The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	0	9806	3603805		Bacillus_phage(100.0%)	8	NA	NA
WP_077346782.1|399_876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077346784.1|1035_1419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077346786.1|1473_4260_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_077346788.1|4414_5017_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_077346790.1|5168_5816_-	ComF family protein	NA	NA	NA	NA	NA
WP_077346792.1|5870_7568_-	GerMN domain-containing protein	NA	NA	NA	NA	NA
WP_152024494.1|7564_9121_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.4	1.8e-14
WP_077346794.1|9104_9806_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	2.0e-37
>prophage 2
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	14624	19440	3603805		Planktothrix_phage(50.0%)	5	NA	NA
WP_077346806.1|14624_15107_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.6	3.0e-29
WP_077346808.1|15130_16582_-	M23 family metallopeptidase	NA	G9BW84	Planktothrix_phage	44.4	2.1e-17
WP_077352565.1|16595_17447_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077346810.1|17515_18202_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	38.4	9.7e-29
WP_077346812.1|18327_19440_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	27.5	9.3e-05
>prophage 3
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	24849	26523	3603805		Faecalibacterium_phage(100.0%)	1	NA	NA
WP_077352569.1|24849_26523_-	recombinase family protein	NA	A0A2K9V406	Faecalibacterium_phage	26.6	9.0e-20
>prophage 4
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	32811	36162	3603805		Liberibacter_phage(100.0%)	1	NA	NA
WP_077346828.1|32811_36162_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.4	1.8e-67
>prophage 5
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	54661	54907	3603805		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_077346858.1|54661_54907_+	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	44.6	5.7e-08
>prophage 6
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	65983	75197	3603805	transposase	Escherichia_phage(40.0%)	10	NA	NA
WP_077352583.1|65983_67654_-	recombinase family protein	NA	A0A2K9V406	Faecalibacterium_phage	25.1	2.6e-19
WP_161490090.1|67722_67929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077346875.1|68036_68399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077346877.1|68395_68848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152024501.1|68899_70381_+	N-6 DNA methylase	NA	A0A2R2Z316	Escherichia_phage	41.8	1.0e-91
WP_077346879.1|70377_71337_+	restriction endonuclease	NA	A0A0P0ZG22	Escherichia_phage	51.9	6.2e-98
WP_179947147.1|71914_73183_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	24.9	1.9e-14
WP_161490091.1|73561_73738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161490092.1|74067_74496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152024503.1|74711_75197_-	hypothetical protein	NA	Q854T1	Mycobacterium_virus	43.6	1.4e-21
>prophage 7
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	79803	81630	3603805		Caulobacter_phage(100.0%)	1	NA	NA
WP_077346897.1|79803_81630_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	33.9	3.7e-51
>prophage 8
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	90235	96628	3603805		Planktothrix_phage(33.33%)	6	NA	NA
WP_077346915.1|90235_90988_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	7.1e-17
WP_077352589.1|90987_91965_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_077346917.1|91951_92350_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_077346919.1|92357_93080_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_077346921.1|93165_93930_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	37.9	4.4e-14
WP_077346923.1|94075_96628_-	DEAD/DEAH box helicase	NA	M1HLM2	Paramecium_bursaria_Chlorella_virus	30.7	2.7e-44
>prophage 9
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	106155	111540	3603805	tRNA	Pseudomonas_phage(25.0%)	6	NA	NA
WP_077352591.1|106155_107088_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.8	8.2e-47
WP_077346942.1|107227_107656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077346944.1|107736_108438_+	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	34.0	6.2e-23
WP_152024504.1|108425_109649_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	34.0	1.7e-60
WP_077352595.1|109639_110371_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_077346946.1|110367_111540_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	31.2	1.5e-26
>prophage 10
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	116899	122999	3603805		Enterobacteria_phage(33.33%)	7	NA	NA
WP_077346954.1|116899_117901_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.5	5.2e-31
WP_077346956.1|117902_118673_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_077346958.1|118703_119549_-	DUF3097 domain-containing protein	NA	NA	NA	NA	NA
WP_077346960.1|119563_120379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077346962.1|120375_121068_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.9	2.0e-13
WP_077346964.1|121064_121442_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077346966.1|121556_122999_-	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	35.3	5.3e-61
>prophage 11
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	127407	179860	3603805	transposase,integrase,tRNA	Hokovirus(14.29%)	47	173120:173137	187741:187758
WP_077346976.1|127407_129888_+	ATP-dependent helicase HrpB	NA	A0A1V0SH94	Hokovirus	27.2	6.0e-28
WP_077346978.1|129952_131584_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_077346980.1|131784_133614_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	42.0	6.8e-21
