The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019615	Listeria monocytogenes strain 10-092876-0168 chromosome, complete genome	3072093	285895	325153	3072093	capsid,terminase,holin,tail,integrase	Listeria_phage(94.34%)	58	285759:285808	325578:325627
285759:285808	attL	CTTCCATGGTAAGGAAGGGGTCGTCGGTTCAAATCCGACAAGTGGCTTAA	NA	NA	NA	NA
WP_003724018.1|285895_287059_-|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	31.2	4.4e-50
WP_003724017.1|287121_287727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003724016.1|287785_288493_-	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	100.0	2.8e-124
WP_003724015.1|288507_288933_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0B5CTZ7	Listeria_phage	100.0	2.2e-76
WP_003724014.1|288948_289371_-	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	98.6	7.7e-69
WP_003733688.1|289536_289746_+	helix-turn-helix domain-containing protein	NA	A0A0B5D0D3	Listeria_phage	95.6	3.5e-30
WP_003733687.1|289766_289961_+	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_003733686.1|289972_290257_+	hypothetical protein	NA	A0A0B5D168	Listeria_phage	85.1	4.5e-41
WP_003722567.1|290282_290564_+	hypothetical protein	NA	A8ATX8	Listeria_phage	95.7	1.8e-37
WP_003733684.1|290565_290763_-	hypothetical protein	NA	Q9T179	Listeria_phage	96.0	4.0e-20
WP_003733683.1|290826_291603_+	phage antirepressor Ant	NA	A0A0B5D0I2	Listeria_phage	97.7	6.9e-140
WP_003733682.1|291726_292257_+	hypothetical protein	NA	A0A0B5D173	Listeria_phage	89.6	2.7e-79
WP_003733681.1|292246_292453_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003722564.1|292555_292744_+	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_003723967.1|292976_294488_+	hypothetical protein	NA	A0A2I7SC81	Paenibacillus_phage	36.2	6.1e-76
WP_077625311.1|294480_295392_+	recombinase RecT	NA	NA	NA	NA	NA
WP_077625312.1|295429_296335_+	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	93.0	2.0e-143
WP_003723963.1|296338_296536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727760.1|296842_297823_+	DNA (cytosine-5-)-methyltransferase	NA	D2IZY5	Enterococcus_phage	55.6	9.1e-97
WP_077625314.1|297819_298359_+	DUF1642 domain-containing protein	NA	A0A059T7S4	Listeria_phage	65.0	3.0e-57
WP_077323777.1|298351_298645_+	hypothetical protein	NA	A8ATM4	Listeria_phage	83.5	2.0e-36
WP_020830814.1|298751_299039_+	hypothetical protein	NA	R4IBL5	Listeria_phage	60.5	7.4e-23
WP_020830815.1|299035_299314_+	DUF1642 domain-containing protein	NA	R4IBV9	Listeria_phage	53.3	9.6e-20
WP_070754240.1|299310_299712_+	hypothetical protein	NA	A0A059T6C9	Listeria_phage	78.9	1.0e-54
WP_070754238.1|299708_299987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070754236.1|299986_300469_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	95.6	4.6e-78
WP_015967175.1|300500_300806_+	hypothetical protein	NA	A8ATZ8	Listeria_phage	100.0	1.7e-46
WP_014601286.1|300802_300943_+	BH0509 family protein	NA	A8ATZ9	Listeria_phage	100.0	2.6e-18
WP_003769966.1|300908_301313_+	endodeoxyribonuclease	NA	A8AU00	Listeria_phage	100.0	5.4e-72
WP_015967177.1|301441_301606_+	hypothetical protein	NA	A8AU02	Listeria_phage	100.0	3.9e-21
WP_015967178.1|301624_302059_+	hypothetical protein	NA	A8AU03	Listeria_phage	100.0	5.1e-76
WP_015987428.1|302240_302873_+	hypothetical protein	NA	A8AU05	Listeria_phage	100.0	1.1e-114
WP_012951944.1|302953_303181_+	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_015987406.1|303220_303961_+	hypothetical protein	NA	A8ATU5	Listeria_phage	100.0	3.7e-135
WP_047933366.1|303926_305273_+|terminase	PBSX family phage terminase large subunit	terminase	A8ATU6	Listeria_phage	99.5	5.9e-264
WP_015987416.1|305287_306844_+	hypothetical protein	NA	A8ATU7	Listeria_phage	100.0	4.8e-302
WP_077625315.1|306848_307889_+|capsid	minor capsid protein	capsid	A8ATU8	Listeria_phage	98.6	4.3e-198
WP_015987425.1|307984_308539_+	hypothetical protein	NA	A8ATU9	Listeria_phage	100.0	2.3e-89
WP_015987427.1|308561_309434_+	F420-dependent oxidoreductase	NA	A8ATV0	Listeria_phage	100.0	1.2e-161
WP_172425835.1|309447_309615_+	hypothetical protein	NA	A8ATV1	Listeria_phage	100.0	1.7e-11
WP_012951937.1|309615_309969_+	hypothetical protein	NA	A8ATV2	Listeria_phage	100.0	7.6e-62
WP_015987430.1|309968_310334_+	hypothetical protein	NA	A8ATV3	Listeria_phage	100.0	4.4e-65
WP_015987407.1|310323_310641_+	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	100.0	9.9e-53
