The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019618	Listeria monocytogenes strain 10-092876-0731 LM5 chromosome, complete genome	2996793	101215	111247	2996793		Tupanvirus(33.33%)	7	NA	NA
WP_009924391.1|101215_102670_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	1.9e-50
WP_072215787.1|102697_103006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077607558.1|103184_104795_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.2e-45
WP_012951083.1|104852_105383_+	ADP-ribose-binding protein	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	3.4e-29
WP_003722118.1|105670_107137_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	8.0e-97
WP_003732117.1|107297_109070_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.1	6.3e-80
WP_012951084.1|109093_111247_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.1	6.7e-44
>prophage 2
NZ_CP019618	Listeria monocytogenes strain 10-092876-0731 LM5 chromosome, complete genome	2996793	1128409	1137962	2996793		Hokovirus(28.57%)	9	NA	NA
WP_003721506.1|1128409_1128793_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003732709.1|1128814_1129798_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
WP_010989660.1|1129812_1130826_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	7.9e-11
WP_003721509.1|1131034_1132525_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003727000.1|1132536_1133361_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_012951453.1|1133373_1133682_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003730540.1|1133741_1134146_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012951454.1|1134274_1135831_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	3.0e-17
WP_012951455.1|1136048_1137962_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.9	1.3e-59
>prophage 3
NZ_CP019618	Listeria monocytogenes strain 10-092876-0731 LM5 chromosome, complete genome	2996793	1259492	1341825	2996793	capsid,integrase,protease,terminase,holin,tail,portal,tRNA	Listeria_phage(76.67%)	103	1259376:1259397	1304120:1304141
1259376:1259397	attL	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_012951516.1|1259492_1260647_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	95.8	1.6e-209
WP_012951517.1|1260788_1261445_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_012951518.1|1261496_1261949_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	91.3	1.1e-78
WP_012951519.1|1261965_1262289_-	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	75.7	6.3e-39
WP_003730994.1|1262689_1262893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951520.1|1262959_1263151_+	helix-turn-helix transcriptional regulator	NA	Q8W5X9	Listeria_phage	84.1	1.6e-21
WP_003730996.1|1263172_1263415_+	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_003730997.1|1263417_1263603_+	hypothetical protein	NA	A8ATD3	Listeria_phage	98.4	3.7e-28
WP_012951521.1|1263837_1263990_+	hypothetical protein	NA	A8ATD4	Listeria_phage	70.0	3.6e-13
WP_012951522.1|1264355_1264598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951524.1|1265414_1265879_+	class I SAM-dependent methyltransferase	NA	A0A059T693	Listeria_phage	94.8	2.9e-85
WP_012951525.1|1265875_1266589_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.9	4.5e-130
WP_012951526.1|1266599_1267544_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	97.8	1.1e-176
WP_012951527.1|1267556_1268237_+	hypothetical protein	NA	A8ATD7	Listeria_phage	95.6	9.0e-120
WP_012951528.1|1268233_1268467_+	DUF1642 domain-containing protein	NA	B6D7L5	Listeria_phage	55.6	6.8e-11
WP_012951529.1|1268469_1268913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951530.1|1269105_1269585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951531.1|1269585_1270215_+	hypothetical protein	NA	A0A191KBJ8	Streptococcus_virus	58.4	1.1e-66
WP_012951532.1|1270233_1270467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951533.1|1270463_1270682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951534.1|1270651_1270843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731668.1|1271045_1271309_+	hypothetical protein	NA	Q8W5W6	Listeria_phage	67.1	8.8e-23
WP_003731667.1|1271311_1271485_+	hypothetical protein	NA	Q8W5W3	Listeria_phage	100.0	6.8e-24
WP_012951535.1|1271481_1271865_+	hypothetical protein	NA	A8ATE8	Listeria_phage	92.9	5.3e-61
WP_003731665.1|1271866_1272346_+	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
WP_012951536.1|1272365_1273055_+	AAA family ATPase	NA	R4IDY8	Listeria_phage	96.9	3.1e-128
WP_074471730.1|1273133_1274375_+	DEAD/DEAH box helicase	NA	A8ATF1	Listeria_phage	96.1	1.2e-213
WP_009918373.1|1274399_1274882_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	98.8	5.5e-87
WP_012951538.1|1274904_1277193_+	primase	NA	R4IBW2	Listeria_phage	95.4	0.0e+00
WP_012951539.1|1277526_1277844_+	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	89.3	7.3e-48
