The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019724	Streptomyces pactum strain ACT12 chromosome, complete genome	8550793	4749545	4797944	8550793	tRNA,plate,tail,transposase	Bacillus_phage(42.86%)	39	NA	NA
WP_055417183.1|4749545_4750613_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_055417586.1|4750641_4751466_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_055417819.1|4751515_4751953_+	DUF2000 domain-containing protein	NA	NA	NA	NA	NA
WP_055417584.1|4753465_4754227_+	phosphoglyceromutase	NA	NA	NA	NA	NA
WP_055417581.1|4757118_4757664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055417580.1|4757942_4758380_-	ATP-binding protein	NA	A0A1V0E640	Streptomyces_phage	35.3	3.3e-06
WP_055417579.1|4758711_4759470_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_055417578.1|4759673_4760276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055417577.1|4760528_4764023_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_055417576.1|4764029_4764734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055417818.1|4764901_4765621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055417575.1|4765964_4766324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167392549.1|4766555_4766708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055417574.1|4766842_4767532_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_055417573.1|4767754_4769026_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.5	1.9e-30
WP_043381903.1|4769022_4769703_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.0	4.9e-41
WP_055417572.1|4769849_4770605_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_079160339.1|4771050_4771311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003953493.1|4771272_4771755_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_055417571.1|4772039_4772816_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_055417570.1|4772805_4773309_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_055417569.1|4773851_4775252_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	29.1	5.0e-40
WP_055417568.1|4775372_4776314_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_055417567.1|4776588_4778295_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_055417566.1|4778383_4779121_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_055417817.1|4779163_4779619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055417565.1|4779871_4781008_-	diacetylchitobiose ABC transporter ATP-binding protein MsiK	NA	Q6GZ03	Mycoplasma_phage	48.3	2.3e-19
WP_055417564.1|4781366_4783013_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_055417816.1|4784892_4785402_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_055417563.1|4785461_4787420_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_055417562.1|4787419_4787869_-	GPW/gp25 family protein	NA	D6PHT9	uncultured_phage	28.9	3.9e-10
WP_055417561.1|4787936_4789850_-	VgrG-related protein	NA	NA	NA	NA	NA
WP_055417560.1|4789849_4790572_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_055417559.1|4790600_4791023_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_055417815.1|4791194_4792289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167392550.1|4795160_4795319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055417558.1|4795315_4795819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053133134.1|4795818_4796265_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_055417557.1|4796342_4797944_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	33.0	1.3e-63
>prophage 2
NZ_CP019724	Streptomyces pactum strain ACT12 chromosome, complete genome	8550793	5682700	5718886	8550793	tRNA,integrase,transposase,protease	Agrobacterium_phage(28.57%)	32	5684051:5684094	5694062:5694105
WP_079160429.1|5682700_5683924_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
5684051:5684094	attL	GGAGCGGGCGACGGGAATCGAACCCGCGTAGCTAGTTTGGAAGA	NA	NA	NA	NA
WP_055416923.1|5685492_5686053_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_055416922.1|5686040_5686511_-	NUDIX domain-containing protein	NA	A0A1V0DXM9	Yersinia_phage	42.3	7.9e-06
WP_055416921.1|5686558_5687290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055416920.1|5687443_5687800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055416919.1|5687803_5689159_+	plasmid transfer protein	NA	NA	NA	NA	NA
WP_055416918.1|5689179_5689377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055416917.1|5689394_5690078_+	DUF2637 domain-containing protein	NA	NA	NA	NA	NA
WP_055416916.1|5690093_5690285_+	Mobile element transfer	NA	NA	NA	NA	NA
