The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016087	Clostridium saccharoperbutylacetonicum strain N1-504 chromosome, complete genome	6216458	548048	584314	6216458	protease,tRNA,transposase,coat	Moraxella_phage(16.67%)	29	NA	NA
WP_015390644.1|548048_549068_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.3	1.9e-65
WP_077360186.1|549074_550076_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077360188.1|550265_551483_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.7	5.2e-17
WP_077360190.1|551911_552223_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_077360192.1|552231_553368_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077360194.1|553618_554740_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_077360196.1|554867_555884_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_026106453.1|555858_556644_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_077360198.1|556791_557826_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_077360200.1|557933_559154_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	1.8e-46
WP_077360202.1|559348_560899_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.5	4.2e-48
WP_015390654.1|561044_561320_-	Mor transcription activator family	NA	NA	NA	NA	NA
WP_077360204.1|561666_562401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077360206.1|563231_564893_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077360208.1|565276_566695_+	flagellar protein	NA	NA	NA	NA	NA
WP_015390658.1|566994_568794_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	22.9	4.2e-07
WP_015390659.1|568861_570667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015390660.1|570947_571916_+	esterase family protein	NA	NA	NA	NA	NA
WP_077360210.1|572437_573151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077360212.1|573506_574349_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_077360214.1|574465_574993_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077360216.1|575242_576904_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	54.4	2.5e-171
WP_077360218.1|577327_578338_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_077360220.1|578796_579579_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_077360222.1|579572_580820_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_156875886.1|580932_581052_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_015390670.1|581011_581614_-	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_077360224.1|582085_583207_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015390672.1|583315_584314_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
>prophage 2
NZ_CP016087	Clostridium saccharoperbutylacetonicum strain N1-504 chromosome, complete genome	6216458	666658	674913	6216458	integrase	Streptococcus_phage(33.33%)	9	670533:670555	679420:679442
WP_077360309.1|666658_668887_+	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	30.7	1.1e-73
WP_077360312.1|668907_669924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015390757.1|669896_670553_+	ComF family protein	NA	NA	NA	NA	NA
670533:670555	attL	TTAGCTAAAAGTCATATATAATA	NA	NA	NA	NA
WP_077360314.1|670613_671702_-|integrase	site-specific integrase	integrase	B3GVW7	Streptococcus_phage	29.2	6.7e-24
WP_156875887.1|671785_672244_-	hypothetical protein	NA	A0A0A7RTX7	Clostridium_phage	46.3	3.4e-30
WP_077360318.1|672258_672753_-	helix-turn-helix transcriptional regulator	NA	Q8SBN0	Clostridium_phage	50.7	2.4e-29
WP_077360320.1|672946_673162_+	hypothetical protein	NA	A1EAC0	Streptococcus_phage	37.1	3.0e-05
WP_077360322.1|673182_673470_+	transcription factor	NA	NA	NA	NA	NA
WP_077360324.1|673908_674913_+	replication protein	NA	M1R6K1	Gastropod_associated_circular_ssDNA_virus	34.8	1.4e-36
679420:679442	attR	TTAGCTAAAAGTCATATATAATA	NA	NA	NA	NA
>prophage 3
NZ_CP016087	Clostridium saccharoperbutylacetonicum strain N1-504 chromosome, complete genome	6216458	794947	859775	6216458	plate,transposase,tail,terminase,tRNA	Clostridium_phage(80.65%)	60	NA	NA
WP_015390829.1|794947_795667_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_015390830.1|795670_796126_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_077360496.1|796399_797311_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_077360498.1|797950_799381_+	ethanolamine utilization protein EutA	NA	NA	NA	NA	NA
WP_077360500.1|799639_800968_+	ethanolamine permease	NA	NA	NA	NA	NA