WP_003731659.1|1277845_1278058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951540.1|1278505_1279045_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	77.1	9.2e-75
WP_003731657.1|1279041_1279311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951541.1|1279339_1279489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009917712.1|1279530_1279956_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	100.0	8.0e-74
WP_012951542.1|1280053_1280797_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_014930130.1|1281265_1281592_+	hypothetical protein	NA	A0A059T5G5	Listeria_phage	100.0	2.2e-55
WP_009931610.1|1281591_1281906_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	5.0e-57
WP_012951543.1|1281955_1282312_+|terminase	P27 family phage terminase small subunit	terminase	A0A059T7Y1	Listeria_phage	98.0	2.0e-46
WP_077607566.1|1282308_1283949_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	98.9	0.0e+00
WP_009917707.1|1283958_1284348_-	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	39.8	3.7e-17
WP_012951545.1|1284398_1285529_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	99.5	2.8e-214
WP_012951546.1|1285525_1286242_+|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	59.0	9.3e-67
WP_012951547.1|1286268_1287420_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	99.5	3.1e-213
WP_012951548.1|1287426_1287597_+	hypothetical protein	NA	A0A059T7Y2	Listeria_phage	100.0	6.3e-22
WP_012951549.1|1287606_1287906_+	hypothetical protein	NA	A8ATA0	Listeria_phage	97.0	8.4e-46
WP_009934006.1|1287889_1288255_+	hypothetical protein	NA	A0A059T6F2	Listeria_phage	96.7	1.6e-62
WP_012951550.1|1288251_1288653_+	hypothetical protein	NA	A0A059T5F3	Listeria_phage	100.0	2.1e-68
WP_009931623.1|1288649_1289033_+	hypothetical protein	NA	A0A059T681	Listeria_phage	96.1	6.1e-65
WP_012951551.1|1289053_1289641_+|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	99.0	1.7e-106
WP_012951552.1|1289711_1290044_+	hypothetical protein	NA	A8ATA5	Listeria_phage	96.4	2.8e-50
WP_009914372.1|1290094_1290256_+	hypothetical protein	NA	A0A059T6F4	Listeria_phage	97.9	2.1e-19
WP_012951553.1|1290259_1295191_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	95.1	0.0e+00
WP_012951554.1|1295178_1296828_+|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	99.1	0.0e+00
WP_012951555.1|1296840_1299135_+|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	94.0	0.0e+00
WP_031644619.1|1299124_1300219_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	87.9	2.2e-184
WP_012951557.1|1300266_1300569_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.0	1.7e-38
WP_012951558.1|1300568_1300826_+|holin	phage holin	holin	A8ATB7	Listeria_phage	69.0	3.2e-25
WP_012951559.1|1300825_1301671_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	83.7	5.4e-130
WP_012951560.1|1301774_1302773_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_012951561.1|1302997_1303180_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	96.6	2.3e-22
WP_012951563.1|1303620_1303854_+	hypothetical protein	NA	A8ATC5	Listeria_phage	98.7	1.6e-36
WP_012951565.1|1304501_1305860_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
1304120:1304141	attR	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_012951566.1|1305900_1306494_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_009914084.1|1306647_1307055_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_009924169.1|1307219_1307819_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	5.8e-30
WP_003723543.1|1307850_1308111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989717.1|1308234_1309647_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-51
WP_003723545.1|1309671_1309935_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_003723546.1|1310102_1310579_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_012951567.1|1310616_1310862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951568.1|1310858_1312064_-	MFS transporter	NA	NA	NA	NA	NA
WP_003723549.1|1312268_1312928_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723550.1|1312969_1313164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723551.1|1313230_1314079_-	YitT family protein	NA	NA	NA	NA	NA
WP_003723553.1|1314410_1314548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009931701.1|1314698_1315412_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_012951570.1|1315442_1317089_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003723556.1|1317107_1318592_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003723557.1|1318707_1319160_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012951571.1|1319206_1319671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723559.1|1319859_1320780_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003723560.1|1320799_1322047_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	1.2e-106
WP_003723561.1|1322030_1322861_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	4.3e-47
