The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014692	Acetobacter aceti strain TMW2.1153 chromosome, complete genome	3725037	759581	838586	3725037	plate,terminase,protease,head,tRNA,portal,tail,integrase,capsid	Sinorhizobium_phage(10.0%)	88	754156:754170	795645:795659
754156:754170	attL	ATCACATCCTGAAAA	NA	NA	NA	NA
WP_149026367.1|759581_761111_-|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_187668854.1|761356_762205_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	25.5	2.0e-07
WP_077812005.1|762273_762585_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077812006.1|762699_763455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187668855.1|763420_763603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812007.1|764222_764555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812008.1|764554_764935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187668856.1|765439_765580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812011.1|765576_766002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812012.1|765998_766454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812014.1|766795_767032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812015.1|767028_767310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812016.1|767321_767543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812017.1|767539_767827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149026369.1|767823_768138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812019.1|768134_768554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812020.1|768550_768814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812021.1|768810_769017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149026370.1|769108_769753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812023.1|769810_770158_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077812024.1|770251_770461_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149026371.1|770536_770809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812025.1|770908_771091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187668985.1|771087_771885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812027.1|771805_772183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187668857.1|772179_772356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812028.1|772352_772532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812029.1|772533_772734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812030.1|772726_773146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812031.1|773147_773723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812032.1|773719_775435_+|terminase	phage terminase large subunit family protein	terminase	M4QRH8	Loktanella_phage	39.5	1.3e-34
WP_077812033.1|775445_776201_+	hypothetical protein	NA	A0A291AUL1	Sinorhizobium_phage	33.8	2.3e-23
WP_077814228.1|776218_776482_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_149026525.1|776601_778164_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	33.9	1.9e-80
WP_077812035.1|778160_778973_+	S49 family peptidase	NA	G8DCP1	Silicibacter_phage	48.5	1.3e-43
WP_077814229.1|778996_779572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812036.1|779571_779979_+|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	40.4	4.4e-05
WP_149026526.1|780008_781097_+|capsid	major capsid protein	capsid	A0A2D1GMR5	Marinobacter_phage	34.8	6.9e-45
WP_149026372.1|781105_781411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812039.1|781407_781791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812040.1|781762_782278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812041.1|782292_782484_+	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	48.8	6.0e-05
WP_077812042.1|782480_784064_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	32.2	1.0e-52
WP_077812043.1|784073_784457_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_077812044.1|784453_785131_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_077812045.1|785285_787352_+	hypothetical protein	NA	A0A1D8KS53	Synechococcus_phage	31.2	3.5e-13
WP_077812046.1|787359_788658_+	DNA circularization N-terminal domain-containing protein	NA	B5TK71	Pseudomonas_phage	24.5	1.8e-07
WP_077812047.1|788654_789794_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_077812048.1|789800_790313_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_077812049.1|790320_790818_+	phage GP46 family protein	NA	NA	NA	NA	NA
WP_077814230.1|790817_791930_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	25.0	1.9e-10
WP_077812050.1|791926_792520_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	34.2	6.6e-26
WP_187668858.1|792523_793414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812051.1|793410_793596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812052.1|793641_793899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812053.1|793895_794393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149026373.1|794533_794932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812055.1|794949_798327_+	hypothetical protein	NA	NA	NA	NA	NA
795645:795659	attR	TTTTCAGGATGTGAT	NA	NA	NA	NA
WP_077812056.1|798402_798726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812057.1|798814_799363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812058.1|799454_800495_+	glycosyltransferase	NA	B2ZY71	Ralstonia_phage	45.3	3.1e-71
WP_077812059.1|800491_801256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187668859.1|803179_803869_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	37.9	6.1e-31
WP_077812060.1|803971_804985_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_077812061.1|805133_806294_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	25.9	2.3e-06
WP_077812062.1|806305_807112_-	NAD kinase	NA	NA	NA	NA	NA
WP_077812063.1|807467_809135_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_077812064.1|809138_810146_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_077812065.1|810142_810853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812066.1|810845_811169_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_077812067.1|811181_812507_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_149026527.1|812584_814657_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_077812069.1|814675_815635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077812070.1|815720_816317_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_077812071.1|816383_817829_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_077814232.1|817838_818576_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.9	4.5e-24