WP_152024495.1|133771_135028_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077346982.1|135235_135496_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_077346984.1|135608_136571_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_161490093.1|136675_136885_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077346988.1|136947_137496_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077346990.1|137488_139501_+	beta-propeller domain-containing protein	NA	NA	NA	NA	NA
WP_077346992.1|139584_140571_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_152024505.1|140602_141883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077352597.1|142129_143329_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077346996.1|143724_146016_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_152024506.1|146012_146807_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077346998.1|146928_149397_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.2	2.7e-190
WP_077347000.1|149483_150404_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_161490094.1|150456_151353_-	DUF4192 domain-containing protein	NA	NA	NA	NA	NA
WP_077347004.1|151438_152080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077347006.1|152051_153023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152024799.1|153129_154014_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_077347008.1|154481_155402_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
WP_161490095.1|155398_156088_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_077347010.1|156218_157463_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_077347012.1|157459_157756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077347014.1|157756_158641_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152024507.1|158712_159690_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_077347018.1|159678_159984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077347020.1|159971_160205_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_077347022.1|160276_160921_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_077347024.1|161043_161406_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077347026.1|161402_161801_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_077347028.1|161793_162504_+	DUF2332 family protein	NA	NA	NA	NA	NA
WP_169836063.1|162576_162741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077347030.1|162771_163047_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_077347032.1|163055_164729_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077347034.1|164725_165100_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_179947107.1|165139_166162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077347038.1|166706_167138_-	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_077347040.1|167134_167479_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077347042.1|167581_168034_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_077347044.1|169219_169963_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	29.2	8.1e-05
WP_077347046.1|169959_171510_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_077347048.1|173061_174054_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	23.1	2.7e-11
173120:173137	attL	CGCTCGTCGAGCGCGGGG	NA	NA	NA	NA
WP_152024508.1|174046_174982_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077347052.1|174978_175917_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	23.0	3.1e-17
WP_077347054.1|176294_178856_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_077347056.1|178861_179860_-	ATP-binding protein	NA	A0A2K9R7H3	Dishui_lake_phycodnavirus	31.2	8.9e-15
187741:187758	attR	CGCTCGTCGAGCGCGGGG	NA	NA	NA	NA
>prophage 12
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	191659	195193	3603805		Mycobacterium_phage(100.0%)	1	NA	NA
WP_077352607.1|191659_195193_-	conjugative relaxase TrwC/TraI family protein	NA	V5UQN3	Mycobacterium_phage	24.5	1.4e-33
>prophage 13
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	198572	198941	3603805		Megavirus(100.0%)	1	NA	NA
WP_077347080.1|198572_198941_-	thiol reductase thioredoxin	NA	G5CQP2	Megavirus	42.9	3.0e-08
>prophage 14
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	206782	208021	3603805		Tupanvirus(100.0%)	1	NA	NA
WP_077347096.1|206782_208021_-	cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase	NA	A0A2K9L6B7	Tupanvirus	29.2	1.4e-30
>prophage 15
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	213359	215065	3603805		Vibrio_phage(50.0%)	2	NA	NA
WP_179947130.1|213359_214313_+	bifunctional DNA primase/polymerase	NA	A0A0K1LKD4	Vibrio_phage	35.1	1.4e-12
WP_179947131.1|214312_215065_+	DUF2637 domain-containing protein	NA	A0A222YXY9	Mycobacterium_phage	45.6	5.5e-17
>prophage 16
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	218211	219873	3603805		Gordonia_phage(100.0%)	1	NA	NA
WP_077352617.1|218211_219873_+	M23 family metallopeptidase	NA	A0A2P1JY73	Gordonia_phage	43.9	2.9e-26
>prophage 17
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	248205	251287	3603805		Streptococcus_phage(100.0%)	4	NA	NA
WP_077347162.1|248205_249447_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.6	2.2e-100
WP_161490099.1|249499_249922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161490100.1|249828_250077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077347166.1|250192_251287_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.7	2.1e-62
>prophage 18