WP_003723562.1|1322996_1324136_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1324216_1324612_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1324762_1324978_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989719.1|1325096_1325630_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1325647_1326313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1326574_1327513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1327627_1328911_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1329095_1330355_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723887.1|1330473_1331040_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_009924619.1|1331074_1331644_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1331745_1332288_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1332297_1333161_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|1333157_1333943_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723892.1|1334076_1334937_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_077607567.1|1335208_1337290_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	6.0e-106
WP_009924616.1|1337352_1338657_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009911635.1|1338939_1339842_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_003724001.1|1339862_1340402_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003732800.1|1340415_1341825_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	28.7	3.7e-43
>prophage 4
NZ_CP019618	Listeria monocytogenes strain 10-092876-0731 LM5 chromosome, complete genome	2996793	1922184	1930470	2996793		Synechococcus_phage(33.33%)	8	NA	NA
WP_003722243.1|1922184_1922751_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_012951771.1|1922747_1923797_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.5	4.6e-62
WP_003722245.1|1923815_1925243_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_012951772.1|1925227_1927447_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	5.0e-159
WP_003722247.1|1927439_1928123_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1928126_1928372_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012951773.1|1928383_1929097_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	1.2e-42
WP_003729814.1|1929177_1930470_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 5
NZ_CP019618	Listeria monocytogenes strain 10-092876-0731 LM5 chromosome, complete genome	2996793	2442914	2482145	2996793	holin,tail,terminase	Listeria_phage(98.15%)	58	NA	NA
WP_012951924.1|2442914_2443148_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	94.8	8.0e-36
WP_012951925.1|2443588_2443798_+	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	97.1	5.5e-28
WP_012951926.1|2443899_2444304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951927.1|2444305_2444734_+	transcriptional regulator	NA	A8ATJ2	Listeria_phage	87.3	3.9e-28
WP_012951928.1|2444745_2445243_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	90.9	4.9e-83
WP_003722520.1|2445517_2446291_+	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_012951929.1|2446331_2447177_-	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	92.6	1.4e-133
WP_003722522.1|2447176_2447458_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|2447470_2447836_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_012951930.1|2447874_2450037_-|tail	phage tail protein	tail	A8ATW1	Listeria_phage	98.8	0.0e+00
WP_012951931.1|2450049_2451618_-|tail	phage tail family protein	tail	A8ATW0	Listeria_phage	99.2	2.0e-303
WP_012951932.1|2451614_2456414_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	89.1	0.0e+00
WP_074046934.1|2456418_2456730_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	96.7	1.3e-41
WP_012951934.1|2456726_2457158_-	hypothetical protein	NA	A8ATV7	Listeria_phage	95.8	3.2e-70
WP_012951935.1|2457213_2457900_-	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	97.4	2.6e-114
WP_010991155.1|2457904_2458276_-	hypothetical protein	NA	A0A0B5CTY4	Listeria_phage	99.2	5.5e-63
WP_012951936.1|2458272_2458590_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	98.1	2.4e-51
WP_003733695.1|2458579_2458945_-	hypothetical protein	NA	A8ATV3	Listeria_phage	99.2	9.9e-65
WP_012951937.1|2458944_2459298_-	hypothetical protein	NA	A8ATV2	Listeria_phage	100.0	7.6e-62
WP_012951938.1|2459298_2459466_-	hypothetical protein	NA	A8ATV1	Listeria_phage	97.1	6.4e-11
WP_012951939.1|2459479_2460352_-	hypothetical protein	NA	A8ATV0	Listeria_phage	99.0	3.0e-160
WP_003744996.1|2460374_2460929_-	hypothetical protein	NA	A8ATU9	Listeria_phage	99.5	1.1e-88
WP_012951940.1|2461024_2462068_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	96.5	1.9e-193
WP_012951941.1|2462072_2463629_-	hypothetical protein	NA	A8ATU7	Listeria_phage	97.9	9.4e-298
WP_047934348.1|2463643_2464990_-|terminase	PBSX family phage terminase large subunit	terminase	A8ATU6	Listeria_phage	99.1	1.1e-262
