The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019617	Listeria monocytogenes strain 10-092876-0055 LM4 chromosome, complete genome	2989685	123026	129551	2989685	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003721739.1|123026_123479_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|123484_123820_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003721741.1|124036_124465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003721742.1|124476_124893_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_003733902.1|125170_125560_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|125572_126085_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|126132_126435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020246385.1|126476_126881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003721747.1|126867_128736_+	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.3	1.7e-19
WP_003721748.1|128732_129551_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	4.2e-39
>prophage 2
NZ_CP019617	Listeria monocytogenes strain 10-092876-0055 LM4 chromosome, complete genome	2989685	1145198	1154156	2989685		Hokovirus(28.57%)	9	NA	NA
WP_003721506.1|1145198_1145582_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003721507.1|1145603_1146587_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.3	3.1e-12
WP_003721508.1|1146601_1147615_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	6.0e-11
WP_003721509.1|1147823_1149314_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003721510.1|1149325_1150150_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	2.2e-67
WP_003721511.1|1150162_1150471_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003721512.1|1150530_1150935_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014601274.1|1151063_1152620_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	3.9e-17
WP_003721514.1|1152752_1154156_+	SIR2 family protein	NA	Q38324	Lactococcus_phage	26.0	9.2e-18
>prophage 3
NZ_CP019617	Listeria monocytogenes strain 10-092876-0055 LM4 chromosome, complete genome	2989685	1286048	1339266	2989685	protease,tRNA	Bacillus_virus(21.43%)	49	NA	NA
WP_003723562.1|1286048_1287188_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1287268_1287664_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1287814_1288030_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003732794.1|1288148_1288682_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1288699_1289365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1289626_1290565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1290679_1291963_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1292148_1293408_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723887.1|1293526_1294093_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723888.1|1294127_1294697_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1294798_1295341_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1295350_1296214_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|1296210_1296996_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723892.1|1297129_1297990_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003732799.1|1298260_1300339_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	3.2e-107
WP_003724001.1|1301555_1302095_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003732800.1|1302108_1303518_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	28.7	3.7e-43
WP_003726695.1|1303538_1304318_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_003724129.1|1304420_1304840_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003724130.1|1304861_1305173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724131.1|1305175_1306048_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003724132.1|1306089_1306686_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003732802.1|1306843_1307251_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_003723731.1|1307431_1309399_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	6.7e-123
WP_003723732.1|1309395_1311855_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	1.1e-101
WP_003723733.1|1311937_1312405_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003723734.1|1312734_1314564_+	lmo1289 family class 1 internalin	NA	NA	NA	NA	NA
WP_003723735.1|1314895_1316698_+	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_003723737.1|1318106_1318805_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	32.4	1.3e-12