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	264247	265045	3603805		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077347192.1|264247_265045_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	3.8e-08
>prophage 19
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	286276	289108	3603805		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_077347230.1|286276_289108_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	1.1e-20
>prophage 20
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	301819	302530	3603805		Autographa_californica_nuclear_polyhedrosis_virus(100.0%)	1	NA	NA
WP_077347254.1|301819_302530_+	phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	40.3	2.7e-05
>prophage 21
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	317897	320413	3603805		Xanthomonas_phage(33.33%)	3	NA	NA
WP_161490102.1|317897_318800_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	33.0	5.9e-18
WP_169836067.1|318802_319765_-	tyrosine recombinase	NA	A0A1D8EVX7	Mycobacterium_phage	31.4	3.7e-18
WP_077347280.1|319807_320413_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	33.9	6.8e-10
>prophage 22
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	330059	342102	3603805		Pandoravirus(25.0%)	12	NA	NA
WP_077347294.1|330059_331775_+	chorismate-binding protein	NA	S4VNU7	Pandoravirus	34.0	2.9e-42
WP_077352631.1|331798_332749_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_077347298.1|334056_334533_-	NfeD family protein	NA	NA	NA	NA	NA
WP_077347300.1|334529_335315_-	ABC transporter ATP-binding protein	NA	A7K9T9	Acanthocystis_turfacea_chlorella_virus	26.3	1.8e-07
WP_077347302.1|335381_336338_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_077347304.1|336371_337145_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_077347306.1|337161_337857_-	3-oxoacyl-ACP reductase FabG	NA	F2NZ40	Diadromus_pulchellus_ascovirus	29.2	6.0e-10
WP_161490103.1|337931_338723_-	DUF2599 domain-containing protein	NA	NA	NA	NA	NA
WP_077347310.1|338777_339095_+	DUF3099 domain-containing protein	NA	NA	NA	NA	NA
WP_077347312.1|339091_339892_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_152024518.1|339888_340692_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_077347314.1|340713_342102_+	ATP-binding protein	NA	R4TQL5	Phaeocystis_globosa_virus	27.8	5.7e-12
>prophage 23
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	347084	348683	3603805		Streptococcus_phage(100.0%)	1	NA	NA
WP_179947133.1|347084_348683_-	ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.9	7.2e-43
>prophage 24
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	352889	356718	3603805		Mycobacterium_phage(50.0%)	5	NA	NA
WP_077347332.1|352889_353726_-	alpha/beta hydrolase	NA	A0A2P1CHW5	Mycobacterium_phage	26.4	1.7e-11
WP_077347334.1|353784_354183_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_077347336.1|354182_354626_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2P1CJL8	Mycobacterium_phage	37.0	3.9e-15
WP_077347338.1|354636_355875_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.1	3.4e-101
WP_077347340.1|355953_356718_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	29.2	5.6e-09
>prophage 25
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	360603	361296	3603805		Staphylococcus_phage(100.0%)	1	NA	NA
WP_152024803.1|360603_361296_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	6.6e-17
>prophage 26
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	370554	371268	3603805		Planktothrix_phage(100.0%)	1	NA	NA
WP_152024804.1|370554_371268_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.7	1.6e-13
>prophage 27
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	378462	382886	3603805	transposase	Mycobacterium_phage(50.0%)	4	NA	NA
WP_077347376.1|378462_379770_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.7	5.3e-185
WP_077347378.1|380115_380307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179947134.1|380316_381318_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_077347382.1|381356_382886_+	glucose-6-phosphate dehydrogenase	NA	E3SIC8	Synechococcus_phage	38.3	1.1e-80
>prophage 28
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	390365	400415	3603805		Streptococcus_phage(25.0%)	7	NA	NA
WP_077347402.1|390365_391313_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.4	1.1e-35
WP_077347404.1|391309_392176_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.4e-08
WP_077347406.1|392934_393549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077347408.1|393545_394649_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	1.7e-14
WP_077347410.1|394914_396834_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_077347412.1|396951_397563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152024805.1|397565_400415_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.8	3.6e-287
>prophage 29
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	407149	409981	3603805		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_077347429.1|407149_409981_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	50.5	6.4e-252
>prophage 30
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	417028	420793	3603805		Bacillus_phage(50.0%)	3	NA	NA
WP_077347441.1|417028_419746_-	DNA polymerase I	NA	X2JUL6	Bacillus_phage	33.4	3.5e-37
WP_077347443.1|419744_420152_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_077347445.1|420214_420793_-	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	33.6	3.7e-05
>prophage 31
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	447362	452802	3603805		Mycobacterium_phage(33.33%)	3	NA	NA
WP_077352645.1|447362_447638_-	HNH endonuclease	NA	A0A2L0HL05	Mycobacterium_phage	54.5	2.0e-09
WP_077347493.1|447783_448971_-	DNA polymerase IV	NA	Q6DMX4	Streptococcus_phage	25.2	3.2e-11