WP_077360502.1|801085_802453_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_077360504.1|802535_803306_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_077360506.1|803659_804034_+	RidA family protein	NA	NA	NA	NA	NA
WP_015390837.1|804165_805233_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_077360508.1|806239_806698_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_077360510.1|806804_807299_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077360512.1|813792_815616_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_077360514.1|816134_816797_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_077360516.1|816777_817131_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077360518.1|817457_817664_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015390851.1|817855_818038_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_077360520.1|818086_818440_+	hypothetical protein	NA	A0A0A7RTL9	Clostridium_phage	55.3	1.1e-25
WP_077360522.1|818490_818904_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077360524.1|819316_819799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077360526.1|820012_820372_+	AP endonuclease	NA	A0A0A8WHT7	Clostridium_phage	43.7	1.4e-18
WP_077360528.1|820371_820980_+	hypothetical protein	NA	A0A1J1J8Y5	Escherichia_phage	61.4	3.8e-61
WP_077360530.1|821018_822941_+|tail	phage tail tape measure protein	tail	A0A075KJK1	Lactobacillus_phage	34.0	3.2e-21
WP_077360532.1|822954_823623_+|tail	phage tail protein	tail	A0A0A7RWN1	Clostridium_phage	29.8	2.6e-18
WP_077360534.1|823622_825818_+	hypothetical protein	NA	A0A1L2BYA1	Clostridium_phage	45.4	1.1e-131
WP_077360536.1|825814_826009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077360538.1|828001_828274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077360540.1|828275_828485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077360542.1|828921_829356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077360544.1|829369_830491_+|tail	phage tail sheath protein	tail	A0A0A7S0D2	Clostridium_phage	46.5	1.0e-80
WP_077360546.1|830503_830935_+|tail	phage tail tube protein	tail	A0A0A7RVT1	Clostridium_phage	62.5	3.1e-41
WP_077360548.1|831040_831445_+	XkdN-like protein	NA	A0A0A7RTP2	Clostridium_phage	49.2	1.3e-28
WP_077360550.1|831620_833726_+	hypothetical protein	NA	A0A2K9V3N5	Faecalibacterium_phage	60.4	9.9e-08
WP_077360552.1|834015_834381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077360554.1|834394_834874_+	hypothetical protein	NA	A0A0A7RTT3	Clostridium_phage	37.0	1.2e-20
WP_077360556.1|834919_835924_+|terminase	terminase	terminase	A0A0A7RWY4	Clostridium_phage	37.7	7.4e-62
WP_077360558.1|835923_836286_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_077360560.1|836288_836729_+	DUF2634 domain-containing protein	NA	A0A0A8WJ32	Clostridium_phage	41.6	1.2e-19
WP_077360562.1|836721_837804_+|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	33.7	6.6e-48
WP_077360564.1|837796_838432_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	44.6	1.0e-40
WP_077360566.1|838431_841578_+|tail	phage tail protein	tail	A0A0A7RTP0	Clostridium_phage	64.0	1.3e-56
WP_077360568.1|841593_841854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077360570.1|841882_842101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077360572.1|842727_843129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077360574.1|843274_844582_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	50.7	1.4e-113
WP_015390883.1|844604_845072_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	71.5	3.1e-55
WP_015390884.1|845197_845614_+	phage XkdN-like protein	NA	A0A0A7RTN3	Clostridium_phage	63.7	1.9e-43
WP_077360575.1|847955_848633_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RW06	Clostridium_phage	57.1	1.2e-68
WP_077360577.1|848644_849616_+	hypothetical protein	NA	A0A0A7RTZ4	Clostridium_phage	66.0	2.0e-120
WP_077360579.1|849618_849939_+	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	54.3	8.2e-23
WP_077360580.1|849938_850349_+	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	66.7	1.7e-41
WP_077360582.1|850348_851392_+|plate	baseplate J/gp47 family protein	plate	A0A0A7S0L4	Clostridium_phage	51.6	3.8e-93
WP_156875959.1|851506_851995_+	DUF2313 domain-containing protein	NA	A0A0A7RTU9	Clostridium_phage	65.0	5.6e-55