WP_003725064.1|310637_311009_+	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_015987408.1|311013_311700_+	Ig domain-containing protein	NA	A8ATV6	Listeria_phage	100.0	9.4e-117
WP_077625316.1|311755_312187_+	hypothetical protein	NA	A8ATV7	Listeria_phage	99.3	2.1e-74
WP_072225507.1|312183_312495_+	hypothetical protein	NA	A8ATV8	Listeria_phage	98.9	1.2e-42
WP_077625317.1|312499_317290_+|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	96.3	0.0e+00
WP_077625318.1|317286_318855_+|tail	phage tail family protein	tail	A8ATW0	Listeria_phage	99.4	1.4e-304
WP_077625319.1|318867_321033_+|tail	phage tail protein	tail	A8ATW1	Listeria_phage	94.0	0.0e+00
WP_003722523.1|321071_321437_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722522.1|321449_321731_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003733663.1|321730_322576_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	94.7	2.7e-137
WP_003722520.1|322616_323390_-	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_003733661.1|323664_324162_-	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	100.0	3.8e-91
WP_003722518.1|324186_324636_-	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	100.0	2.4e-76
WP_003731276.1|324636_324888_-	hypothetical protein	NA	A8ATW8	Listeria_phage	100.0	2.0e-40
WP_003731277.1|324919_325153_-	hypothetical protein	NA	A8ATW9	Listeria_phage	100.0	4.3e-13
325578:325627	attR	CTTCCATGGTAAGGAAGGGGTCGTCGGTTCAAATCCGACAAGTGGCTTAA	NA	NA	NA	NA
>prophage 2
NZ_CP019615	Listeria monocytogenes strain 10-092876-0168 chromosome, complete genome	3072093	451953	459795	3072093		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722610.1|451953_452913_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
WP_009918601.1|453029_454013_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	3.1e-52
WP_009918600.1|454029_455091_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_003725409.1|455132_456863_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	9.5e-174
WP_003722606.1|456970_457846_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003731212.1|457847_458816_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003725407.1|458823_459795_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
>prophage 3
NZ_CP019615	Listeria monocytogenes strain 10-092876-0168 chromosome, complete genome	3072093	609016	648474	3072093	terminase,capsid,holin,plate,portal,tail	Listeria_phage(93.1%)	66	NA	NA
WP_003739618.1|609016_609364_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
WP_003733645.1|609418_609895_-	competence protein ComK	NA	NA	NA	NA	NA
WP_003733644.1|609885_611244_-	recombinase family protein	NA	Q8LTD8	Listeria_phage	98.5	2.5e-254
WP_003749255.1|611420_612194_-	DUF1829 domain-containing protein	NA	NA	NA	NA	NA
WP_003749254.1|612213_612669_-	hypothetical protein	NA	Q6SEA3	Lactobacillus_prophage	39.0	1.9e-17
WP_077625325.1|612719_613370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582373.1|613425_613593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031669386.1|613748_614225_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	80.3	4.5e-57
WP_012582375.1|614387_614621_+	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	95.9	1.6e-31
WP_003770002.1|614641_614827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052197039.1|614786_615098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003735007.1|615115_615310_+	hypothetical protein	NA	A0A059T6E5	Listeria_phage	100.0	1.3e-26
WP_003769996.1|615321_615606_+	hypothetical protein	NA	A0A0B5D168	Listeria_phage	98.9	1.6e-46
WP_003733634.1|615645_615882_+	hypothetical protein	NA	A0A059T5E9	Listeria_phage	100.0	3.3e-37
WP_069007280.1|615878_616160_+	hypothetical protein	NA	Q9T180	Listeria_phage	96.8	6.5e-40
WP_003727748.1|616191_616353_+	hypothetical protein	NA	A0A059T7X7	Listeria_phage	98.1	1.2e-19
WP_025370647.1|616345_616588_-	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	98.8	1.5e-37
WP_003747301.1|616651_617425_+	phage repressor protein/antirepressor Ant	NA	A8ATY0	Listeria_phage	99.6	2.4e-140
WP_072239139.1|617546_618080_+	hypothetical protein	NA	Q9T177	Listeria_phage	89.8	3.1e-83
WP_014601517.1|618076_618292_+	hypothetical protein	NA	Q9T176	Listeria_phage	69.0	6.7e-21
WP_072239141.1|618399_618588_+	hypothetical protein	NA	Q9T175	Listeria_phage	74.2	6.5e-20
WP_003747308.1|618889_619084_+	hypothetical protein	NA	A0A059T6E8	Listeria_phage	96.9	6.0e-29
WP_003747311.1|619080_619557_+	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	93.0	7.1e-71
WP_003769987.1|619561_620200_+	ERF family protein	NA	A8ASN3	Listeria_phage	74.8	8.0e-78