WP_077347495.1|448974_452802_-	DNA polymerase III subunit alpha	NA	A0A2L1IVQ8	Streptomyces_phage	28.6	1.6e-75
>prophage 32
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	462084	467413	3603805		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_077347514.1|462084_464454_+	HAD-IC family P-type ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	26.3	2.6e-33
WP_077347516.1|464426_465107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161490106.1|465343_467413_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	26.7	2.5e-19
>prophage 33
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	474565	478331	3603805		Clostridium_phage(50.0%)	4	NA	NA
WP_077347534.1|474565_475702_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	44.8	9.1e-24
WP_077352647.1|475783_475978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077347536.1|476049_477780_+	DEDD exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_179947150.1|477836_478331_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	42.0	4.4e-23
>prophage 34
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	481920	482958	3603805		Acinetobacter_phage(100.0%)	1	NA	NA
WP_077347548.1|481920_482958_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	1.2e-41
>prophage 35
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	498309	502662	3603805		Klosneuvirus(50.0%)	4	NA	NA
WP_077347570.1|498309_499770_+	GuaB1 family IMP dehydrogenase-related protein	NA	A0A1V0SHK8	Klosneuvirus	29.8	9.5e-42
WP_077347572.1|499786_501046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077347574.1|501042_501693_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_077347576.1|501780_502662_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	2.2e-25
>prophage 36
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	510951	512424	3603805		Mycoplasma_phage(100.0%)	1	NA	NA
WP_077347600.1|510951_512424_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.2	4.0e-40
>prophage 37
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	521855	527638	3603805		Tupanvirus(33.33%)	5	NA	NA
WP_077347614.1|521855_523616_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.5	3.3e-41
WP_077347616.1|523773_525054_-	glutaminase	NA	NA	NA	NA	NA
WP_077347618.1|525409_525610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077347620.1|525624_526434_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.1	8.7e-53
WP_077347622.1|526495_527638_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	35.6	6.1e-52
>prophage 38
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	535660	537124	3603805		Tupanvirus(100.0%)	1	NA	NA
WP_077352655.1|535660_537124_+	catalase	NA	A0A2K9L572	Tupanvirus	42.3	1.8e-85
>prophage 39
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	565440	568709	3603805		Streptococcus_phage(50.0%)	2	NA	NA
WP_077347681.1|565440_567522_+	elongation factor G-like protein EF-G2	NA	E4ZFJ7	Streptococcus_phage	22.6	3.0e-12
WP_077347683.1|567482_568709_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.2	6.4e-31
>prophage 40
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	572241	575661	3603805		Bacillus_thuringiensis_phage(50.0%)	3	NA	NA
WP_077347696.1|572241_572853_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.6	7.0e-39
WP_077347698.1|572923_574834_-	acyltransferase	NA	NA	NA	NA	NA
WP_161490110.1|574830_575661_-	acyltransferase	NA	W6MVL2	Pseudomonas_phage	45.4	4.5e-12
>prophage 41
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	580134	580926	3603805		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_077347703.1|580134_580926_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.4	4.0e-10
>prophage 42
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	611908	670061	3603805	transposase,integrase,bacteriocin,holin,tRNA	Tetraselmis_virus(14.29%)	57	609375:609390	674965:674980
609375:609390	attL	CCTCGGTGACGCCGAG	NA	NA	NA	NA
WP_077352659.1|611908_615190_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	40.8	9.6e-34
WP_077347771.1|615345_615735_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_161490114.1|615852_616002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077347775.1|616097_616376_-	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_077347777.1|616378_616612_-	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_077347779.1|616611_617031_-	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_077347781.1|617034_617844_-	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_077347783.1|617846_618248_-	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_077347785.1|618275_618557_-	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_077347787.1|618575_619412_-	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_077347789.1|619445_619757_-	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_077347791.1|619753_620695_-	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_077347793.1|620691_621348_-	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_015071250.1|621359_621671_-	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_077347795.1|621979_622663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077352662.1|622717_623512_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	37.9	2.1e-19
WP_077347797.1|623585_625856_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.1	7.4e-158
WP_077347799.1|626020_628087_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	36.9	9.9e-69
WP_161490115.1|628118_629888_+	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	38.2	1.0e-29