WP_077360586.1|853289_853727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077360588.1|853728_853959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077360590.1|854089_854320_+	hypothetical protein	NA	A0A0A7S0T7	Clostridium_phage	54.2	2.2e-14
WP_077360592.1|854410_854821_+	hypothetical protein	NA	M9Q2G0	Clostridium_phage	48.9	8.9e-30
WP_077360594.1|855009_856044_+	glycoside hydrolase	NA	Q0SPG7	Clostridium_phage	38.0	7.2e-28
WP_077360200.1|856191_857412_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	1.8e-46
WP_015390898.1|857647_858568_-	ornithine carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	31.5	1.6e-26
WP_077360597.1|858590_859775_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.3	3.0e-25
>prophage 4
NZ_CP016087	Clostridium saccharoperbutylacetonicum strain N1-504 chromosome, complete genome	6216458	1240997	1250745	6216458		Cyanophage(28.57%)	7	NA	NA
WP_077361019.1|1240997_1244744_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.0	3.3e-30
WP_015391248.1|1244815_1245295_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.4	1.3e-24
WP_077361021.1|1245294_1246002_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	43.3	4.8e-47
WP_015391250.1|1246181_1247612_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	3.0e-56
WP_077361023.1|1247621_1248623_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SX09	Cyanophage	45.4	4.5e-67
WP_077361025.1|1248610_1249219_+	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	36.4	2.7e-22
WP_015391253.1|1249236_1250745_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	45.5	1.8e-35
>prophage 5
NZ_CP016087	Clostridium saccharoperbutylacetonicum strain N1-504 chromosome, complete genome	6216458	1288486	1297674	6216458		Planktothrix_phage(14.29%)	9	NA	NA
WP_077361069.1|1288486_1290451_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	37.6	2.1e-31
WP_077361070.1|1290870_1291461_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.7	3.2e-49
WP_077361072.1|1291467_1292379_+	dTDP-4-dehydrorhamnose reductase	NA	H9NCE8	Sphingomonas_phage	27.8	1.4e-11
WP_077361074.1|1292375_1293425_+	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	46.7	1.4e-79
WP_077361076.1|1293678_1294173_+	teicoplanin resistance protein VanZ	NA	NA	NA	NA	NA
WP_077361078.1|1294272_1295517_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	42.6	1.7e-84
WP_077361080.1|1295598_1296051_+	RrF2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_077361082.1|1296053_1297235_+	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	40.2	2.6e-42
WP_077361084.1|1297236_1297674_+	Fe-S cluster assembly scaffold protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	58.1	2.4e-33
>prophage 6
NZ_CP016087	Clostridium saccharoperbutylacetonicum strain N1-504 chromosome, complete genome	6216458	1425703	1435663	6216458		Staphylococcus_phage(42.86%)	7	NA	NA
WP_077361178.1|1425703_1426792_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	38.2	4.4e-52
WP_077361180.1|1426806_1427460_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.9	1.6e-33
WP_077361182.1|1427510_1428704_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.3	7.6e-106
WP_077361184.1|1429032_1429497_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.6	2.3e-42
WP_077361186.1|1429863_1431159_+	C40 family peptidase	NA	A0A1C9EHF6	Mycobacterium_phage	52.0	8.8e-23
WP_077361188.1|1431236_1433228_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	36.6	3.3e-69
WP_077361189.1|1433641_1435663_-	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	36.2	3.1e-67
>prophage 7
NZ_CP016087	Clostridium saccharoperbutylacetonicum strain N1-504 chromosome, complete genome	6216458	2424066	2433936	6216458		Bacillus_phage(33.33%)	6	NA	NA
WP_077362533.1|2424066_2425911_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.8e-53
WP_015392513.1|2426121_2426535_+	3D domain-containing protein	NA	S6BUU4	Bacillus_phage	52.9	1.6e-18
WP_077362535.1|2427086_2429927_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	37.4	3.8e-63
WP_077362537.1|2429948_2431367_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	36.3	1.2e-17
WP_077362539.1|2431463_2431892_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	31.9	3.9e-12
WP_077362541.1|2431956_2433936_-	glycoside hydrolase family 25	NA	A0A2R2ZGL8	Clostridioides_phage	39.0	3.7e-20
>prophage 8
