The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019623	Listeria monocytogenes strain 10-092876-1763 LM10 chromosome, complete genome	2940913	123039	129564	2940913	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003721739.1|123039_123492_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|123497_123833_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003732219.1|124049_124478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732220.1|124489_124906_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_009930418.1|125183_125573_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|125585_126098_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_009911446.1|126145_126448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009911444.1|126489_126894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069007725.1|126880_128749_+	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_009911828.1|128745_129564_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
NZ_CP019623	Listeria monocytogenes strain 10-092876-1763 LM10 chromosome, complete genome	2940913	1150278	1157700	2940913		Hokovirus(33.33%)	8	NA	NA
WP_003721506.1|1150278_1150662_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003732709.1|1150683_1151667_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
WP_058876248.1|1151681_1152695_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	4.6e-11
WP_003721509.1|1152903_1154394_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003727000.1|1154405_1155230_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_061111005.1|1155242_1155551_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003730540.1|1155610_1156015_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_010989661.1|1156143_1157700_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
>prophage 3
NZ_CP019623	Listeria monocytogenes strain 10-092876-1763 LM10 chromosome, complete genome	2940913	1247968	1351717	2940913	integrase,portal,protease,holin,tail,capsid,tRNA,terminase	Listeria_phage(70.49%)	114	1273654:1273675	1314527:1314548
WP_003736387.1|1247968_1249021_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	1.3e-29
WP_069007870.1|1249020_1251429_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_014600776.1|1251589_1252291_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	3.0e-33
WP_031674597.1|1252304_1255715_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_069007869.1|1255812_1256265_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069007868.1|1256280_1259481_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_069007867.1|1259587_1260262_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.3	1.7e-49
WP_072217174.1|1260299_1261226_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003740576.1|1261379_1261643_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003723849.1|1261642_1262185_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003723851.1|1262277_1263990_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.8	5.1e-18
WP_003732776.1|1264012_1266370_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723853.1|1266450_1266762_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
WP_014600780.1|1266837_1268649_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003732778.1|1268837_1270052_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003733801.1|1270107_1270602_-	YslB family protein	NA	NA	NA	NA	NA
WP_003723856.1|1270749_1271550_+	glutamate racemase	NA	NA	NA	NA	NA
WP_014601941.1|1271562_1272309_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_069007866.1|1272312_1272924_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_012951515.1|1272960_1273485_+	metallophosphoesterase	NA	NA	NA	NA	NA
1273654:1273675	attL	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_031660124.1|1273770_1274925_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	94.8	1.1e-207
WP_003730990.1|1275056_1275671_-	hypothetical protein	NA	A0A059T7Z1	Listeria_phage	77.0	7.7e-78
WP_003730991.1|1275721_1276174_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	90.0	4.8e-77
WP_014601389.1|1276190_1276514_-	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	73.8	6.3e-39
WP_159420750.1|1276795_1276951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025370566.1|1277357_1277681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003730994.1|1277828_1278032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003730995.1|1278098_1278290_+	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	87.1	5.4e-22
WP_003730996.1|1278311_1278554_+	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_003730997.1|1278556_1278742_+	hypothetical protein	NA	A8ATD3	Listeria_phage	98.4	3.7e-28
WP_012951522.1|1279479_1279722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731843.1|1280007_1280223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069007865.1|1280300_1280852_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	45.0	2.7e-37
WP_009912778.1|1280910_1281426_+	hypothetical protein	NA	C9E2P0	Enterococcus_phage	45.5	1.8e-32
WP_068997557.1|1281604_1282075_+	DUF1642 domain-containing protein	NA	R4IBV9	Listeria_phage	69.2	2.5e-28
WP_031669126.1|1282075_1282498_+	hypothetical protein	NA	Q8W5W4	Listeria_phage	95.0	1.5e-69
WP_003731667.1|1282494_1282668_+	hypothetical protein	NA	Q8W5W3	Listeria_phage	100.0	6.8e-24
WP_012951535.1|1282664_1283048_+	hypothetical protein	NA	A8ATE8	Listeria_phage	92.9	5.3e-61
WP_003731665.1|1283049_1283529_+	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
WP_012951536.1|1283548_1284238_+	AAA family ATPase	NA	R4IDY8	Listeria_phage	96.9	3.1e-128
WP_077310975.1|1284316_1285558_+	DEAD/DEAH box helicase	NA	A8ATF1	Listeria_phage	92.4	1.2e-207
WP_069007862.1|1285582_1286068_+	DUF669 domain-containing protein	NA	A0A059T5G4	Listeria_phage	97.5	1.6e-86
WP_069011928.1|1286090_1288364_+	DNA primase	NA	R4IBW2	Listeria_phage	94.8	0.0e+00
WP_031669964.1|1288698_1289013_+	VRR-NUC domain-containing protein	NA	Q8W5V6	Listeria_phage	98.1	1.7e-52
WP_031659886.1|1289125_1289659_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	78.9	2.2e-76
WP_009915300.1|1289659_1289815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731655.1|1289876_1290104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009917712.1|1290116_1290542_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	100.0	8.0e-74
WP_031669127.1|1290639_1291383_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_026749920.1|1291842_1292169_+	hypothetical protein	NA	A0A059T5G5	Listeria_phage	98.1	8.3e-55
WP_009928009.1|1292168_1292483_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	99.0	3.8e-57
WP_061107421.1|1292531_1292888_+|terminase	P27 family phage terminase small subunit	terminase	A8AT94	Listeria_phage	99.0	2.0e-46
WP_061107420.1|1292884_1294528_+|terminase	terminase large subunit	terminase	A8AT95	Listeria_phage	98.7	0.0e+00