WP_077347803.1|629903_630419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077347806.1|630495_630891_-|transposase	transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	54.5	3.7e-33
WP_179947136.1|630887_632228_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	24.7	2.7e-11
WP_077347808.1|632306_633125_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_169836068.1|633024_633594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152024807.1|633661_634174_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_077347814.1|634516_636268_+	DEAD/DEAH box helicase	NA	I4AZM6	Saccharomonospora_phage	43.1	9.0e-79
WP_077347816.1|636278_637280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077347818.1|637276_638128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077347820.1|640422_641379_+	glutathione S-transferase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_152024535.1|642301_643486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077347824.1|643452_644247_-|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
WP_077352666.1|644246_645230_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_077347826.1|645381_647100_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_152024536.1|647086_647494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077347830.1|647511_648975_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077347832.1|649101_649677_+	DUF4112 domain-containing protein	NA	NA	NA	NA	NA
WP_077347834.1|649707_651387_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	51.4	5.8e-160
WP_077347838.1|651922_652663_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_152024538.1|652652_653192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077347842.1|653109_653709_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	72.6	1.6e-40
WP_077347844.1|653860_654319_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077347846.1|654425_655340_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_077347848.1|655336_656287_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_077347850.1|656286_657618_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_077347852.1|657750_658377_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161490116.1|658684_658831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015011457.1|659052_659625_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	39.9	2.6e-27
WP_077347854.1|659566_660289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161490117.1|660273_660438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152024539.1|660434_660890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077347858.1|661079_662279_-	elongation factor Tu	NA	M4M9V7	Vibrio_phage	63.9	6.9e-06
WP_077352668.1|662534_664580_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	8.3e-60
WP_077347860.1|664688_665159_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_014847273.1|665158_665530_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_152024495.1|665888_667145_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077347862.1|667305_667773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077347864.1|668969_670061_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	30.9	8.8e-08
674965:674980	attR	CTCGGCGTCACCGAGG	NA	NA	NA	NA
>prophage 43
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	673866	681362	3603805		Vibrio_phage(50.0%)	2	NA	NA
WP_077347871.1|673866_677805_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.1	1.8e-55
WP_077347873.1|677888_681362_-	DNA-directed RNA polymerase subunit beta	NA	G8DH04	Emiliania_huxleyi_virus	22.6	1.6e-34
>prophage 44
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	686671	687424	3603805		Planktothrix_phage(100.0%)	1	NA	NA
WP_077352670.1|686671_687424_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	1.9e-33
>prophage 45
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	693572	699500	3603805		Bodo_saltans_virus(33.33%)	4	NA	NA
WP_077347893.1|693572_695402_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	25.4	4.6e-17
WP_077347895.1|695398_697186_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	7.6e-41
WP_077347897.1|697268_698432_+	amidohydrolase	NA	NA	NA	NA	NA
WP_077347899.1|698438_699500_-	peptidoglycan-binding protein	NA	B6RT57	Bacillus_virus	33.1	1.7e-11
>prophage 46
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	706992	709710	3603805		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_152024542.1|706992_709710_-	HAD-IC family P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.2	5.1e-65
>prophage 47
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	714028	717160	3603805		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_077347927.1|714028_717160_+	SNF2 helicase associated domain-containing protein	NA	C7U0G1	Ostreococcus_tauri_virus	30.9	4.0e-37
>prophage 48
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	721473	723423	3603805		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_077347935.1|721473_723423_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.1	4.3e-82
>prophage 49
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	744888	751501	3603805		Micromonas_pusilla_virus(33.33%)	6	NA	NA
WP_077347971.1|744888_746718_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	45.1	1.5e-140
WP_077347973.1|746868_747438_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077347975.1|747434_748532_+	DnaJ domain-containing protein	NA	A0A2H4UVP1	Bodo_saltans_virus	24.9	4.1e-13
WP_077347977.1|748533_748953_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077347979.1|749318_750947_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_152024808.1|750946_751501_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	1.9e-06