WP_077812072.1|818643_819750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812073.1|819750_820515_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_187668860.1|820514_821612_-	KpsF/GutQ family sugar-phosphate isomerase	NA	E5E465	Acinetobacter_phage	31.1	1.7e-19
WP_077812074.1|821634_822291_-	ribonuclease D	NA	K7XYU9	uncultured_Mediterranean_phage	35.9	2.4e-13
WP_077812075.1|822326_823763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077812076.1|824384_825341_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_077812077.1|825597_827031_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077812078.1|827030_831605_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_077814234.1|832447_834520_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_077812079.1|834612_836508_-	superinfection immunity protein	NA	NA	NA	NA	NA
WP_077812080.1|836856_837675_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_077812081.1|837671_838586_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	33.9	3.5e-10
>prophage 2
NZ_CP014692	Acetobacter aceti strain TMW2.1153 chromosome, complete genome	3725037	3154204	3217720	3725037	transposase,holin,integrase	Enterobacteria_phage(23.08%)	60	3172177:3172222	3219983:3220028
WP_077813783.1|3154204_3156571_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_077813784.1|3157330_3157744_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	33.0	1.4e-06
WP_077813785.1|3157777_3158596_-	universal stress protein	NA	NA	NA	NA	NA
WP_077813786.1|3159829_3160879_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_077813787.1|3161183_3162479_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_077813788.1|3162660_3163221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077813789.1|3163238_3164216_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_077813790.1|3164380_3165376_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077813791.1|3165406_3166312_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_077813792.1|3166308_3166869_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	44.4	1.6e-37
WP_187668965.1|3166982_3167861_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	55.2	2.9e-86
WP_077813794.1|3167912_3168971_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.5	1.4e-95
WP_077813795.1|3169150_3171328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077813796.1|3171324_3172026_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
3172177:3172222	attL	TTGCCAAGGTTGGGGTCGTGGGTTCGAATCCCATCGCCCGCTCCAG	NA	NA	NA	NA
WP_010516374.1|3172462_3173095_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_010516376.1|3173091_3173661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010516378.1|3173875_3174802_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010516380.1|3174764_3175025_-	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_010516382.1|3175021_3176224_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_077813797.1|3176220_3177222_-	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_010516386.1|3177218_3177902_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_077813798.1|3177901_3179326_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_010516389.1|3179329_3180064_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_010518332.1|3181886_3182150_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_018308128.1|3182280_3182565_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010518334.1|3182745_3182898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018308129.1|3183238_3183565_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_010517748.1|3183563_3183794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010517753.1|3184161_3184602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010668868.1|3184718_3184871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010517758.1|3184869_3185256_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_010517760.1|3185239_3185563_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010517762.1|3185593_3186523_-	DUF2493 domain-containing protein	NA	A0A291L9X7	Bordetella_phage	36.7	2.2e-15
WP_077813800.1|3186843_3187629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010517766.1|3187615_3188056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029604267.1|3188139_3189342_-	hypothetical protein	NA	A0A1V0DX75	Synechococcus_virus	42.2	1.3e-73
WP_077813801.1|3189641_3190553_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	27.4	4.0e-22
WP_077813802.1|3190572_3191763_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003618791.1|3192253_3192652_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010516881.1|3192725_3193376_+	cation transporter	NA	NA	NA	NA	NA
WP_019088956.1|3193368_3194811_+	TolC family protein	NA	NA	NA	NA	NA
WP_011251445.1|3194807_3195842_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_062247650.1|3195841_3198976_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.1	2.7e-62
WP_010516885.1|3199002_3199200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029604276.1|3199503_3200226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010517432.1|3200323_3202381_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_085948219.1|3203218_3203972_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_077813803.1|3204243_3205026_-	cytochrome c family protein	NA	NA	NA	NA	NA
WP_077814491.1|3205022_3205751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187668780.1|3205750_3207886_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	I3ULH6	Synechococcus_phage	38.2	9.4e-06
WP_029604279.1|3208020_3208584_-	cytochrome c	NA	NA	NA	NA	NA
WP_062497143.1|3208649_3209042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062497145.1|3209122_3209929_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_062497147.1|3209925_3211758_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_029604282.1|3211834_3212209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007284529.1|3212244_3212517_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_077813805.1|3212560_3214987_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.0	7.3e-87
WP_010515588.1|3215280_3215721_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010515587.1|3215717_3216065_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	60.7	1.6e-32
WP_077813806.1|3216130_3217720_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.3	7.3e-104
3219983:3220028	attR	TTGCCAAGGTTGGGGTCGTGGGTTCGAATCCCATCGCCCGCTCCAG	NA	NA	NA	NA