WP_003723738.1|1319037_1320714_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_003723739.1|1320839_1321757_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003719566.1|1321879_1322113_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_003733804.1|1322223_1323447_+	GTPase HflX	NA	NA	NA	NA	NA
WP_003723434.1|1323439_1324666_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003719570.1|1324869_1325238_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723435.1|1325308_1326643_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_003723442.1|1328193_1328433_+	YneF family protein	NA	NA	NA	NA	NA
WP_003723443.1|1328483_1329326_-	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_003723444.1|1329344_1330076_-	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	59.1	1.2e-80
WP_003723445.1|1330097_1330604_-	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	4.0e-56
WP_003723446.1|1330613_1331918_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	9.5e-134
WP_072217143.1|1331907_1333113_-	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	47.1	3.7e-92
WP_003723448.1|1333090_1333465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723449.1|1333757_1334486_+	UMP kinase	NA	NA	NA	NA	NA
WP_003723450.1|1334485_1335043_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003723451.1|1335272_1336031_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.4	1.1e-22
WP_003723452.1|1336044_1336833_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003723453.1|1336847_1337990_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003723454.1|1338003_1339266_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 4
NZ_CP019617	Listeria monocytogenes strain 10-092876-0055 LM4 chromosome, complete genome	2989685	1827404	1835690	2989685		Synechococcus_phage(33.33%)	8	NA	NA
WP_003722243.1|1827404_1827971_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_003722244.1|1827967_1829017_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.2	1.0e-61
WP_003722245.1|1829035_1830463_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_003722246.1|1830447_1832667_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.4	2.6e-160
WP_003722247.1|1832659_1833343_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1833346_1833592_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003722249.1|1833603_1834317_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.7	2.7e-42
WP_003722250.1|1834397_1835690_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	7.2e-17
>prophage 5
NZ_CP019617	Listeria monocytogenes strain 10-092876-0055 LM4 chromosome, complete genome	2989685	2348939	2389592	2989685	holin,tail,terminase	Listeria_phage(98.33%)	67	NA	NA
WP_031647214.1|2348939_2349173_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	96.1	1.6e-36
WP_003731277.1|2349474_2349708_+	hypothetical protein	NA	A8ATW9	Listeria_phage	100.0	4.3e-13
WP_003731276.1|2349739_2349991_+	hypothetical protein	NA	A8ATW8	Listeria_phage	100.0	2.0e-40
WP_003722518.1|2349991_2350441_+	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	100.0	2.4e-76
WP_003733661.1|2350465_2350963_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	100.0	3.8e-91
WP_003722520.1|2351237_2352011_+	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_077323971.1|2352051_2352897_-	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	94.3	5.9e-137
WP_003722522.1|2352896_2353178_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|2353190_2353556_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_012951930.1|2353594_2355757_-|tail	phage tail protein	tail	A8ATW1	Listeria_phage	98.8	0.0e+00
WP_077323972.1|2357339_2362139_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	86.5	0.0e+00
WP_077323973.1|2362143_2362485_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	80.2	2.0e-35
WP_031672313.1|2362481_2362913_-	hypothetical protein	NA	A8ATV7	Listeria_phage	95.8	2.4e-70
WP_003745009.1|2362968_2363655_-	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	99.6	3.6e-116
WP_031645293.1|2363659_2364031_-	hypothetical protein	NA	A8ATV5	Listeria_phage	99.2	3.2e-63
WP_003733696.1|2364027_2364345_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	96.2	4.6e-50
WP_003733695.1|2364334_2364700_-	hypothetical protein	NA	A8ATV3	Listeria_phage	99.2	9.9e-65
WP_003723785.1|2364699_2365053_-	hypothetical protein	NA	A8ATV2	Listeria_phage	99.1	8.4e-61
WP_003725067.1|2365053_2365209_-	hypothetical protein	NA	A0A0B5CYK6	Listeria_phage	98.0	1.0e-18
WP_003725068.1|2365222_2366095_-	hypothetical protein	NA	A0A0B5CTX8	Listeria_phage	99.7	4.5e-164
WP_031641740.1|2366117_2366672_-	hypothetical protein	NA	A0A0B5CTR8	Listeria_phage	100.0	2.6e-88