>prophage 50
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	759563	760382	3603805		Escherichia_phage(100.0%)	1	NA	NA
WP_077347994.1|759563_760382_+	nucleotidyltransferase family protein	NA	K7QKA7	Escherichia_phage	26.9	2.3e-08
>prophage 51
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	772675	774244	3603805		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077348022.1|772675_774244_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.2e-13
>prophage 52
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	781507	782452	3603805		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_077348036.1|781507_782452_-	hypothetical protein	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	29.4	2.0e-08
>prophage 53
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	792368	795703	3603805		Morganella_phage(50.0%)	4	NA	NA
WP_077348054.1|792368_792887_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	41.1	5.6e-21
WP_077352687.1|792896_793229_-	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077348057.1|793266_793929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161490120.1|794317_795703_+	SH3 domain-containing protein	NA	Q9ZX60	Mycobacterium_phage	31.5	5.2e-13
>prophage 54
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	812959	816845	3603805	tRNA	Tupanvirus(33.33%)	3	NA	NA
WP_077348087.1|812959_814369_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	42.7	3.8e-80
WP_077348089.1|814377_815418_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	39.1	1.7e-56
WP_077348091.1|815414_816845_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.7	1.4e-53
>prophage 55
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	822897	824540	3603805		Planktothrix_phage(100.0%)	2	NA	NA
WP_077348097.1|822897_823860_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	2.7e-29
WP_077348099.1|823853_824540_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	6.9e-35
>prophage 56
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	832208	833306	3603805		Planktothrix_phage(100.0%)	1	NA	NA
WP_077348111.1|832208_833306_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	1.9e-18
>prophage 57
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	843193	844783	3603805		Escherichia_phage(100.0%)	1	NA	NA
WP_077348135.1|843193_844783_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.2	9.5e-19
>prophage 58
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	856146	856899	3603805		Planktothrix_phage(100.0%)	1	NA	NA
WP_077348153.1|856146_856899_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	3.8e-34
>prophage 59
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	880235	889770	3603805	transposase	Tupanvirus(33.33%)	11	NA	NA
WP_077348193.1|880235_882164_+	acyl-CoA dehydrogenase family protein	NA	A0A2K9L6M4	Tupanvirus	32.8	1.5e-55
WP_077348195.1|882229_882700_-	DUF3048 domain-containing protein	NA	NA	NA	NA	NA
WP_077348197.1|882903_884130_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_077348199.1|884245_884581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077348201.1|884625_884874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161490126.1|884887_885916_-	acyltransferase family protein	NA	A0A142KBN9	Gordonia_phage	28.3	4.2e-12
WP_077348205.1|885977_886457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077348207.1|886457_887012_-	DinB family protein	NA	NA	NA	NA	NA
WP_077348209.1|887140_888130_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_077348211.1|888245_888485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077348213.1|888486_889770_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	34.9	6.8e-68
>prophage 60
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	903805	906476	3603805		Streptococcus_phage(50.0%)	2	NA	NA
WP_077348242.1|903805_905668_+	translational GTPase TypA	NA	E4ZFJ7	Streptococcus_phage	26.4	1.1e-23
WP_169836087.1|905879_906476_+	helix-turn-helix transcriptional regulator	NA	A7KUY2	Bacillus_phage	40.6	5.0e-05
>prophage 61
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	911706	912360	3603805		Bacillus_phage(100.0%)	1	NA	NA
WP_077348260.1|911706_912360_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.9	1.9e-13
>prophage 62
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	916361	927345	3603805		Cyanophage(20.0%)	9	NA	NA
WP_077348268.1|916361_917471_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	29.7	9.5e-18
WP_077348270.1|917574_918558_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_077348272.1|918557_919637_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_077348274.1|919666_920446_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	5.0e-13
WP_077348276.1|921222_922872_+	DUF222 domain-containing protein	NA	NA	NA	NA	NA
WP_077348278.1|923231_924083_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	8.5e-59
WP_077352703.1|924317_924725_-	glyoxalase	NA	V5UQY3	Oenococcus_phage	34.1	4.0e-14
WP_077348280.1|924727_925945_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_077348282.1|925941_927345_-	mycothione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	5.6e-39
>prophage 63
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	941726	943118	3603805		Thermobifida_phage(100.0%)	1	NA	NA
WP_077348308.1|941726_943118_+	DNA repair protein RadA	NA	A0A0R8V1H3	Thermobifida_phage	24.5	1.4e-05
>prophage 64
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	948954	949929	3603805		Planktothrix_phage(100.0%)	1	NA	NA
WP_077348319.1|948954_949929_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.3e-22
>prophage 65
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	954585	957536	3603805	protease	Serratia_phage(50.0%)	2	NA	NA