WP_007387680.1|5690294_5690450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055416915.1|5690470_5690800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055417728.1|5690891_5691071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055416914.1|5691067_5691247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055416913.1|5691243_5692638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055416912.1|5692630_5692846_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_055416911.1|5692845_5693994_+|integrase	site-specific integrase	integrase	A0A249XVB5	Mycobacterium_phage	35.5	3.0e-51
WP_055416910.1|5694694_5696107_+	trigger factor	NA	NA	NA	NA	NA
5694062:5694105	attR	GGAGCGGGCGACGGGAATCGAACCCGCGTAGCTAGTTTGGAAGA	NA	NA	NA	NA
WP_055416909.1|5696556_5697162_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	50.3	3.9e-42
WP_055416908.1|5697286_5697967_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	47.9	8.4e-41
WP_055416907.1|5698148_5699435_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.6	2.6e-144
WP_055416906.1|5699510_5700512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055416905.1|5700649_5703274_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	40.3	5.2e-147
WP_055416904.1|5703470_5704994_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_055416903.1|5705000_5705357_+	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_055416902.1|5705566_5705980_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	47.7	3.2e-27
WP_030381728.1|5706299_5707319_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_055416901.1|5707502_5708504_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_055416900.1|5708517_5709189_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_055416899.1|5709296_5711594_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_055416898.1|5711590_5712790_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_055416897.1|5712893_5714843_+	TIGR03960 family B12-binding radical SAM protein	NA	NA	NA	NA	NA
WP_159027849.1|5716723_5718886_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP019724	Streptomyces pactum strain ACT12 chromosome, complete genome	8550793	7292889	7304363	8550793	terminase,capsid,portal	Streptomyces_phage(88.89%)	12	NA	NA
WP_055420691.1|7292889_7293240_-	hypothetical protein	NA	K4HYD6	Streptomyces_phage	59.3	1.9e-28
WP_055420690.1|7293250_7293571_-	hypothetical protein	NA	K4I2V6	Streptomyces_phage	42.3	4.1e-14
WP_107095365.1|7293564_7293978_-	hypothetical protein	NA	A0A1J0MC98	Streptomyces_phage	50.4	4.6e-18
WP_055420688.1|7294238_7296695_-	hypothetical protein	NA	A0A097EYK8	Mycobacterium_phage	30.6	3.2e-05
WP_055420687.1|7296716_7297175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055420686.1|7298017_7298398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055420685.1|7298394_7299345_-	hypothetical protein	NA	A0A2H5BLD0	Streptomyces_phage	30.7	2.6e-24
WP_055420684.1|7299370_7300156_-	hypothetical protein	NA	A0A1J0MD42	Streptomyces_phage	49.0	2.1e-19
WP_055420683.1|7300255_7301371_-|capsid	capsid protein	capsid	A0A1J0MC53	Streptomyces_phage	49.7	5.7e-87
WP_055420682.1|7301387_7302905_-|portal	phage portal protein	portal	A0A1J0MCN7	Streptomyces_phage	42.1	7.2e-101
WP_055420681.1|7302885_7303092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055420680.1|7303091_7304363_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E630	Streptomyces_phage	66.0	8.9e-153
>prophage 4
NZ_CP019724	Streptomyces pactum strain ACT12 chromosome, complete genome	8550793	7317907	7327640	8550793		Streptomyces_phage(22.22%)	16	NA	NA
WP_055420657.1|7317907_7319497_-	AAA family ATPase	NA	V5R9D2	Arthrobacter_phage	32.1	1.4e-30
WP_055420656.1|7319510_7319822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055420655.1|7319821_7320190_-	hypothetical protein	NA	Q1WDI1	Streptomyces_phage	63.2	7.7e-33
WP_055420654.1|7320222_7320510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055420653.1|7320506_7320767_-	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	36.6	4.8e-05
WP_055420927.1|7320763_7322461_-	DNA cytosine methyltransferase	NA	A0A1B3AZA3	Gordonia_phage	31.0	1.4e-39
WP_055420652.1|7322457_7323096_-	hypothetical protein	NA	Q1WDI4	Streptomyces_phage	49.7	1.2e-36
WP_055420651.1|7323098_7323371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055420650.1|7323367_7323790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063787532.1|7323789_7324539_-	DNA polymerase III subunit epsilon	NA	A0A0R8VDA1	Thermobifida_phage	39.6	2.9e-34
WP_055420925.1|7324535_7325159_-	hypothetical protein	NA	A0A1B0XTM7	Freshwater_phage	36.4	5.7e-12
WP_055420649.1|7325311_7326361_-	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	33.6	7.1e-23
WP_055420648.1|7326357_7326600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159027858.1|7326592_7327006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055420924.1|7327002_7327386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055420646.1|7327385_7327640_-	hypothetical protein	NA	A0A1B3B003	Gordonia_phage	45.3	6.1e-05