WP_003719493.1|2366767_2367811_-	gp4	NA	A0A0B5D111	Listeria_phage	98.3	9.7e-198
WP_014601502.1|2367815_2369372_-	hypothetical protein	NA	A0A0B5D0A6	Listeria_phage	98.8	7.7e-300
WP_188317559.1|2369386_2370733_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	98.9	1.5e-262
WP_077323975.1|2370698_2371439_-	TerS	NA	A0A0B5CTX0	Listeria_phage	98.0	2.3e-132
WP_012951944.1|2371478_2371706_-	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_038409832.1|2371966_2372539_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0B5D145	Listeria_phage	87.9	2.8e-90
WP_003722548.1|2372626_2372782_-	hypothetical protein	NA	A0A0B5D186	Listeria_phage	96.1	3.3e-22
WP_077323976.1|2372800_2373199_-	DUF2481 family protein	NA	A8ASP8	Listeria_phage	44.3	2.4e-19
WP_038409830.1|2373202_2373607_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	84.3	3.8e-57
WP_038409828.1|2373551_2373734_-	hypothetical protein	NA	A8ASP6	Listeria_phage	79.4	3.8e-17
WP_077323977.1|2373752_2374235_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	91.9	5.7e-76
WP_077323978.1|2374231_2374492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731706.1|2374491_2374674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731705.1|2374777_2375050_-	hypothetical protein	NA	A8ATE2	Listeria_phage	100.0	2.0e-46
WP_003731704.1|2375046_2375376_-	hypothetical protein	NA	A8ATE1	Listeria_phage	100.0	1.1e-57
WP_003731703.1|2375376_2375553_-	hypothetical protein	NA	A0A076G7F4	Listeria_phage	87.9	1.9e-21
WP_003731702.1|2375656_2376190_-	pentapeptide repeat-containing protein	NA	A0A060AFJ6	Listeria_phage	85.2	2.2e-44
WP_003731701.1|2376186_2376360_-	hypothetical protein	NA	A0A059T7N2	Listeria_phage	93.0	6.2e-25
WP_077323979.1|2376363_2376762_-	hypothetical protein	NA	R4ICD6	Listeria_phage	98.7	1.7e-38
WP_077323980.1|2376765_2376975_-	hypothetical protein	NA	A0A059T6G5	Listeria_phage	95.7	2.9e-29
WP_003731698.1|2376974_2377253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010991168.1|2377268_2377415_-	hypothetical protein	NA	A8ATZ0	Listeria_phage	97.9	2.3e-20
WP_077323981.1|2377411_2377789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077323982.1|2377801_2378326_-	sugar-phosphate nucleotidyltransferase	NA	A0A059T5F9	Listeria_phage	88.5	1.1e-88
WP_023559383.1|2378336_2378543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077323983.1|2378539_2378791_-	hypothetical protein	NA	Q8W5X5	Listeria_phage	92.8	2.8e-34
WP_077323984.1|2378787_2379720_-	DnaD domain-containing protein	NA	A8ATY7	Listeria_phage	90.6	3.0e-150
WP_003731807.1|2379739_2380555_-	recombinase RecT	NA	A8ATY6	Listeria_phage	98.5	1.0e-149
WP_003731808.1|2380554_2381514_-	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	98.4	1.5e-176
WP_010989962.1|2381745_2381934_-	hypothetical protein	NA	Q9T175	Listeria_phage	79.0	2.0e-21
WP_003731810.1|2382041_2382278_-	DUF771 domain-containing protein	NA	A8ATY2	Listeria_phage	100.0	1.9e-40
WP_061092555.1|2382284_2382809_-	hypothetical protein	NA	A8ATY1	Listeria_phage	98.3	9.2e-88
WP_003733683.1|2383140_2383917_-	phage antirepressor Ant	NA	A0A0B5D0I2	Listeria_phage	97.7	6.9e-140
WP_010990193.1|2383980_2384223_+	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	98.8	6.8e-38
WP_003727748.1|2384215_2384377_-	hypothetical protein	NA	A0A059T7X7	Listeria_phage	98.1	1.2e-19
WP_077323985.1|2384408_2384690_-	hypothetical protein	NA	A8ATX8	Listeria_phage	97.8	6.1e-38
WP_077323986.1|2384715_2385000_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	84.0	3.8e-40
WP_003733687.1|2385011_2385206_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_003731220.1|2385209_2385461_-	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	100.0	7.6e-40
WP_026750223.1|2385609_2385918_+	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	99.0	2.7e-47
WP_012951966.1|2385948_2386440_+	hypothetical protein	NA	A8ATX4	Listeria_phage	99.4	2.9e-91
WP_003727739.1|2386462_2386681_+	zinc-ribbon domain-containing protein	NA	A0A059T6E3	Listeria_phage	100.0	5.4e-34
WP_003724017.1|2386695_2387301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046377505.1|2387364_2388723_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	99.1	2.7e-256
WP_077323987.1|2388713_2389190_+	competence protein ComK	NA	NA	NA	NA	NA
WP_003739618.1|2389244_2389592_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 6