WP_077348333.1|954585_957090_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1S6UBG5	Serratia_phage	41.6	8.5e-131
WP_077348335.1|957203_957536_-	Lsr2 family protein	NA	A0A160DEV0	Gordonia_phage	49.6	6.5e-15
>prophage 66
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	960881	964353	3603805	protease	Pandoravirus(33.33%)	3	NA	NA
WP_077352713.1|960881_961790_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.8	2.4e-19
WP_077352711.1|961807_962374_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	52.0	2.2e-42
WP_077352715.1|962373_964353_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	43.2	2.3e-107
>prophage 67
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	984046	988794	3603805		Bacteriophage(50.0%)	3	NA	NA
WP_077348385.1|984046_984661_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	40.6	6.0e-30
WP_152024573.1|984657_986052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152024818.1|986103_988794_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	33.1	1.5e-104
>prophage 68
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1006033	1063797	3603805	protease,transposase,integrase,holin	Mycobacterium_phage(40.0%)	47	1020143:1020159	1049205:1049221
WP_077348478.1|1006033_1006519_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_169836070.1|1006559_1006721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077348480.1|1006720_1007176_+	RidA family protein	NA	NA	NA	NA	NA
WP_077348482.1|1007175_1007847_+	endonuclease III	NA	NA	NA	NA	NA
WP_077348484.1|1007865_1008480_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_077348486.1|1008476_1009112_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_077348488.1|1009170_1009485_-	WhiB family transcriptional regulator	NA	A0A1J0GPQ3	Mycobacterium_phage	46.4	9.2e-11
WP_077352723.1|1009670_1012058_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_077348490.1|1012057_1012954_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_161490136.1|1013986_1014145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161490137.1|1015247_1015670_-	DNA lyase	NA	NA	NA	NA	NA
WP_077352727.1|1015825_1017256_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_077348494.1|1017295_1018096_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077348496.1|1018088_1018853_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161490138.1|1018826_1019264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152024575.1|1019313_1019967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077348500.1|1020080_1021964_+	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
1020143:1020159	attL	CCACCCCAAGCTGCTGG	NA	NA	NA	NA
WP_152024576.1|1022194_1022488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077348504.1|1022708_1022903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077352729.1|1023189_1023444_+	NrdH-redoxin	NA	NA	NA	NA	NA
WP_077348506.1|1023459_1024635_+	MFS transporter	NA	NA	NA	NA	NA
WP_077348508.1|1024631_1026092_+	amidohydrolase	NA	NA	NA	NA	NA
WP_077348510.1|1026267_1026786_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_077348512.1|1026946_1027432_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077348514.1|1027439_1028483_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_077348516.1|1031334_1032261_-	kinase	NA	NA	NA	NA	NA
WP_077348518.1|1032304_1032922_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_077348520.1|1032935_1033244_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_077352731.1|1033281_1035525_-	DNA polymerase III subunit gamma and tau	NA	A0A1L2BWV7	Bacteriophage	34.0	2.6e-46
WP_077348522.1|1035955_1036936_+	asparaginase	NA	NA	NA	NA	NA
WP_077352733.1|1037372_1038194_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_152024577.1|1038343_1039621_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077352735.1|1041458_1043144_+	glycosidase	NA	NA	NA	NA	NA
WP_077352737.1|1043194_1043692_-	universal stress protein	NA	NA	NA	NA	NA
WP_077348526.1|1043702_1045100_-	MFS transporter	NA	NA	NA	NA	NA
WP_077348528.1|1045096_1045561_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_077348530.1|1046032_1046986_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077348532.1|1047097_1048090_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	25.7	6.1e-16
WP_077348534.1|1048086_1049637_-|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
1049205:1049221	attR	CCAGCAGCTTGGGGTGG	NA	NA	NA	NA
WP_077348536.1|1049648_1052144_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_077348538.1|1052136_1055640_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_077348540.1|1055639_1059119_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_077348542.1|1059123_1059723_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_077348544.1|1059719_1060358_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_077348546.1|1060580_1061648_-	bifunctional lytic transglycosylase/C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	28.1	5.2e-05
WP_179947139.1|1061683_1062418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152024820.1|1062573_1063797_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	75.9	2.0e-173
>prophage 69
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1071606	1079591	3603805	integrase	Gordonia_phage(50.0%)	6	1064886:1064900	1079205:1079219
1064886:1064900	attL	GAGTCGGTGGGCCCG	NA	NA	NA	NA
WP_077348566.1|1071606_1073073_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	8.4e-46
WP_077347052.1|1074122_1075061_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	23.0	3.1e-17