WP_077625326.1|620213_621128_+	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	89.8	1.5e-138
WP_003723963.1|621131_621329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727760.1|621635_622616_+	DNA (cytosine-5-)-methyltransferase	NA	D2IZY5	Enterococcus_phage	55.6	9.1e-97
WP_077625314.1|622612_623152_+	DUF1642 domain-containing protein	NA	A0A059T7S4	Listeria_phage	65.0	3.0e-57
WP_077323777.1|623144_623438_+	hypothetical protein	NA	A8ATM4	Listeria_phage	83.5	2.0e-36
WP_020830814.1|623544_623832_+	hypothetical protein	NA	R4IBL5	Listeria_phage	60.5	7.4e-23
WP_020830815.1|623828_624107_+	DUF1642 domain-containing protein	NA	R4IBV9	Listeria_phage	53.3	9.6e-20
WP_070754240.1|624103_624505_+	hypothetical protein	NA	A0A059T6C9	Listeria_phage	78.9	1.0e-54
WP_070754238.1|624501_624780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070754236.1|624779_625262_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	95.6	4.6e-78
WP_015967175.1|625293_625599_+	hypothetical protein	NA	A8ATZ8	Listeria_phage	100.0	1.7e-46
WP_014601286.1|625595_625736_+	BH0509 family protein	NA	A8ATZ9	Listeria_phage	100.0	2.6e-18
WP_003769966.1|625701_626106_+	endodeoxyribonuclease	NA	A8AU00	Listeria_phage	100.0	5.4e-72
WP_015967177.1|626234_626399_+	hypothetical protein	NA	A8AU02	Listeria_phage	100.0	3.9e-21
WP_015967178.1|626417_626852_+	hypothetical protein	NA	A8AU03	Listeria_phage	100.0	5.1e-76
WP_039120307.1|627793_628336_+|terminase	terminase small subunit	terminase	A0A0B5CU16	Listeria_phage	95.5	4.9e-84
WP_077625380.1|628304_629636_+|terminase	PBSX family phage terminase large subunit	terminase	A8ASJ2	Listeria_phage	93.5	2.9e-247
WP_077625328.1|629648_631139_+|portal	phage portal protein	portal	Q9T1C0	Listeria_phage	84.5	2.5e-239
WP_077625329.1|631144_632284_+|capsid	phage minor capsid protein	capsid	A0A059T7W2	Listeria_phage	93.1	2.6e-196
WP_061108341.1|632362_632953_+	phage scaffolding protein	NA	Q9T1B8	Listeria_phage	88.6	1.3e-74
WP_003769954.1|632952_633954_+	hypothetical protein	NA	A0A059T6D4	Listeria_phage	97.6	1.1e-182
WP_061108342.1|633971_634367_+	hypothetical protein	NA	A0A059T5E3	Listeria_phage	90.8	2.3e-59
WP_003727786.1|634366_634729_+	hypothetical protein	NA	A0A0B5D151	Listeria_phage	95.8	8.6e-61
WP_003727787.1|634728_635067_+|capsid	minor capsid protein	capsid	Q9T1B3	Listeria_phage	100.0	2.2e-58
WP_003727788.1|635066_635474_+	hypothetical protein	NA	Q9T1B2	Listeria_phage	98.5	9.0e-67
WP_003769949.1|635476_635911_+|tail	tail protein	tail	Q9T1B1	Listeria_phage	98.6	6.0e-77
WP_012582410.1|635933_636173_+	Ig-like domain-containing protein	NA	A0A059T5E4	Listeria_phage	75.9	5.2e-22
WP_003769943.1|636227_636650_+|tail	phage tail assembly chaperone	tail	Q9T1A9	Listeria_phage	97.9	5.9e-69
WP_003735024.1|636655_637255_+	bacteriophage Gp15 family protein	NA	A0A0B5CTW0	Listeria_phage	72.0	1.9e-76
WP_077625330.1|637265_640337_+	tape measure protein	NA	Q9T1A7	Listeria_phage	93.4	1.2e-62
WP_077310940.1|640338_641157_+|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	91.2	8.8e-146
WP_077310942.1|641165_642191_+|tail	phage tail protein	tail	Q9T1A5	Listeria_phage	88.3	6.2e-181
WP_009931500.1|642191_643220_+	hypothetical protein	NA	Q9T1A4	Listeria_phage	98.8	2.5e-190
WP_039120293.1|643219_644293_+|plate	phage baseplate upper protein	plate	Q9T1A3	Listeria_phage	98.9	7.2e-196
WP_003722525.1|644304_644622_+	hypothetical protein	NA	Q9T1A2	Listeria_phage	100.0	6.2e-55
WP_003722524.1|644626_644785_+	hypothetical protein	NA	Q9T1A1	Listeria_phage	100.0	6.0e-19
WP_039177480.1|644825_645128_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	94.1	2.7e-39
WP_003733521.1|645127_645394_+|holin	phage holin	holin	A0A059T684	Listeria_phage	93.1	9.8e-38
WP_077625331.1|645393_646239_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	90.8	6.8e-133
WP_012951560.1|646341_647340_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_003733518.1|647545_648046_-	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	71.8	1.4e-64
WP_003733517.1|648042_648474_-	hypothetical protein	NA	A8ATJ2	Listeria_phage	81.7	4.1e-25
>prophage 4
NZ_CP019615	Listeria monocytogenes strain 10-092876-0168 chromosome, complete genome	3072093	1176188	1184474	3072093		Prochlorococcus_phage(33.33%)	8	NA	NA
WP_003726215.1|1176188_1177481_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
WP_003734637.1|1177561_1178275_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	6.7e-41
