The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019674	Burkholderia cenocepacia strain VC12308 chromosome 1, complete sequence	3668000	70437	142737	3668000	plate,holin,tail,integrase	Burkholderia_phage(68.75%)	70	70339:70369	93042:93072
70339:70369	attL	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCC	NA	NA	NA	NA
WP_006484045.1|70437_71514_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	81.7	7.2e-164
WP_034178513.1|71516_71789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006496273.1|71840_72212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034201137.1|72208_75001_-	hypothetical protein	NA	E5E3N5	Burkholderia_phage	91.0	0.0e+00
WP_006496271.1|75006_75264_-	hypothetical protein	NA	A4JWQ9	Burkholderia_virus	57.1	1.2e-13
WP_077190291.1|75391_75640_-	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	90.2	6.5e-36
WP_006485450.1|75821_76037_-	hypothetical protein	NA	E5E3U1	Burkholderia_phage	80.0	4.4e-20
WP_077190290.1|76163_76619_+	helix-turn-helix transcriptional regulator	NA	E5E3U2	Burkholderia_phage	62.9	5.4e-44
WP_006485449.1|76935_77232_+	hypothetical protein	NA	E5E3U3	Burkholderia_phage	50.5	1.6e-12
WP_077190289.1|77419_78478_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	69.7	9.1e-135
WP_077190287.1|78474_78906_-|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	67.4	1.1e-41
WP_077190286.1|78928_81499_-	hypothetical protein	NA	E5E3U6	Burkholderia_phage	46.3	2.4e-133
WP_006484104.1|81514_81628_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	85.7	1.1e-09
WP_034201131.1|81636_82008_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	66.4	3.4e-28
WP_077175722.1|82084_82588_-|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	74.3	2.2e-70
WP_060213076.1|82622_83795_-|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	81.5	6.6e-187
WP_077190284.1|83849_84602_-|tail	tail assembly chaperone	tail	E5E3V1	Burkholderia_phage	84.2	1.4e-89
WP_077190283.1|84617_86945_-|tail	phage tail protein	tail	E5E3V2	Burkholderia_phage	61.7	6.2e-261
WP_006484097.1|86951_87494_-|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	70.9	5.2e-70
WP_006484106.1|87486_88401_-|plate	baseplate assembly protein	plate	E5FFH3	Burkholderia_phage	72.6	1.5e-117
WP_034201129.1|88397_88760_-|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	69.2	3.4e-41
WP_006496264.1|88756_89443_-|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	68.7	4.4e-82
WP_077190281.1|89951_90401_-|tail	phage tail protein	tail	E5E3V9	Burkholderia_phage	54.2	1.5e-30
WP_034201128.1|90517_90958_-	protein lysB	NA	K4NXJ2	Burkholderia_phage	44.8	8.4e-18
WP_077190279.1|90954_91812_-	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	65.4	3.8e-91
WP_006484102.1|91808_92075_-|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	65.5	6.2e-24
WP_006484093.1|92076_92421_-	membrane protein	NA	A4JWU2	Burkholderia_virus	77.9	5.7e-38
WP_006484103.1|92437_92644_-|tail	tail protein	tail	E5E3W5	Burkholderia_phage	64.7	5.1e-18
WP_077190278.1|93205_94825_+	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
93042:93072	attR	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCC	NA	NA	NA	NA
WP_034201126.1|97124_97817_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077190276.1|98128_99406_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_034201124.1|99461_100424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034201123.1|100420_101119_-	WbqC family protein	NA	NA	NA	NA	NA
WP_034201122.1|101120_102266_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	31.1	2.3e-11
WP_062911073.1|102294_104640_-	glycosyltransferase family 41 protein	NA	NA	NA	NA	NA
WP_059721094.1|104897_105197_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_006484094.1|105222_106731_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_034201118.1|106863_108018_-	flagellin	NA	NA	NA	NA	NA
WP_006401410.1|108548_108761_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_060213053.1|108927_111051_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_077190273.1|111280_112516_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_034201116.1|112600_113203_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_077190272.1|113344_114226_+	ATPase	NA	NA	NA	NA	NA
WP_077190270.1|114387_115212_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_006489324.1|115342_116086_-	aquaporin Z	NA	A0A1B1ISL4	uncultured_Mediterranean_phage	50.8	8.1e-05
WP_006489320.1|116385_116682_+	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	41.1	1.9e-10
WP_006489318.1|116785_117850_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_006477348.1|118481_118835_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_006493184.1|118927_119482_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_006482649.1|119662_120523_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_006482647.1|120536_121556_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_006482646.1|121580_121958_+	response regulator	NA	NA	NA	NA	NA
WP_077190268.1|121991_124244_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_006486165.1|124291_124807_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_077019861.1|124844_126803_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.0	1.5e-10
WP_006497455.1|126806_127799_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_006497454.1|127795_128554_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_012492268.1|128550_129642_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_006485893.1|129709_130105_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	6.0e-07
WP_006497453.1|130107_130839_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_012492269.1|131098_131602_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_006497451.1|131618_132857_+	DUF3443 family protein	NA	NA	NA	NA	NA
