608_252854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077929807.1|253638_254361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157762929.1|254357_254963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157762930.1|256664_257063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167552525.1|257029_257869_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_077929809.1|257865_258300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077929810.1|258664_259657_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_077929811.1|259687_260821_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_167552519.1|260934_261075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077929813.1|262388_264311_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.0e-115
WP_077929814.1|264307_264814_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_077929815.1|264810_265518_-	DUF1826 domain-containing protein	NA	NA	NA	NA	NA
WP_077929816.1|265601_266213_+	GTP cyclohydrolase I FolE	NA	A0A088F7Y4	Vibrio_phage	46.2	1.4e-42
WP_077929817.1|266209_266719_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_077929818.1|266732_267962_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_077929819.1|270868_271252_-	VOC family protein	NA	NA	NA	NA	NA
WP_077929820.1|271397_272486_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
271295:271310	attR	ATTTCCGGCACCCTGA	NA	NA	NA	NA
WP_077929821.1|272499_272982_-	DUF2938 family protein	NA	NA	NA	NA	NA
WP_077929822.1|273000_273687_-	cupin	NA	NA	NA	NA	NA
WP_077929823.1|273690_274437_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.2	6.2e-13
WP_077931588.1|274592_275528_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077931589.1|275689_276058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077929824.1|276174_276633_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077929825.1|278171_279077_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077929826.1|279172_280000_+	oxidoreductase	NA	NA	NA	NA	NA
WP_077929827.1|280273_281173_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077929828.1|281274_282036_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_140329621.1|282188_282959_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077929829.1|283044_283827_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077929830.1|283933_284551_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_099050325.1|284569_285324_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.5	3.9e-23
>prophage 2
NZ_CP014687	Acetobacter persici strain TMW2.1084 chromosome, complete genome	3230507	1717378	1743947	3230507	integrase,tail,capsid,terminase,tRNA,portal	Rhodobacter_phage(20.0%)	34	1710213:1710228	1729796:1729811
1710213:1710228	attL	GAGCCAGCACCTGTGC	NA	NA	NA	NA
WP_077931736.1|1717378_1720039_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	37.2	3.1e-147
WP_077930657.1|1720038_1720737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930658.1|1720764_1721778_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_077930659.1|1722326_1723532_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	49.3	9.1e-107
WP_077930660.1|1723511_1723736_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_077930661.1|1723732_1724146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077930663.1|1724471_1724693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077930664.1|1724689_1725034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077930665.1|1725036_1725216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077930666.1|1725264_1725498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077930667.1|1725516_1726011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157762971.1|1726145_1726964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157762972.1|1726968_1727748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077930670.1|1727758_1727974_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077930671.1|1727970_1728651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930672.1|1728650_1729127_+	hypothetical protein	NA	A0A0A8IL22	Aurantimonas_phage	41.4	2.2e-11
WP_157762973.1|1729126_1729300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930673.1|1729296_1729749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930674.1|1729735_1730317_+	hypothetical protein	NA	A0A060AGD9	Listeria_phage	32.5	4.1e-20
1729796:1729811	attR	GAGCCAGCACCTGTGC	NA	NA	NA	NA
WP_077930675.1|1730309_1731341_+	hypothetical protein	NA	A0A0U4B0G9	Pseudomonas_phage	34.8	1.1e-12
WP_157762974.1|1731321_1731489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099050345.1|1732169_1733216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930676.1|1733463_1733922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930677.1|1734038_1734359_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_077930678.1|1734578_1735052_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	36.8	6.2e-19
WP_077930679.1|1735059_1736784_+|terminase	terminase large subunit	terminase	A0A141GEV8	Brucella_phage	50.4	7.0e-161
WP_077930680.1|1736786_1738064_+|portal	phage portal protein	portal	I3ULZ7	Rhodobacter_phage	49.8	1.1e-107
WP_077930681.1|1738066_1739023_+	S49 family peptidase	NA	I3ULZ8	Rhodobacter_phage	46.3	2.9e-63
WP_077930682.1|1739024_1740362_+|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	36.6	3.4e-62
WP_077930683.1|1740366_1740618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157762975.1|1740657_1741335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930685.1|1741334_1741682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930686.1|1741656_1742118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930687.1|1742702_1743947_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 3