WP_003722248.1|1178286_1178532_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003726212.1|1178535_1179219_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_009918191.1|1179211_1181431_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
WP_003722245.1|1181415_1182843_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_003726210.1|1182861_1183911_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003731569.1|1183907_1184474_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	38.5	2.8e-26
>prophage 5
NZ_CP019615	Listeria monocytogenes strain 10-092876-0168 chromosome, complete genome	3072093	1673361	1847005	3072093	protease,holin,terminase,capsid,tRNA,plate,portal,tail,integrase,head	Listeria_phage(81.16%)	215	1803063:1803086	1847023:1847046
WP_003726416.1|1673361_1675068_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003726415.1|1675108_1676371_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003726414.1|1676384_1677527_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003727496.1|1677541_1678330_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003727497.1|1678343_1679102_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	4.4e-22
WP_003723450.1|1679332_1679890_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003723449.1|1679889_1680618_-	UMP kinase	NA	NA	NA	NA	NA
WP_003727498.1|1680910_1681285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012681273.1|1681262_1682468_+	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	46.6	7.0e-91
WP_003731336.1|1682457_1683762_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	1.2e-133
WP_003726669.1|1683771_1684278_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	1.4e-56
WP_003726667.1|1685080_1685320_-	YneF family protein	NA	NA	NA	NA	NA
WP_003734516.1|1685540_1687535_-	transketolase	NA	NA	NA	NA	NA
WP_003726567.1|1687681_1687909_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003727502.1|1688002_1688332_-	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003723438.1|1688487_1689102_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_003727503.1|1689132_1689657_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077398075.1|1689690_1689870_-	hypothetical protein	NA	A0A2H4PQU3	Staphylococcus_phage	77.1	5.6e-13
WP_003723435.1|1690413_1691748_-	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_003719570.1|1691818_1692187_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003727505.1|1692388_1693615_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_012681271.1|1693607_1694831_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003719566.1|1694941_1695175_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_003727506.1|1695296_1696214_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003723738.1|1696340_1698017_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_003726657.1|1698249_1698948_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	31.9	6.4e-12
WP_003727507.1|1699160_1701047_+	peptidoglycan O-acetyltransferase OatA	NA	B5WZU0	Pseudomonas_phage	32.2	3.8e-43
WP_009917681.1|1701079_1702900_-	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_003726814.1|1703527_1703995_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003727509.1|1704077_1706537_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.8	1.1e-101
WP_003727510.1|1706533_1708501_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	5.1e-123
WP_003727511.1|1708681_1709089_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_003726698.1|1709246_1709843_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003726697.1|1709884_1710757_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003724130.1|1710759_1711071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003727513.1|1711093_1711513_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003726695.1|1711615_1712395_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_003727514.1|1712415_1713825_-|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	7.5e-44
WP_003724001.1|1713838_1714378_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003731303.1|1714398_1715301_-	tyrosine recombinase XerC	NA	A0A142K7N4	Mycobacterium_phage	29.5	1.8e-14
WP_003727516.1|1715583_1716888_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003727517.1|1716950_1719029_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	5.4e-107
WP_003727518.1|1719301_1720162_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003727519.1|1720295_1721081_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.6	6.7e-26
