The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019668	Burkholderia cenocepacia strain VC7848 chromosome, complete genome	7499459	3874276	3887385	7499459		Bodo_saltans_virus(12.5%)	11	NA	NA
WP_077179142.1|3874276_3875476_+	Tet(A)/Tet(B)/Tet(C) family tetracycline efflux MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	24.3	5.9e-05
WP_006484927.1|3875575_3876631_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.9	1.7e-72
WP_011544645.1|3876833_3877619_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_006476830.1|3877630_3878308_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_012327944.1|3878313_3879870_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.8	1.2e-23
WP_006476832.1|3879905_3880448_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_023477678.1|3880444_3881131_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	26.4	1.2e-07
WP_006476834.1|3881174_3881990_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.7	6.7e-37
WP_077179141.1|3882112_3884035_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VNU7	Pandoravirus	37.0	8.1e-57
WP_006476837.1|3884039_3885176_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	5.0e-22
WP_006476838.1|3885432_3887385_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.8	1.6e-148
>prophage 2
NZ_CP019668	Burkholderia cenocepacia strain VC7848 chromosome, complete genome	7499459	6353142	6390464	7499459	portal,plate,terminase,capsid,holin,head,tail,integrase	Burkholderia_phage(95.83%)	51	6353033:6353078	6391326:6391371
6353033:6353078	attL	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAA	NA	NA	NA	NA
WP_077180162.1|6353142_6354219_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	96.4	3.9e-202
WP_077180163.1|6355107_6357900_-	hypothetical protein	NA	A0A1S5NPU9	Burkholderia_phage	97.3	0.0e+00
WP_077180164.1|6357902_6358151_-	hypothetical protein	NA	E5E3T3	Burkholderia_phage	91.5	9.8e-32
WP_077180165.1|6358147_6358510_-	hypothetical protein	NA	A0A1S5NQ52	Burkholderia_phage	93.3	6.6e-45
WP_077180166.1|6358513_6358861_-	hypothetical protein	NA	A0A1S5NV61	Burkholderia_phage	55.3	4.6e-35
WP_077180167.1|6358865_6359060_-	hypothetical protein	NA	E5E3T5	Burkholderia_phage	85.9	3.9e-20
WP_077180168.1|6359103_6359298_-	hypothetical protein	NA	E5E3T6	Burkholderia_phage	62.5	1.0e-15
WP_027809271.1|6359302_6359497_-	hypothetical protein	NA	A0A1S5NR87	Burkholderia_phage	92.2	3.1e-25
WP_006757081.1|6359585_6359834_-	ogr/Delta-like zinc finger family protein	NA	A0A1S5NNI9	Burkholderia_phage	97.6	2.6e-40
WP_012734469.1|6359861_6360053_-	hypothetical protein	NA	E5E3T9	Burkholderia_phage	54.7	1.4e-09
WP_017432096.1|6360081_6360273_-	hypothetical protein	NA	E5E3U0	Burkholderia_phage	67.3	1.7e-12
WP_034196663.1|6360289_6360475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077180169.1|6360592_6361084_+	helix-turn-helix transcriptional regulator	NA	E5E3U2	Burkholderia_phage	43.0	7.9e-25
WP_036036984.1|6361074_6361455_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077180170.1|6361921_6363073_-	phage late control D family protein	NA	A0A1S5NV58	Burkholderia_phage	96.8	5.5e-194
WP_027809278.1|6363069_6363498_-|tail	phage tail protein	tail	A0A1S5NTH4	Burkholderia_phage	99.3	3.6e-74
WP_077180171.1|6363511_6366763_-	hypothetical protein	NA	A0A1S5NRM8	Burkholderia_phage	96.6	0.0e+00
WP_014724666.1|6366759_6366879_-|tail	GpE family phage tail protein	tail	A0A1S5NR79	Burkholderia_phage	100.0	6.1e-16
WP_006757090.1|6366878_6367190_-|tail	phage tail assembly protein	tail	A0A1S5NNH9	Burkholderia_phage	95.1	8.8e-46
WP_077180172.1|6367222_6367732_-|tail	phage major tail tube protein	tail	A0A1S5NNH7	Burkholderia_phage	94.7	1.4e-88
WP_077180173.1|6367761_6368934_-|tail	phage tail sheath protein	tail	A0A1S5NNH8	Burkholderia_phage	98.5	4.7e-225
WP_077180174.1|6369045_6369795_-	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	97.2	1.7e-140
WP_077180175.1|6369772_6369955_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	95.0	2.4e-27
WP_035984600.1|6370104_6370443_-	hypothetical protein	NA	A0A1S5NQ35	Burkholderia_phage	89.3	8.6e-47
WP_077180176.1|6370465_6370900_-	hypothetical protein	NA	R4JMH4	Burkholderia_phage	81.6	2.9e-63
WP_077180177.1|6370896_6373914_-|tail	phage tail protein	tail	A0A1S5NTG6	Burkholderia_phage	67.1	0.0e+00
WP_077180178.1|6373919_6374471_-|tail	phage tail protein I	tail	A0A1S5NRL9	Burkholderia_phage	98.4	3.8e-100
WP_077180179.1|6374463_6375369_-|plate	baseplate assembly protein	plate	A0A1S5NR72	Burkholderia_phage	94.7	2.1e-156
WP_077180180.1|6375365_6375731_-	hypothetical protein	NA	A0A1S5NNH3	Burkholderia_phage	94.2	6.9e-58
WP_077180181.1|6375727_6376432_-|plate	phage baseplate assembly protein V	plate	A0A1S5NNH1	Burkholderia_phage	84.2	1.1e-96