WP_012951943.1|2464955_2465696_-	hypothetical protein	NA	A0A0B5CTX0	Listeria_phage	99.6	2.4e-134
WP_012951944.1|2465735_2465963_-	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_012951945.1|2466248_2466683_-	hypothetical protein	NA	A8AU03	Listeria_phage	97.2	1.6e-74
WP_012951946.1|2466823_2467207_-	DUF2481 family protein	NA	A0A0B5CYS3	Listeria_phage	96.1	5.7e-63
WP_012951947.1|2467210_2467615_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	89.6	1.9e-61
WP_031645468.1|2467559_2467742_-	hypothetical protein	NA	A8ASP6	Listeria_phage	81.0	2.9e-17
WP_012951948.1|2467769_2468147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951949.1|2468168_2468648_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	91.2	1.4e-74
WP_012951950.1|2468644_2469046_-	hypothetical protein	NA	A8ATZ6	Listeria_phage	75.9	1.4e-48
WP_012951951.1|2469042_2469402_-	hypothetical protein	NA	A0A059T801	Listeria_phage	92.0	6.6e-45
WP_031645470.1|2469423_2469654_-	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	73.8	1.1e-18
WP_012951953.1|2469789_2470320_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	95.5	8.4e-97
WP_012951954.1|2470316_2470604_-	hypothetical protein	NA	A0A059T7V3	Listeria_phage	88.4	1.7e-40
WP_012951955.1|2470600_2471584_-	phage replisome organizer N-terminal domain-containing protein	NA	A8ASN4	Listeria_phage	91.7	1.4e-166
WP_012951956.1|2471600_2472260_-	ERF family protein	NA	A8ASN3	Listeria_phage	94.1	5.3e-93
WP_012951957.1|2472265_2472742_-	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	100.0	9.5e-76
WP_003734953.1|2472738_2472933_-	hypothetical protein	NA	A0A059T6E8	Listeria_phage	100.0	1.6e-29
WP_003722564.1|2473238_2473427_-	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_012951958.1|2473535_2473751_-	hypothetical protein	NA	Q9T176	Listeria_phage	93.0	9.7e-28
WP_012951959.1|2473747_2474281_-	hypothetical protein	NA	A0A059T5F0	Listeria_phage	87.9	1.5e-77
WP_012951960.1|2474404_2475181_-	phage antirepressor KilAC domain-containing protein	NA	A0A0B5D0I2	Listeria_phage	99.2	9.6e-142
WP_003733684.1|2475244_2475442_+	hypothetical protein	NA	Q9T179	Listeria_phage	96.0	4.0e-20
WP_012951961.1|2475443_2475725_-	hypothetical protein	NA	A8ATX8	Listeria_phage	96.7	3.6e-38
WP_012951962.1|2475721_2475958_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	97.4	2.8e-36
WP_012951963.1|2476022_2476382_+	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	26.3	2.1e-06
WP_003733687.1|2476340_2476535_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_012951964.1|2476538_2476790_-	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	76.7	9.3e-22
WP_012951965.1|2476952_2477258_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	68.5	1.8e-27
WP_012951966.1|2477288_2477780_+	hypothetical protein	NA	A8ATX4	Listeria_phage	99.4	2.9e-91
WP_012951967.1|2477806_2478514_+	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	99.1	5.3e-123
WP_012951968.1|2478572_2479007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951969.1|2479211_2480726_+	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_012951970.1|2480786_2482145_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	99.8	1.1e-257
>prophage 6
NZ_CP019618	Listeria monocytogenes strain 10-092876-0731 LM5 chromosome, complete genome	2996793	2623370	2631211	2996793		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2623370_2624342_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_077607575.1|2624349_2625315_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	42.9	3.7e-66
WP_003722606.1|2625316_2626192_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_012952017.1|2626299_2628030_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	3.0e-175
WP_012952018.1|2628071_2629133_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_012952019.1|2629149_2630133_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	5.8e-51
WP_003722610.1|2630251_2631211_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 7
NZ_CP019618	Listeria monocytogenes strain 10-092876-0731 LM5 chromosome, complete genome	2996793	2869732	2876257	2996793	tail	Streptococcus_pyogenes_phage(33.33%)	10	NA	NA
WP_003734720.1|2869732_2870551_-|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
WP_012952081.1|2870547_2872416_-	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_012952082.1|2872402_2872807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721745.1|2872848_2873151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721744.1|2873198_2873711_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_012952083.1|2873723_2874113_-	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003732220.1|2874390_2874807_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_003732219.1|2874818_2875247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721740.1|2875463_2875799_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003721739.1|2875804_2876257_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