WP_003726396.1|1721077_1721941_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003727520.1|1721950_1722493_-	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003726394.1|1722594_1723164_-	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003726393.1|1723198_1723765_-	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723886.1|1723883_1725143_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723884.1|1725327_1726611_-	trigger factor	NA	NA	NA	NA	NA
WP_003727521.1|1726725_1727664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003727522.1|1727925_1728591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003727523.1|1728606_1729140_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_069019573.1|1729422_1729644_-	hypothetical protein	NA	A8ATX1	Listeria_phage	93.1	5.7e-23
WP_069019586.1|1729640_1729874_-	hypothetical protein	NA	A8ATC5	Listeria_phage	85.7	9.2e-32
WP_031648625.1|1730183_1730549_+	hypothetical protein	NA	A8ATJ4	Listeria_phage	94.2	3.8e-56
WP_023559354.1|1730562_1730766_+	hypothetical protein	NA	A8ATJ3	Listeria_phage	95.5	2.6e-30
WP_003731542.1|1730793_1731015_+	helix-turn-helix transcriptional regulator	NA	A8ATJ2	Listeria_phage	95.9	3.5e-33
WP_003731541.1|1731076_1731910_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1S7FZ94	Listeria_phage	43.8	2.5e-47
WP_031648624.1|1731912_1732167_-|holin	phage holin	holin	A8ATJ0	Listeria_phage	95.2	9.4e-38
WP_023559355.1|1732177_1732393_-	LysM peptidoglycan-binding domain-containing protein	NA	A8ATI9	Listeria_phage	94.4	6.3e-27
WP_003731538.1|1732412_1732859_-	hypothetical protein	NA	A8ATI8	Listeria_phage	95.9	1.7e-63
WP_003731537.1|1732834_1733281_-	hypothetical protein	NA	A8ATI7	Listeria_phage	97.3	9.3e-73
WP_003731536.1|1733468_1733810_-	hypothetical protein	NA	A8ATI5	Listeria_phage	93.5	1.5e-43
WP_077625340.1|1733815_1734544_-	hypothetical protein	NA	A8ATI4	Listeria_phage	93.0	7.9e-130
WP_003731534.1|1734565_1735207_-	hypothetical protein	NA	A8ATI3	Listeria_phage	99.1	4.5e-113
WP_046811237.1|1735196_1736348_-|plate	baseplate J/gp47 family protein	plate	A8ATI2	Listeria_phage	77.0	2.4e-165
WP_003731532.1|1736340_1736703_-	DUF2634 domain-containing protein	NA	A8ATI1	Listeria_phage	70.0	2.0e-41
WP_003731531.1|1736699_1737038_-	hypothetical protein	NA	A8ATI0	Listeria_phage	92.0	8.0e-53
WP_077426168.1|1737038_1737845_-	hypothetical protein	NA	A8ATH9	Listeria_phage	85.4	1.1e-129
WP_069019604.1|1737850_1738222_-	hypothetical protein	NA	A8ATH8	Listeria_phage	78.7	2.4e-50
WP_023559357.1|1738221_1738770_-	LysM peptidoglycan-binding domain-containing protein	NA	A8ATH7	Listeria_phage	84.5	5.4e-83
WP_069019629.1|1738775_1743806_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	78.2	0.0e+00
WP_049961612.1|1743982_1744339_-	hypothetical protein	NA	A8ATH4	Listeria_phage	97.5	2.3e-58
WP_049961613.1|1744391_1744790_-	hypothetical protein	NA	A8ATH3	Listeria_phage	99.2	4.0e-67
WP_031648614.1|1744806_1745802_-	DUF3383 family protein	NA	A8ATH2	Listeria_phage	99.1	7.9e-181
WP_031648613.1|1745806_1746289_-	hypothetical protein	NA	A8ATH1	Listeria_phage	96.9	1.1e-82
WP_031648612.1|1746278_1746653_-	hypothetical protein	NA	A8ATH0	Listeria_phage	96.8	8.6e-64
WP_031648611.1|1746652_1747252_-	hypothetical protein	NA	A8ATG9	Listeria_phage	98.5	3.7e-109
WP_031648610.1|1747251_1747587_-	DUF4054 domain-containing protein	NA	A8ATG8	Listeria_phage	99.1	3.6e-53
WP_031648609.1|1747598_1747985_-	hypothetical protein	NA	A8ATG7	Listeria_phage	92.2	1.0e-59
WP_031648608.1|1748007_1748913_-	encapsulin	NA	A8ATG6	Listeria_phage	98.0	8.8e-163
WP_031648607.1|1748933_1749386_-	hypothetical protein	NA	A8ATG5	Listeria_phage	93.3	2.8e-69
WP_077625341.1|1749385_1750495_-	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	99.5	1.6e-174
WP_003731514.1|1750543_1750714_-	hypothetical protein	NA	A8ATG3	Listeria_phage	100.0	1.1e-26
WP_003731513.1|1750710_1752120_-|head	phage head morphogenesis protein	head	A8ATG2	Listeria_phage	100.0	7.8e-267
WP_003731512.1|1752112_1753498_-	DUF1073 domain-containing protein	NA	A8ATG1	Listeria_phage	100.0	1.1e-265
WP_003731511.1|1753511_1754972_-|terminase	phage terminase large subunit	terminase	A8ATG0	Listeria_phage	100.0	4.4e-289
WP_015987328.1|1754949_1755834_-	TerS	NA	A8ATF9	Listeria_phage	100.0	2.1e-140
WP_010990878.1|1755879_1756104_-	hypothetical protein	NA	A8ATN8	Listeria_phage	100.0	2.7e-36
WP_003731508.1|1756131_1756362_-	hypothetical protein	NA	A8ATN7	Listeria_phage	98.7	3.7e-33