NZ_CP019617	Listeria monocytogenes strain 10-092876-0055 LM4 chromosome, complete genome	2989685	2541495	2549339	2989685		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2541495_2542467_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|2542474_2543443_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_003722606.1|2543444_2544320_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003722607.1|2544427_2546158_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.2	7.8e-176
WP_003734087.1|2546199_2547261_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_003722609.1|2547277_2548261_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	36.9	2.2e-50
WP_003722610.1|2548379_2549339_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 7
NZ_CP019617	Listeria monocytogenes strain 10-092876-0055 LM4 chromosome, complete genome	2989685	2635798	2707845	2989685	tail,integrase,terminase,protease,holin,tRNA	Listeria_phage(88.14%)	90	2667629:2667678	2707932:2707981
WP_003723609.1|2635798_2637469_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003723610.1|2637465_2637915_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003723611.1|2637992_2638646_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003723612.1|2638719_2638905_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003723613.1|2638939_2640262_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.2	2.6e-30
WP_003723614.1|2640276_2641113_-	lipoyl-[GcvH]:protein N-lipoyltransferase	NA	NA	NA	NA	NA
WP_003723615.1|2641429_2641630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723616.1|2641651_2641975_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003734106.1|2642129_2643791_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003723619.1|2643926_2644541_-	SdpI family protein	NA	NA	NA	NA	NA
WP_003723620.1|2644564_2645197_-	nicotinamidase	NA	NA	NA	NA	NA
WP_003723621.1|2645197_2645722_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_003733266.1|2645724_2646723_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003723623.1|2646819_2647092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723624.1|2647140_2648052_-	cation transporter	NA	NA	NA	NA	NA
WP_003723275.1|2648177_2652770_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003733264.1|2652990_2653818_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003733263.1|2653932_2654808_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003723278.1|2654818_2655112_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003723279.1|2655144_2655306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723280.1|2655374_2656043_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.0	5.0e-38
WP_003723281.1|2656042_2657131_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003723282.1|2657209_2658589_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	47.1	2.6e-57
WP_003723283.1|2658585_2659263_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	48.4	2.6e-58
WP_003723284.1|2659309_2660095_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_003723285.1|2660156_2660633_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_003723286.1|2660632_2663620_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_003723287.1|2664117_2664960_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_003723288.1|2665009_2666491_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003723289.1|2666591_2667479_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2667629:2667678	attL	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
WP_003731277.1|2668102_2668336_+	hypothetical protein	NA	A8ATW9	Listeria_phage	100.0	4.3e-13
WP_003731276.1|2668367_2668619_+	hypothetical protein	NA	A8ATW8	Listeria_phage	100.0	2.0e-40
WP_003722518.1|2668619_2669069_+	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	100.0	2.4e-76
WP_003733661.1|2669093_2669591_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	100.0	3.8e-91
WP_003722520.1|2669865_2670639_+	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_003733663.1|2670679_2671525_-	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	94.7	2.7e-137
WP_003722522.1|2671524_2671806_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|2671818_2672184_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_023553771.1|2672222_2674388_-|tail	phage tail protein	tail	A8ATW1	Listeria_phage	94.3	0.0e+00
WP_003733727.1|2674400_2675969_-|tail	phage tail family protein	tail	A8ATW0	Listeria_phage	99.2	3.1e-304
WP_077323991.1|2675965_2680765_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	89.1	0.0e+00
WP_077286899.1|2680769_2681081_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	97.8	3.4e-42
WP_003733698.1|2681077_2681509_-	hypothetical protein	NA	A8ATV7	Listeria_phage	97.9	4.0e-73