WP_077180182.1|6376531_6376981_-	phage virion morphogenesis protein	NA	A0A1S5NPT5	Burkholderia_phage	95.3	2.8e-69
WP_077180183.1|6376980_6377391_-|tail	phage tail protein	tail	E5E3R4	Burkholderia_phage	93.4	2.6e-69
WP_077180184.1|6377387_6377879_-	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	94.5	4.9e-75
WP_077180185.1|6377875_6378676_-	DUF3380 domain-containing protein	NA	A0A1S5NV50	Burkholderia_phage	96.2	3.5e-139
WP_014724682.1|6378668_6378989_-|holin	phage holin family protein	holin	A0A1S5NTF8	Burkholderia_phage	97.2	7.9e-50
WP_077180186.1|6378988_6379363_-	hypothetical protein	NA	A0A1S5NRL1	Burkholderia_phage	93.5	2.6e-52
WP_077180187.1|6379365_6379578_-|tail	phage tail protein	tail	A0A1S5NR68	Burkholderia_phage	95.7	1.3e-32
WP_077180188.1|6379577_6379814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027809294.1|6379813_6380296_-|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	93.1	8.4e-80
WP_077180189.1|6380400_6381087_-|terminase	terminase endonuclease subunit	terminase	A0A1S5NNA5	Burkholderia_phage	98.2	7.5e-122
WP_027809296.1|6381083_6382103_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S5NPT2	Burkholderia_phage	97.9	1.4e-188
WP_077180190.1|6382139_6382964_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S5NPS0	Burkholderia_phage	90.1	7.3e-132
WP_077180191.1|6383108_6384872_+	oxidoreductase	NA	E5E3S6	Burkholderia_phage	89.5	0.0e+00
WP_077180192.1|6384858_6385914_+|portal	phage portal protein	portal	A0A1S5NV43	Burkholderia_phage	97.7	2.6e-198
WP_077180193.1|6385941_6386658_-	DUF159 family protein	NA	A0A1S5NTJ1	Burkholderia_phage	98.3	5.7e-141
WP_077232705.1|6386752_6387034_+	hypothetical protein	NA	A0A1S5NRP7	Burkholderia_phage	92.5	1.1e-47
WP_036037044.1|6387082_6387337_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	97.6	3.1e-41
WP_036037045.1|6387320_6387647_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	99.1	1.0e-52
WP_077180195.1|6388039_6389155_-	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	61.0	1.2e-132
WP_077180196.1|6389160_6389931_-	nuclease	NA	A4JWV4	Burkholderia_virus	50.6	1.9e-49
WP_077180197.1|6389927_6390464_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	62.3	2.7e-58
6391326:6391371	attR	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAA	NA	NA	NA	NA
>prophage 3
NZ_CP019668	Burkholderia cenocepacia strain VC7848 chromosome, complete genome	7499459	6620211	6658878	7499459	protease,tail,plate	uncultured_Caudovirales_phage(60.0%)	27	NA	NA
WP_011546600.1|6620211_6620733_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	48.7	4.8e-20
WP_011546589.1|6621150_6621354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011546588.1|6621463_6622264_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077178473.1|6622620_6625812_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.1	2.5e-58
WP_077178472.1|6625863_6630519_+	sugar-binding protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	50.3	1.8e-46
WP_077178471.1|6630529_6631105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023476214.1|6631639_6631957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077178470.1|6632043_6632826_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_006477098.1|6632822_6634169_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_006477097.1|6634271_6634883_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011546581.1|6635255_6635891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006484395.1|6635937_6636453_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006477094.1|6636468_6637959_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006477093.1|6638029_6638533_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_006477092.1|6638595_6639081_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_077178469.1|6639157_6640993_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011694123.1|6640956_6642057_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_077178468.1|6642098_6644768_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.1	5.0e-89
WP_077178467.1|6644812_6645934_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_077178466.1|6646000_6648700_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.1	3.5e-50
WP_143275915.1|6648696_6650028_+	chitosanase	NA	NA	NA	NA	NA
WP_143275916.1|6650034_6650454_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_054928313.1|6650731_6651682_-	OmpA family protein	NA	NA	NA	NA	NA
WP_054928314.1|6651686_6652676_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_077178464.1|6652672_6656617_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_077178463.1|6656918_6657764_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_077178462.1|6657885_6658878_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP019668	Burkholderia cenocepacia strain VC7848 chromosome, complete genome	7499459	6776600	6859457	7499459	transposase,holin	Mycobacterium_phage(16.67%)	57	NA	NA