WP_003731507.1|1756491_1756689_-	hypothetical protein	NA	A8ATN6	Listeria_phage	100.0	5.2e-28
WP_069029548.1|1756736_1758074_-	ParB N-terminal domain-containing protein	NA	A8ATN5	Listeria_phage	94.2	5.7e-243
WP_046811224.1|1758146_1758623_-	hypothetical protein	NA	A0A1P8BMT7	Lactococcus_phage	30.2	5.5e-07
WP_046811222.1|1758936_1759704_-	phage antirepressor KilAC domain-containing protein	NA	A8ATN0	Listeria_phage	98.4	9.8e-139
WP_003731502.1|1759716_1760139_-	hypothetical protein	NA	A8ATM9	Listeria_phage	100.0	6.3e-71
WP_046811221.1|1760219_1760780_-	phage protein	NA	A8ATM8	Listeria_phage	95.7	4.5e-101
WP_003731500.1|1760791_1761043_-	DUF3850 domain-containing protein	NA	A8ATM7	Listeria_phage	95.2	9.9e-40
WP_069029549.1|1761392_1761728_-	hypothetical protein	NA	A8ATZ5	Listeria_phage	93.1	4.6e-08
WP_061092529.1|1761727_1761916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069029551.1|1762121_1762403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003727764.1|1762399_1762585_-	hypothetical protein	NA	A0A059T5G1	Listeria_phage	100.0	4.1e-27
WP_069029552.1|1762725_1762980_-	hypothetical protein	NA	A0A059T6G3	Listeria_phage	74.4	9.7e-27
WP_176716633.1|1762976_1763114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069029553.1|1763130_1764492_-	PcfJ domain-containing protein	NA	A8ATM0	Listeria_phage	71.7	1.7e-189
WP_069029554.1|1764488_1764911_-	hypothetical protein	NA	A8ATL9	Listeria_phage	74.3	5.7e-48
WP_003731490.1|1764927_1765104_-	hypothetical protein	NA	A8ATL8	Listeria_phage	100.0	2.0e-23
WP_069029555.1|1765063_1765444_-	hypothetical protein	NA	A8ATL7	Listeria_phage	94.4	4.6e-65
WP_046811212.1|1765484_1766105_-	hypothetical protein	NA	A8ATL6	Listeria_phage	98.1	6.1e-107
WP_046811211.1|1766124_1766562_-	RusA family crossover junction endodeoxyribonuclease	NA	A8ATL5	Listeria_phage	91.0	8.5e-71
WP_046811210.1|1766542_1766782_-	hypothetical protein	NA	A8ATL4	Listeria_phage	98.6	3.6e-31
WP_046811277.1|1766738_1766960_-	hypothetical protein	NA	A8ATL3	Listeria_phage	85.3	1.2e-28
WP_041918379.1|1766946_1767147_-	hypothetical protein	NA	A8ATL2	Listeria_phage	89.4	4.0e-28
WP_031648583.1|1767143_1767959_-	ATP-binding protein	NA	A8ATL1	Listeria_phage	99.3	4.1e-143
WP_069029556.1|1767882_1768803_-	DUF4373 domain-containing protein	NA	A8ATL0	Listeria_phage	95.8	5.8e-162
WP_077426163.1|1768814_1769552_-	MBL fold metallo-hydrolase	NA	A8ATK9	Listeria_phage	97.6	5.9e-133
WP_003731480.1|1769511_1770297_-	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	100.0	7.9e-144
WP_077625342.1|1770297_1772241_-	AAA family ATPase	NA	A8ATK7	Listeria_phage	97.7	0.0e+00
WP_069019739.1|1772227_1772569_-	hypothetical protein	NA	A8ATK6	Listeria_phage	98.2	2.3e-55
WP_077625343.1|1772586_1772814_-	hypothetical protein	NA	A8ATK5	Listeria_phage	92.0	1.9e-29
WP_061092501.1|1772994_1773279_-	hypothetical protein	NA	A8ATK4	Listeria_phage	54.2	5.4e-26
WP_176715291.1|1773428_1773593_-	hypothetical protein	NA	A8ATK3	Listeria_phage	58.5	1.0e-08
WP_069019742.1|1773757_1774282_-	hypothetical protein	NA	A8ATK1	Listeria_phage	80.5	1.2e-76
WP_069019745.1|1774376_1774565_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069019748.1|1774711_1775140_+	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	69.7	4.7e-50
WP_069019751.1|1775156_1775576_+	ImmA/IrrE family metallo-endopeptidase	NA	A8ATJ8	Listeria_phage	83.2	8.7e-65
WP_077625383.1|1775628_1776642_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	50.0	8.7e-18
WP_069019758.1|1776720_1778136_+	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	45.6	8.5e-112
WP_003727525.1|1778452_1778848_+	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727526.1|1778927_1780067_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003727527.1|1780213_1781044_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	3.6e-46
WP_003727528.1|1781027_1782275_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.0	1.6e-106
WP_009918133.1|1782299_1783214_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|1783402_1783867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727530.1|1783905_1784367_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003727531.1|1784484_1785969_+	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003727532.1|1785987_1787634_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003726055.1|1787664_1788378_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_003723553.1|1788528_1788666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726054.1|1788996_1789845_+	YitT family protein	NA	NA	NA	NA	NA