WP_006485888.1|133021_133519_+	VOC family protein	NA	NA	NA	NA	NA
WP_006485884.1|133948_135148_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_006485892.1|135144_137247_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_077190266.1|137243_139043_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_006491878.1|139035_139854_+	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_006484033.1|139876_140611_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_006484031.1|140862_142281_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	9.9e-44
WP_006477367.1|142383_142737_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 2
NZ_CP019674	Burkholderia cenocepacia strain VC12308 chromosome 1, complete sequence	3668000	315071	355129	3668000	plate,protease,integrase	Pseudomonas_phage(20.0%)	38	308582:308600	368321:368339
308582:308600	attL	CGTGATCGCGCTGCCGATC	NA	NA	NA	NA
WP_059723936.1|315071_315587_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.0	9.5e-21
WP_077188931.1|315855_317073_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	43.6	1.7e-89
WP_077188932.1|317287_318505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102898885.1|319278_322155_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.6	6.6e-71
WP_077188934.1|322267_322594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004522579.1|322603_322951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077188935.1|322943_323156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077188936.1|323148_323451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012329039.1|323443_323620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077188937.1|323950_324475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042967671.1|324471_324663_-	AlpA family phage regulatory protein	NA	A0A2L0V109	Agrobacterium_phage	47.2	2.4e-06
WP_125345935.1|325246_325990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125345937.1|326263_327649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077188939.1|328041_328617_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	39.6	8.7e-23
WP_077188940.1|329574_330873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077188941.1|331179_332112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077188942.1|332191_333307_-	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	96.0	1.7e-208
WP_077188943.1|333316_334045_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	48.3	6.8e-49
WP_077188944.1|334041_334569_-	hypothetical protein	NA	A4JWV5	Burkholderia_virus	64.6	4.5e-58
WP_125345941.1|335058_335355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077188945.1|335743_338494_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.9	2.4e-78
WP_077188960.1|338615_340838_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	32.2	9.7e-38
WP_077188961.1|340846_342310_+	virulence factor	NA	NA	NA	NA	NA
WP_059723932.1|342324_342582_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_059723931.1|342921_343125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060373216.1|343187_343988_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006485338.1|344269_344587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062884146.1|344668_345004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006491869.1|345118_345901_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_006477098.1|345897_347244_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_034178609.1|347349_347961_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_043204524.1|348336_348963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006484395.1|349009_349525_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006484397.1|349540_351031_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006477093.1|351101_351605_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_006477092.1|351667_352153_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_006494422.1|352229_354065_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_058901209.1|354028_355129_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
368321:368339	attR	CGTGATCGCGCTGCCGATC	NA	NA	NA	NA
>prophage 3
NZ_CP019674	Burkholderia cenocepacia strain VC12308 chromosome 1, complete sequence	3668000	658064	667084	3668000		Hokovirus(16.67%)	7	NA	NA
WP_006484920.1|658064_660017_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	2.5e-146
WP_006476837.1|660270_661407_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	5.0e-22
WP_077189442.1|661410_663333_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	36.5	2.0e-55
WP_006485002.1|663407_664223_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.2	1.8e-37
WP_006484932.1|664266_664953_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	26.4	7.2e-08
WP_006476832.1|664949_665492_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_006497490.1|665527_667084_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.8	1.6e-23
>prophage 4
NZ_CP019674	Burkholderia cenocepacia strain VC12308 chromosome 1, complete sequence	3668000	795536	802112	3668000		Enterobacteria_phage(66.67%)	7	NA	NA
WP_077190968.1|795536_796598_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.4	1.6e-86
WP_006496667.1|796609_797503_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.8	1.3e-97
WP_059721600.1|797487_798039_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.2	8.5e-52
WP_077190967.1|798053_798980_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.6	1.6e-26
WP_006496664.1|799063_800479_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	1.9e-58
WP_006496663.1|800482_801301_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006496662.1|801305_802112_+	ABC transporter ATP-binding protein	NA	Q66093	Chlorella_virus	25.1	9.4e-07