NZ_CP016087	Clostridium saccharoperbutylacetonicum strain N1-504 chromosome, complete genome	6216458	3061369	3114713	6216458	capsid,plate,tail,integrase,portal,terminase	Clostridium_phage(42.86%)	67	3073960:3073975	3081816:3081831
WP_077363314.1|3061369_3064303_+	DEAD/DEAH box helicase	NA	A0A127AW80	Bacillus_phage	23.3	5.1e-34
WP_077363318.1|3064924_3065341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363320.1|3065826_3066246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363322.1|3066350_3066605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077363324.1|3066531_3068202_-	hypothetical protein	NA	A0A1L2BY67	Clostridium_phage	41.5	6.5e-103
WP_077363326.1|3068260_3068698_-	helix-turn-helix transcriptional regulator	NA	M9Q2L3	Clostridium_phage	41.4	4.6e-16
WP_077363328.1|3068935_3069136_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077363330.1|3069160_3069376_+	helix-turn-helix transcriptional regulator	NA	M9Q2L3	Clostridium_phage	41.8	3.0e-05
WP_077363332.1|3070038_3070815_+	hypothetical protein	NA	A0A2H4JCT2	uncultured_Caudovirales_phage	45.2	1.0e-34
WP_077363334.1|3070848_3071037_+	hypothetical protein	NA	I2E8Z1	Clostridium_phage	45.8	4.5e-05
WP_156875917.1|3071190_3071361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363336.1|3071383_3071578_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_077363338.1|3071570_3072245_+	hypothetical protein	NA	A0A0U2C0X9	Paracoccus_phage	30.5	3.3e-05
WP_077363340.1|3072255_3073179_+	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_077363342.1|3073193_3073964_+	DUF4373 domain-containing protein	NA	A8ATL0	Listeria_phage	54.4	3.5e-43
3073960:3073975	attL	ATTAAAAATGATTGAT	NA	NA	NA	NA
WP_077363344.1|3073966_3074515_+	sigma-70 family RNA polymerase sigma factor	NA	M9Q2I8	Clostridium_phage	31.9	2.3e-17
WP_077363346.1|3074511_3074919_+	hypothetical protein	NA	A0A0A7RVR5	Clostridium_phage	41.7	4.3e-16
WP_077363348.1|3074915_3075935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363350.1|3076071_3076428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077363352.1|3076708_3076975_-	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	49.3	1.0e-10
WP_156875918.1|3078497_3078668_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_077363356.1|3078746_3079169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077363358.1|3079349_3080357_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	28.6	1.5e-14
WP_077366783.1|3080401_3081142_+	hypothetical protein	NA	A0A1L2BY85	Clostridium_phage	52.5	1.0e-60
WP_077366784.1|3081251_3081593_+	hypothetical protein	NA	A0A2H4J4U3	uncultured_Caudovirales_phage	62.4	1.8e-31
WP_077363359.1|3081585_3081900_+	hypothetical protein	NA	NA	NA	NA	NA
3081816:3081831	attR	ATTAAAAATGATTGAT	NA	NA	NA	NA
WP_077363361.1|3081899_3082328_+	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_077363363.1|3082447_3083380_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_077363365.1|3083686_3083890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363367.1|3083927_3084215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363369.1|3084298_3084493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363371.1|3084509_3085391_+|portal	phage portal protein	portal	E5DV49	Deep-sea_thermophilic_phage	40.6	4.6e-39
WP_156875919.1|3085377_3086697_+|terminase	PBSX family phage terminase large subunit	terminase	X5JAB3	Clostridium_phage	83.7	4.2e-206
WP_077363375.1|3086849_3088400_+|portal	phage portal protein	portal	D9ZNC8	Clostridium_phage	50.4	8.1e-132
WP_156875920.1|3088402_3089998_+	hypothetical protein	NA	A0A2H4J048	uncultured_Caudovirales_phage	34.7	3.9e-49
WP_077363377.1|3089994_3090258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363379.1|3090432_3090837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156875963.1|3091124_3091787_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.3	4.5e-07
WP_156875921.1|3091806_3092007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363385.1|3092073_3092391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363387.1|3092948_3093563_+	hypothetical protein	NA	A0A0A7RW68	Clostridium_phage	32.7	4.6e-22
WP_077363389.1|3093584_3093971_+	hypothetical protein	NA	D9ZND5	Clostridium_phage	34.9	8.4e-06
WP_077363391.1|3093981_3095037_+|capsid	phage capsid protein	capsid	A0A0A7RU11	Clostridium_phage	48.4	5.2e-82
WP_156875964.1|3095366_3095699_+	hypothetical protein	NA	A0A2H4J040	uncultured_Caudovirales_phage	59.4	2.3e-28