WP_003733697.1|2681564_2682254_-	Ig domain-containing protein	NA	A8ATV6	Listeria_phage	85.6	2.8e-100
WP_003725064.1|2682258_2682630_-	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_003733696.1|2682626_2682944_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	96.2	4.6e-50
WP_003733695.1|2682933_2683299_-	hypothetical protein	NA	A8ATV3	Listeria_phage	99.2	9.9e-65
WP_003723785.1|2683298_2683652_-	hypothetical protein	NA	A8ATV2	Listeria_phage	99.1	8.4e-61
WP_003725067.1|2683652_2683808_-	hypothetical protein	NA	A0A0B5CYK6	Listeria_phage	98.0	1.0e-18
WP_003725068.1|2683821_2684694_-	hypothetical protein	NA	A0A0B5CTX8	Listeria_phage	99.7	4.5e-164
WP_031641740.1|2684716_2685271_-	hypothetical protein	NA	A0A0B5CTR8	Listeria_phage	100.0	2.6e-88
WP_003719493.1|2685366_2686410_-	gp4	NA	A0A0B5D111	Listeria_phage	98.3	9.7e-198
WP_014601502.1|2686414_2687971_-	hypothetical protein	NA	A0A0B5D0A6	Listeria_phage	98.8	7.7e-300
WP_061664743.1|2687985_2689305_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	88.7	2.1e-234
WP_031641733.1|2689243_2690029_-	hypothetical protein	NA	A0A0B5CTX0	Listeria_phage	95.9	8.0e-128
WP_012951944.1|2690068_2690296_-	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_031670269.1|2690377_2691010_-	hypothetical protein	NA	A8AU05	Listeria_phage	99.0	4.0e-114
WP_038409832.1|2691167_2691740_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0B5D145	Listeria_phage	87.9	2.8e-90
WP_003722548.1|2691827_2691983_-	hypothetical protein	NA	A0A0B5D186	Listeria_phage	96.1	3.3e-22
WP_031645285.1|2692001_2692394_-	DUF2481 family protein	NA	A8ASP8	Listeria_phage	45.0	8.0e-20
WP_038409830.1|2692397_2692802_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	84.3	3.8e-57
WP_038409828.1|2692746_2692929_-	hypothetical protein	NA	A8ASP6	Listeria_phage	79.4	3.8e-17
WP_023552462.1|2692947_2693430_-	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	66.9	1.1e-52
WP_023552463.1|2693426_2693708_-	hypothetical protein	NA	R4IBL7	Listeria_phage	92.7	7.5e-20
WP_003747326.1|2693886_2694348_-	hypothetical protein	NA	D9J0I6	Brochothrix_phage	30.6	1.7e-13
WP_003747324.1|2694344_2694512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003747322.1|2694502_2694763_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	65.3	3.1e-20
WP_039388669.1|2694759_2695026_-	hypothetical protein	NA	R4IBL5	Listeria_phage	84.9	1.1e-33
WP_096813853.1|2695022_2695670_-	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	35.9	3.1e-21
WP_003731843.1|2695666_2695882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731842.1|2695893_2696061_-	hypothetical protein	NA	A8ASN5	Listeria_phage	80.0	9.2e-18
WP_023553782.1|2696073_2696604_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	86.4	3.5e-87
WP_003733679.1|2696600_2697515_-	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	84.9	8.4e-129
WP_003723965.1|2697552_2698464_-	recombinase RecT	NA	NA	NA	NA	NA
WP_003723967.1|2698456_2699968_-	hypothetical protein	NA	A0A2I7SC81	Paenibacillus_phage	36.2	6.1e-76
WP_003722564.1|2700200_2700389_-	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_003733681.1|2700491_2700698_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003733682.1|2700687_2701218_-	hypothetical protein	NA	A0A0B5D173	Listeria_phage	89.6	2.7e-79
WP_003733683.1|2701341_2702118_-	phage antirepressor Ant	NA	A0A0B5D0I2	Listeria_phage	97.7	6.9e-140
WP_003733684.1|2702181_2702379_+	hypothetical protein	NA	Q9T179	Listeria_phage	96.0	4.0e-20
WP_003722567.1|2702380_2702662_-	hypothetical protein	NA	A8ATX8	Listeria_phage	95.7	1.8e-37
WP_003733686.1|2702687_2702972_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	85.1	4.5e-41
WP_003733687.1|2702983_2703178_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_003733688.1|2703198_2703408_-	helix-turn-helix domain-containing protein	NA	A0A0B5D0D3	Listeria_phage	95.6	3.5e-30
WP_003724014.1|2703573_2703996_+	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	98.6	7.7e-69
WP_003724015.1|2704011_2704437_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0B5CTZ7	Listeria_phage	100.0	2.2e-76
WP_003724016.1|2704451_2705159_+	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	100.0	2.8e-124
WP_077323992.1|2705217_2705919_+	hypothetical protein	NA	A0A0B5D125	Listeria_phage	87.1	1.4e-88
WP_021496297.1|2705939_2706620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068996271.1|2706681_2707845_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	31.0	5.8e-50
2707932:2707981	attR	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