WP_069011925.1|1294539_1295670_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	98.7	2.3e-213
WP_061107162.1|1295666_1296464_+|protease	Clp protease ClpP	protease	A0A059T5F2	Listeria_phage	93.6	2.6e-134
WP_061107418.1|1296490_1297642_+|capsid	phage major capsid protein	capsid	A8AT98	Listeria_phage	93.0	2.7e-201
WP_023548922.1|1297648_1297819_+	hypothetical protein	NA	A8AT99	Listeria_phage	94.6	6.9e-21
WP_003731645.1|1297828_1298128_+	hypothetical protein	NA	A8ATA0	Listeria_phage	100.0	5.3e-48
WP_045552979.1|1298111_1298477_+	hypothetical protein	NA	A8ATA1	Listeria_phage	94.2	2.3e-61
WP_045552980.1|1298473_1298875_+	hypothetical protein	NA	A8ATA2	Listeria_phage	97.0	2.0e-66
WP_061107417.1|1298871_1299255_+	hypothetical protein	NA	A8ATA3	Listeria_phage	95.3	4.4e-63
WP_012581455.1|1299276_1299864_+|tail	phage tail protein	tail	A8ATA4	Listeria_phage	100.0	4.0e-108
WP_009917698.1|1299935_1300268_+	hypothetical protein	NA	A8ATA5	Listeria_phage	99.1	1.8e-52
WP_009917697.1|1300318_1300468_+	hypothetical protein	NA	A8ATA6	Listeria_phage	100.0	3.0e-20
WP_023553822.1|1304790_1306440_+|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	99.6	0.0e+00
WP_031669134.1|1306452_1308747_+|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	98.3	0.0e+00
WP_077600797.1|1308736_1309828_+	carbohydrate-binding protein CenC	NA	A0A059T7R4	Listeria_phage	93.4	2.2e-192
WP_003722523.1|1309866_1310232_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722522.1|1310244_1310526_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_033919168.1|1310525_1311371_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	95.8	2.6e-140
WP_060869024.1|1311527_1312430_+	ATP-binding protein	NA	J7KDG8	Streptococcus_phage	33.1	2.0e-37
WP_031667948.1|1312423_1312723_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_003723291.1|1312797_1313247_-	anti-CRISPR protein AcrIIA1	NA	Q9T196	Listeria_phage	94.6	1.3e-71
WP_003723290.1|1313251_1313515_-	anti-CRISPR protein AcrIIA4	NA	A0A2D0TCG7	unidentified_phage	100.0	1.9e-41
WP_069007859.1|1314027_1314261_+	hypothetical protein	NA	A8ATC5	Listeria_phage	96.1	3.1e-35
WP_069007858.1|1314908_1316267_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
1314527:1314548	attR	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_023548894.1|1316307_1316901_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_009914084.1|1317054_1317462_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_031674609.1|1317626_1318226_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.5	1.2e-30
WP_003723543.1|1318257_1318518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069007857.1|1318641_1320051_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-51
WP_003723545.1|1320078_1320342_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_003723546.1|1320509_1320986_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003723547.1|1321023_1321269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003732784.1|1321265_1322471_-	MFS transporter	NA	NA	NA	NA	NA
WP_003723549.1|1322675_1323335_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723550.1|1323376_1323571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723551.1|1323637_1324486_-	YitT family protein	NA	NA	NA	NA	NA
WP_003723553.1|1324816_1324954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003732787.1|1325104_1325818_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_031664857.1|1325848_1327495_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003723556.1|1327513_1328998_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003723557.1|1329113_1329566_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003723558.1|1329612_1330077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723559.1|1330265_1331186_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014931389.1|1331205_1332453_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	7.2e-107
WP_003723561.1|1332436_1333267_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	4.3e-47
WP_003732792.1|1333402_1334542_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014931390.1|1334622_1335018_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1335168_1335384_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014931391.1|1335502_1336036_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1336053_1336719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1336980_1337919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1338033_1339317_+	trigger factor	NA	NA	NA	NA	NA
WP_069007856.1|1339501_1340761_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.0e-145
WP_003723887.1|1340879_1341446_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723888.1|1341480_1342050_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1342151_1342694_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1342703_1343567_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_023548886.1|1343563_1344349_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723892.1|1344482_1345343_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_009924617.1|1345614_1347693_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.7	1.4e-107
WP_009924616.1|1347755_1349060_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_061387996.1|1350307_1351717_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	7.5e-44
>prophage 4
NZ_CP019623	Listeria monocytogenes strain 10-092876-1763 LM10 chromosome, complete genome	2940913	1878071	1886357	2940913		Synechococcus_phage(33.33%)	8	NA	NA
WP_031665594.1|1878071_1878638_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_031665593.1|1878634_1879684_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	9.2e-63
WP_031665592.1|1879702_1881130_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.9	1.4e-53
WP_031665591.1|1881114_1883334_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	1.7e-159
WP_003733240.1|1883326_1884010_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1884013_1884259_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014931516.1|1884270_1884984_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	37.8	8.8e-41
WP_003729814.1|1885064_1886357_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 5
NZ_CP019623	Listeria monocytogenes strain 10-092876-1763 LM10 chromosome, complete genome	2940913	2543270	2551114	2940913		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2543270_2544242_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|2544249_2545218_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_010990001.1|2545219_2546095_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	3.2e-08
WP_069007711.1|2546202_2547933_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	3.0e-175
WP_009930954.1|2547974_2549036_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_009924988.1|2549052_2550036_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	2.6e-51
WP_003722610.1|2550154_2551114_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