WP_077363395.1|3095695_3096082_+	hypothetical protein	NA	A0A2H4J057	uncultured_Caudovirales_phage	52.8	6.4e-30
WP_077363397.1|3096083_3096509_+	hypothetical protein	NA	A0A2H4J736	uncultured_Caudovirales_phage	39.9	1.2e-21
WP_077363399.1|3096511_3097342_+	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	60.8	8.0e-94
WP_077366785.1|3097483_3097672_+	hypothetical protein	NA	A0A0A8WEX5	Clostridium_phage	60.3	5.0e-12
WP_077363401.1|3097671_3099105_+|tail	phage tail sheath protein	tail	A0A2H4J1N7	uncultured_Caudovirales_phage	58.7	3.0e-157
WP_077363402.1|3099127_3099541_+|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	61.4	1.4e-43
WP_077366786.1|3099624_3100056_+	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	47.2	1.3e-26
WP_077366787.1|3100234_3103849_+|tail	phage tail tape measure protein	tail	A0A2H4J055	uncultured_Caudovirales_phage	38.3	4.5e-117
WP_077363404.1|3103891_3104548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363406.1|3104676_3105360_+	SH3 domain-containing protein	NA	A0A0A8WI78	Clostridium_phage	46.6	2.3e-30
WP_077363408.1|3105364_3106369_+	XkdQ	NA	A0A2H4J063	uncultured_Caudovirales_phage	50.6	3.4e-83
WP_156875922.1|3106361_3106703_+	hypothetical protein	NA	A0A2H4J746	uncultured_Caudovirales_phage	54.2	2.3e-23
WP_077363412.1|3106695_3107133_+	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	50.7	5.9e-32
WP_077363414.1|3107137_3108268_+|plate	baseplate J/gp47 family protein	plate	A0A0A8WEY6	Clostridium_phage	57.3	2.7e-116
WP_077363416.1|3108264_3108906_+	YmfQ family protein	NA	A0A2H4J1P4	uncultured_Caudovirales_phage	51.7	6.4e-59
WP_077363418.1|3108905_3110417_+|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	60.9	1.1e-53
WP_077363420.1|3110448_3110727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363422.1|3110728_3110929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363424.1|3111020_3111425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077363425.1|3111756_3112992_+	Ig domain-containing protein	NA	K4FB16	Cronobacter_phage	41.3	5.3e-09
WP_077363427.1|3113167_3113404_+	hypothetical protein	NA	A0A0A7S0T7	Clostridium_phage	53.9	1.6e-15
WP_077363429.1|3113422_3113857_+	hypothetical protein	NA	M9Q2G0	Clostridium_phage	51.8	5.9e-32
WP_077363431.1|3113927_3114713_+	glycoside hydrolase	NA	Q0SPG7	Clostridium_phage	37.8	9.1e-31
>prophage 9
NZ_CP016087	Clostridium saccharoperbutylacetonicum strain N1-504 chromosome, complete genome	6216458	3667340	3674388	6216458	integrase	uncultured_Caudovirales_phage(33.33%)	11	3656869:3656884	3675475:3675490
3656869:3656884	attL	GTTATTAAATTAATTG	NA	NA	NA	NA
WP_077364214.1|3667340_3668051_-	hypothetical protein	NA	A0A1L2BY85	Clostridium_phage	51.9	1.2e-58
WP_077364216.1|3668181_3668406_+	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_077364218.1|3668449_3668668_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_077364220.1|3668799_3669195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077364222.1|3669196_3669439_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	51.4	4.2e-11
WP_077364224.1|3669514_3670159_-	AAA family ATPase	NA	A0A0K2CPA5	Brevibacillus_phage	38.5	3.1e-29
WP_077364226.1|3670190_3671357_-	phage replisome organizer	NA	V5UQV4	Oenococcus_phage	38.0	3.3e-21
WP_077364228.1|3671499_3671691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077364230.1|3671886_3672135_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_077364232.1|3672109_3672331_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J776	uncultured_Caudovirales_phage	49.2	1.7e-06
WP_077364236.1|3673209_3674388_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	29.0	1.4e-27
3675475:3675490	attR	CAATTAATTTAATAAC	NA	NA	NA	NA
>prophage 10
NZ_CP016087	Clostridium saccharoperbutylacetonicum strain N1-504 chromosome, complete genome	6216458	5612344	5621081	6216458		Catovirus(50.0%)	6	NA	NA
WP_077366386.1|5612344_5614210_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.2	1.2e-25
WP_077366387.1|5614243_5615227_-	glycosyltransferase	NA	R9S8I6	Prochlorococcus_phage	27.6	2.8e-05
WP_077366388.1|5615426_5616275_-	LicD family protein	NA	A0A1V0SAS8	Catovirus	36.8	2.6e-07
WP_077366389.1|5616607_5617588_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	39.3	2.3e-15
WP_077366390.1|5617757_5619641_+	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	25.7	2.9e-14