NZ_CP014687	Acetobacter persici strain TMW2.1084 chromosome, complete genome	3230507	2201402	2274547	3230507	transposase,integrase	uncultured_Mediterranean_phage(20.0%)	50	2235656:2235698	2274695:2274737
WP_099050358.1|2201402_2202156_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.5	1.3e-23
WP_157762990.1|2202166_2203099_-	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	26.7	1.3e-20
WP_077930932.1|2203095_2204592_-	amino acid permease	NA	NA	NA	NA	NA
WP_077930933.1|2204610_2206932_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_157762991.1|2206991_2208944_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_077930936.1|2210824_2211442_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_099050359.1|2211491_2211686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077930937.1|2211805_2212384_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077930938.1|2212456_2213731_+	MFS transporter	NA	NA	NA	NA	NA
WP_077930939.1|2214182_2214884_-	pirin family protein	NA	NA	NA	NA	NA
WP_077930940.1|2215080_2216001_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077931768.1|2216129_2216726_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_077930941.1|2216859_2217303_-	DoxX family protein	NA	NA	NA	NA	NA
WP_077930942.1|2218354_2219221_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_077930943.1|2219450_2220830_+	cyclic nucleotide-binding protein	NA	A0A2K9L2D2	Tupanvirus	33.6	8.4e-32
WP_077931769.1|2220813_2222403_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.2	5.1e-89
WP_077930944.1|2222404_2222824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930945.1|2222820_2223246_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_077930946.1|2223317_2224178_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_157762992.1|2224365_2224548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077930948.1|2224735_2225035_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	51.6	7.4e-18
WP_099050360.1|2225906_2226663_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099050361.1|2227664_2228945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930951.1|2229032_2230262_-	MFS transporter	NA	NA	NA	NA	NA
WP_077930952.1|2230258_2230696_-	DOPA 4,5-dioxygenase family protein	NA	NA	NA	NA	NA
WP_157762993.1|2231023_2233645_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	39.5	5.5e-16
WP_077930954.1|2233675_2234416_+	DOPA 4,5-dioxygenase family protein	NA	NA	NA	NA	NA
WP_099050358.1|2234612_2235367_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.5	1.3e-23
2235656:2235698	attL	GTCCCGTACGGGATTCGAACCCGTGTTGCCGCCGTGAAAGGGC	NA	NA	NA	NA
WP_077931770.1|2235988_2236231_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_077930955.1|2236227_2236653_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_077930956.1|2236727_2241893_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.6	2.0e-49
WP_077930957.1|2241897_2244678_+	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	26.0	5.3e-33
WP_077930958.1|2244681_2249499_+	N-6 DNA methylase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	26.9	3.5e-40
WP_157762994.1|2249566_2251453_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_077930960.1|2251459_2252212_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_077930961.1|2253989_2256461_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.8	1.5e-87
WP_039906194.1|2256463_2257783_-	chloride channel protein	NA	NA	NA	NA	NA
WP_061487487.1|2257866_2260965_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.1e-60
WP_148262860.1|2260961_2262143_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_077930962.1|2262139_2263381_-	TolC family protein	NA	NA	NA	NA	NA
WP_077930964.1|2264878_2266141_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	38.5	7.7e-32
WP_077930965.1|2266272_2266509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077930966.1|2266644_2268168_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_061487217.1|2268157_2268943_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.7	2.7e-35
WP_077930967.1|2269050_2270664_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_077930968.1|2270801_2271548_+	SWF/SNF helicase family protein	NA	NA	NA	NA	NA
WP_077930969.1|2271809_2272028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930970.1|2272114_2272750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930971.1|2273087_2273429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077930972.1|2273437_2274547_-|integrase	site-specific integrase	integrase	A0A1S6L1B6	Ralstonia_phage	27.5	1.5e-26
2274695:2274737	attR	GTCCCGTACGGGATTCGAACCCGTGTTGCCGCCGTGAAAGGGC	NA	NA	NA	NA
>prophage 4
NZ_CP014687	Acetobacter persici strain TMW2.1084 chromosome, complete genome	3230507	2495256	2503442	3230507	plate	Myoviridae_environmental_samples(42.86%)	8	NA	NA
WP_077931801.1|2495256_2495574_+	hypothetical protein	NA	A0A2R3UAZ3	Myoviridae_environmental_samples	34.0	3.1e-06
WP_077931115.1|2495607_2496558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077931116.1|2496583_2497312_+|plate	baseplate assembly protein	plate	A0A2R3UAK1	Myoviridae_environmental_samples	44.0	2.2e-31
WP_099050425.1|2497658_2499782_-	catalase	NA	A0A2K9L0T1	Tupanvirus	50.3	1.7e-140
WP_077931118.1|2500143_2500497_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	38.4	5.9e-14
WP_077931119.1|2500468_2501743_+	hypothetical protein	NA	A0A2R3UAL9	Myoviridae_environmental_samples	40.5	2.7e-61
WP_077931120.1|2501742_2502318_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	41.7	2.8e-29
WP_077931121.1|2502314_2503442_+	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	42.1	2.5e-18