WP_011546943.1|6776600_6777653_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1C9LZZ3	Mycobacterium_phage	39.4	3.2e-31
WP_041489351.1|6777742_6778936_+	porin	NA	NA	NA	NA	NA
WP_011546945.1|6779560_6781486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011546946.1|6781499_6783668_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	29.9	3.0e-07
WP_011546947.1|6784068_6784515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011546948.1|6784693_6785659_-	oxidoreductase	NA	NA	NA	NA	NA
WP_011546949.1|6785655_6786735_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_006480545.1|6786936_6787425_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011546950.1|6787479_6788226_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006480547.1|6788396_6789578_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011546951.1|6789608_6791216_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	55.3	2.3e-20
WP_011546952.1|6791235_6792021_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011546953.1|6792057_6794055_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011694854.1|6794392_6794596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011546955.1|6794638_6796753_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_011546956.1|6796840_6798226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011546957.1|6798567_6799710_+	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_011546958.1|6799924_6800299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011694853.1|6800497_6801301_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011546960.1|6801297_6801789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011546961.1|6801846_6803820_-	FkbM family methyltransferase	NA	A0A291AUV0	Sinorhizobium_phage	28.0	2.7e-07
WP_011546962.1|6803844_6804981_-	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_011546963.1|6805014_6805482_-	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011546964.1|6805508_6806663_-	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_006480560.1|6806677_6807823_-	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_011546965.1|6808223_6808889_-	OmpA family protein	NA	NA	NA	NA	NA
WP_155123332.1|6809009_6817154_-	hemagglutinin	NA	NA	NA	NA	NA
WP_012339443.1|6818116_6819019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011546968.1|6819548_6820034_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143275912.1|6820651_6821813_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	2.8e-84
WP_011546981.1|6822501_6823314_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	25.5	8.8e-05
WP_011546982.1|6823923_6824874_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_011546983.1|6824955_6825771_+	alpha/beta hydrolase	NA	A0A1L7N183	Ralstonia_phage	29.3	1.6e-09
WP_011546984.1|6825960_6826719_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.8	1.4e-07
WP_011694847.1|6826780_6827980_+	MFS transporter	NA	NA	NA	NA	NA
WP_011546986.1|6828099_6828639_+	alkylhydroperoxidase	NA	NA	NA	NA	NA
WP_011546988.1|6829221_6830160_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011694846.1|6830661_6831186_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011546990.1|6831585_6832305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077178779.1|6832750_6834937_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_011546992.1|6835039_6835873_+	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	26.8	6.5e-11
WP_011546993.1|6836075_6837170_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011546994.1|6837493_6839182_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011546995.1|6839792_6840248_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011546996.1|6840249_6842484_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_011546997.1|6842499_6843798_+	cytochrome c	NA	NA	NA	NA	NA
WP_077178780.1|6844471_6844906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011546999.1|6845178_6845550_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_012339455.1|6846134_6847166_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012339456.1|6847426_6847801_+	response regulator	NA	NA	NA	NA	NA
WP_011547002.1|6847840_6849739_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	32.5	4.2e-05
WP_011547003.1|6849731_6850376_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011547004.1|6850527_6851853_-	MFS transporter	NA	NA	NA	NA	NA
WP_011694841.1|6852963_6854328_+	mercuric reductase	NA	NA	NA	NA	NA
WP_011546517.1|6855277_6856783_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_011546518.1|6856775_6857573_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	37.2	9.8e-33
WP_011544750.1|6858197_6859457_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	5.1e-44