WP_015395412.1|5619671_5621081_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	35.4	1.3e-59
>prophage 11
NZ_CP016087	Clostridium saccharoperbutylacetonicum strain N1-504 chromosome, complete genome	6216458	6050355	6082143	6216458	capsid,plate,tail,protease,head,portal,terminase	Clostridium_phage(32.0%)	41	NA	NA
WP_077366620.1|6050355_6051108_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1L2BYB1	Clostridium_phage	57.8	1.4e-76
WP_077366621.1|6051107_6051335_-	hypothetical protein	NA	A0A1Q1PVX5	Staphylococcus_phage	39.7	7.6e-07
WP_077366622.1|6051352_6051634_-	hypothetical protein	NA	A0A2H4J1Q4	uncultured_Caudovirales_phage	40.9	4.0e-13
WP_077366623.1|6051687_6051867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077366624.1|6051868_6052297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077366625.1|6052315_6053683_-	hypothetical protein	NA	S6B1J7	Thermus_phage	25.7	2.7e-06
WP_077366626.1|6053695_6054265_-	YmfQ family protein	NA	A0A0A7RTU9	Clostridium_phage	43.1	3.5e-40
WP_077366627.1|6054277_6055315_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	42.2	1.8e-63
WP_077366628.1|6055315_6055756_-	DUF2634 domain-containing protein	NA	A0A0A8WJ32	Clostridium_phage	29.9	4.6e-08
WP_077366629.1|6055757_6056081_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_077366630.1|6056083_6056989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077366631.1|6056985_6057411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077366632.1|6057423_6059307_-	hypothetical protein	NA	A0A2H4J4V9	uncultured_Caudovirales_phage	35.2	1.9e-34
WP_077366633.1|6059491_6059884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077366634.1|6059999_6060392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077366635.1|6060884_6061310_-|tail	phage tail tube protein	tail	A0A090DCP2	Clostridium_phage	28.0	6.2e-10
WP_077366636.1|6061325_6062483_-	hypothetical protein	NA	A0A0A8WJL8	Clostridium_phage	28.8	2.6e-34
WP_077366637.1|6062460_6062925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077366638.1|6062926_6063364_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_077366639.1|6063356_6063710_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_077366640.1|6063720_6064032_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_077366641.1|6064050_6065193_-|capsid	phage major capsid protein	capsid	A0A2P1CCA5	Lactobacillus_phage	41.2	5.9e-71
WP_077366642.1|6065267_6065891_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B1P7P1	Bacillus_phage	51.8	1.0e-48
WP_077366643.1|6065853_6067092_-|portal	phage portal protein	portal	A0A2P1CD40	Lactobacillus_phage	41.9	3.6e-82
WP_077366644.1|6067126_6068803_-|terminase	terminase	terminase	A0A075KQB9	Lactobacillus_phage	59.2	7.8e-189
WP_077366645.1|6068799_6069267_-|terminase	phage terminase small subunit P27 family	terminase	A0A0A7RUQ4	Clostridium_phage	55.2	9.2e-39
WP_077366646.1|6069365_6070223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077366647.1|6070412_6071183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077366648.1|6071277_6071835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077366649.1|6071794_6072205_-	hypothetical protein	NA	U3PD10	Staphylococcus_phage	39.5	1.9e-08
WP_077366650.1|6072705_6073158_-	hypothetical protein	NA	A0A0A7RTX6	Clostridium_phage	36.9	1.5e-17
WP_077366651.1|6073416_6075297_-	hypothetical protein	NA	A0A2H4J1M0	uncultured_Caudovirales_phage	49.3	1.3e-171
WP_077366652.1|6075323_6075617_-	DUF1599 domain-containing protein	NA	A0A1W6JKU5	Lactococcus_phage	36.2	3.6e-09
WP_077366653.1|6075613_6077305_-	hypothetical protein	NA	A0A2H4J041	uncultured_Caudovirales_phage	61.3	1.1e-201
WP_077366654.1|6077562_6078018_-	DUF669 domain-containing protein	NA	A0A2H4J1S8	uncultured_Caudovirales_phage	40.5	6.2e-24
WP_077366655.1|6078024_6078894_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	49.8	1.1e-48
WP_077366656.1|6078966_6079266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077366657.1|6079270_6079570_-	VRR-NUC domain-containing protein	NA	A0A2H4J095	uncultured_Caudovirales_phage	60.8	2.5e-29
WP_077366659.1|6079827_6080037_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156875973.1|6080033_6081197_-	ATP-dependent helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	64.3	1.3e-145
WP_077366661.1|6081765_6082143_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J076	uncultured_Caudovirales_phage	43.1	6.1e-17