WP_003726053.1|1789911_1790106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726052.1|1790145_1790805_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003726051.1|1791009_1792215_+	MFS transporter	NA	NA	NA	NA	NA
WP_003726050.1|1792211_1792457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727535.1|1792494_1792971_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003726048.1|1793138_1793402_-	DUF3116 family protein	NA	NA	NA	NA	NA
WP_003726047.1|1793426_1794839_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	4.9e-51
WP_003727536.1|1794963_1795224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727537.1|1795255_1795855_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	1.3e-29
WP_077625344.1|1796019_1796427_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_003726043.1|1796563_1797157_+	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_003727539.1|1797199_1798558_-	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_077625345.1|1798680_1802598_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
1803063:1803086	attL	ATAAAAAAATCTCTAAAACATTCA	NA	NA	NA	NA
WP_003726932.1|1803265_1803628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726037.1|1803733_1804207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989939.1|1805087_1805321_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	93.5	8.9e-35
WP_003731277.1|1805622_1805856_+	hypothetical protein	NA	A8ATW9	Listeria_phage	100.0	4.3e-13
WP_003731276.1|1805887_1806139_+	hypothetical protein	NA	A8ATW8	Listeria_phage	100.0	2.0e-40
WP_003731275.1|1806139_1806589_+	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	98.7	2.0e-75
WP_039120634.1|1807180_1807570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003750018.1|1807566_1807920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075702241.1|1807916_1808435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077625347.1|1808920_1809766_-	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	92.6	8.6e-136
WP_031668020.1|1809762_1810032_-|holin	phage holin	holin	A0A059T684	Listeria_phage	94.3	2.6e-38
WP_064614890.1|1810031_1810334_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	94.0	7.7e-39
WP_077625348.1|1810383_1811478_-	carbohydrate-binding protein CenC	NA	A0A059T7R4	Listeria_phage	89.3	5.6e-188
WP_077625349.1|1811467_1813762_-|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	98.4	0.0e+00
WP_077625350.1|1813777_1815427_-|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	98.0	0.0e+00
WP_077625351.1|1815423_1820340_-|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	95.4	0.0e+00
WP_014930919.1|1820355_1820505_-	hypothetical protein	NA	A0A059T6F4	Listeria_phage	100.0	2.3e-20
WP_031641717.1|1820555_1820888_-	hypothetical protein	NA	A0A059T7R2	Listeria_phage	98.2	3.0e-52
WP_014929552.1|1820958_1821546_-|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	98.5	2.9e-106
WP_014929551.1|1821566_1821950_-	hypothetical protein	NA	A0A059T681	Listeria_phage	95.3	2.3e-64
WP_077625352.1|1821946_1822348_-	hypothetical protein	NA	A8ATA2	Listeria_phage	97.0	2.3e-67
WP_077625353.1|1822344_1822710_-|head,tail	phage head-tail adapter protein	head,tail	A0A059T6F2	Listeria_phage	99.2	2.9e-64
WP_009934007.1|1822693_1822993_-	hypothetical protein	NA	A8ATA0	Listeria_phage	98.0	9.9e-47
WP_176716059.1|1823002_1823173_-	hypothetical protein	NA	A0A059T7Y2	Listeria_phage	98.2	3.1e-21
WP_014929546.1|1823179_1824331_-|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	99.5	2.4e-213
WP_014929545.1|1824357_1825155_-|protease	Clp protease ClpP	protease	A0A059T5F2	Listeria_phage	98.9	6.8e-143
WP_014929544.1|1825151_1826282_-|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	100.0	1.9e-215
WP_077625354.1|1826293_1827937_-|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	99.6	0.0e+00
WP_012951543.1|1827933_1828290_-|terminase	P27 family phage terminase small subunit	terminase	A0A059T7Y1	Listeria_phage	98.0	2.0e-46
WP_060577744.1|1828338_1828653_-	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	1.1e-56
WP_023548932.1|1828652_1828979_-	hypothetical protein	NA	A0A059T5G5	Listeria_phage	97.2	3.2e-54
WP_003747284.1|1829538_1829964_-	DUF722 domain-containing protein	NA	Q8W5V4	Listeria_phage	92.2	5.0e-68
WP_003731655.1|1829976_1830204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731656.1|1830264_1830420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731657.1|1830448_1830718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031644593.1|1830714_1831254_-	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	77.1	2.7e-74
WP_003731659.1|1831701_1831914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951539.1|1831915_1832233_-	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	89.3	7.3e-48
WP_077625355.1|1832521_1834795_-	DNA primase	NA	R4IBW2	Listeria_phage	99.1	0.0e+00
WP_038330175.1|1834817_1835303_-	DUF669 domain-containing protein	NA	R4ICE5	Listeria_phage	100.0	2.9e-88
WP_097665292.1|1835325_1836582_-	DEAD/DEAH box helicase	NA	R4IBK4	Listeria_phage	98.7	1.7e-228
WP_077625356.1|1836645_1837335_-	AAA family ATPase	NA	R4IDY8	Listeria_phage	98.7	2.8e-129
WP_039380420.1|1837354_1837834_-	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	99.4	9.3e-79
WP_003731666.1|1837837_1838215_-	hypothetical protein	NA	A8ATE8	Listeria_phage	65.4	8.7e-40
WP_003731667.1|1838211_1838385_-	hypothetical protein	NA	Q8W5W3	Listeria_phage	100.0	6.8e-24
WP_003731670.1|1838718_1838985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031641705.1|1838974_1839205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731672.1|1839201_1839435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061107348.1|1839431_1839893_-	hypothetical protein	NA	D9J0I6	Brochothrix_phage	30.6	7.7e-14
WP_077625357.1|1839889_1840153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077625358.1|1840149_1840374_-	hypothetical protein	NA	R4IBJ7	Listeria_phage	82.4	4.8e-30
WP_077625359.1|1840367_1840919_-	DUF1642 domain-containing protein	NA	A8ATD8	Listeria_phage	40.9	1.7e-28
WP_077625360.1|1840929_1842000_-	DNA cytosine methyltransferase	NA	A0A1X9I6Y5	Streptococcus_phage	64.7	3.5e-142
WP_077625361.1|1841996_1842179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009929539.1|1842699_1842885_-	hypothetical protein	NA	A0A059T7Z3	Listeria_phage	96.7	1.7e-28
WP_026747303.1|1842887_1843130_-	hypothetical protein	NA	A8ATD2	Listeria_phage	96.2	6.0e-42
WP_003730995.1|1843151_1843343_-	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	87.1	5.4e-22
WP_003730994.1|1843409_1843613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951519.1|1844013_1844337_+	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	75.7	6.3e-39
WP_026747145.1|1844353_1844806_+	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	87.3	9.1e-76
WP_014930257.1|1844857_1845721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031646809.1|1845850_1847005_+|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	97.9	1.3e-214
1847023:1847046	attR	ATAAAAAAATCTCTAAAACATTCA	NA	NA	NA	NA
>prophage 6
NZ_CP019615	Listeria monocytogenes strain 10-092876-0168 chromosome, complete genome	3072093	1958833	1966255	3072093		Hokovirus(33.33%)	8	NA	NA
WP_077625364.1|1958833_1960390_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
WP_009917597.1|1960518_1960923_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003724634.1|1960982_1961291_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003727000.1|1961303_1962128_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_003721509.1|1962139_1963630_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003727001.1|1963838_1964852_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003727002.1|1964866_1965850_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
WP_003727003.1|1965871_1966255_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	8.1e-17
>prophage 7
NZ_CP019615	Listeria monocytogenes strain 10-092876-0168 chromosome, complete genome	3072093	2932246	2938773	3072093	tail	Streptococcus_pyogenes_phage(33.33%)	10	NA	NA
WP_003728210.1|2932246_2933065_-|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	9.4e-39
WP_003728211.1|2933061_2934930_-	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	4.5e-20
WP_003740367.1|2934916_2935321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721745.1|2935362_2935665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721744.1|2935712_2936225_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003728212.1|2936237_2936627_-	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003728213.1|2936906_2937323_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	3.2e-19
WP_003724946.1|2937334_2937763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721740.1|2937979_2938315_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003728215.1|2938320_2938773_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