WP_152024508.1|1075057_1075993_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077348568.1|1075985_1076978_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	33.2	8.8e-15
WP_077352739.1|1077132_1078119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077348570.1|1078847_1079591_+	phage Gp37/Gp68 family protein	NA	A0A2P1A0W3	Gordonia_phage	44.8	3.2e-62
1079205:1079219	attR	CGGGCCCACCGACTC	NA	NA	NA	NA
>prophage 70
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1086087	1086825	3603805		Planktothrix_phage(100.0%)	1	NA	NA
WP_077348584.1|1086087_1086825_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	9.4e-30
>prophage 71
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1096906	1098295	3603805		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_152024579.1|1096906_1098295_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	24.2	3.5e-17
>prophage 72
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1102772	1103762	3603805		Enterobacteria_phage(100.0%)	1	NA	NA
WP_077348608.1|1102772_1103762_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.7	5.6e-78
>prophage 73
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1110944	1111913	3603805		Streptococcus_phage(100.0%)	1	NA	NA
WP_161490140.1|1110944_1111913_-	WYL domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	28.2	6.2e-05
>prophage 74
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1122701	1123412	3603805		Bacillus_virus(100.0%)	1	NA	NA
WP_077348640.1|1122701_1123412_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	42.8	1.2e-18
>prophage 75
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1127600	1130162	3603805		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_077348650.1|1127600_1130162_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	45.5	7.1e-16
>prophage 76
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1134630	1135314	3603805		Streptomyces_phage(100.0%)	1	NA	NA
WP_077348658.1|1134630_1135314_+	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	43.8	3.2e-16
>prophage 77
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1138468	1142065	3603805		Yellowstone_lake_phycodnavirus(50.0%)	3	NA	NA
WP_077348664.1|1138468_1139635_-	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	27.5	1.4e-14
WP_077348666.1|1139672_1140200_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077348668.1|1140196_1142065_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.1	3.8e-136
>prophage 78
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1146472	1147438	3603805		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077348678.1|1146472_1147438_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.3	5.7e-35
>prophage 79
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1151027	1157265	3603805		Bacillus_phage(75.0%)	6	NA	NA
WP_077348685.1|1151027_1151753_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	3.9e-36
WP_077348687.1|1151749_1153186_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	8.5e-19
WP_077348688.1|1153257_1153629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077348690.1|1153985_1154669_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_077348692.1|1154703_1156596_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	3.6e-49
WP_077348694.1|1156689_1157265_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	70.0	5.2e-76
>prophage 80
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1173962	1219518	3603805	transposase,integrase,tRNA	Mycobacterium_phage(25.0%)	40	1214518:1214577	1215966:1216082
WP_077348716.1|1173962_1177097_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	30.5	1.5e-140
WP_077348719.1|1177196_1178195_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_077348721.1|1178235_1179612_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_152024583.1|1180388_1180730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077348725.1|1180871_1181369_+	SigE family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077348727.1|1181365_1182448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077348729.1|1182455_1183640_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_077348731.1|1183731_1185006_+	aspartate kinase	NA	NA	NA	NA	NA
WP_077348733.1|1185091_1186459_+	carbohydrate ABC transporter, N-acetylglucosamine/diacetylchitobiose-binding protein	NA	NA	NA	NA	NA
WP_077348735.1|1186783_1188454_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	38.0	1.9e-62
WP_077348738.1|1188557_1188851_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_077348741.1|1188885_1189419_+	LytR C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_077348743.1|1189429_1189978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161490143.1|1189984_1190140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077347437.1|1190566_1191829_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077348746.1|1192586_1193762_+	MFS transporter	NA	NA	NA	NA	NA
WP_077352763.1|1193912_1194764_+	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_077352765.1|1194914_1195346_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	33.6	3.8e-07
WP_077348748.1|1195378_1195987_-|tRNA	tRNA adenosine deaminase-associated protein	tRNA	NA	NA	NA	NA
WP_179947140.1|1196047_1196707_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_077348752.1|1197162_1198119_-	squalene cyclase	NA	NA	NA	NA	NA
WP_152024585.1|1198181_1198946_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_161490144.1|1199367_1199799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077348759.1|1199882_1200965_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_077348761.1|1200957_1201869_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_077348763.1|1202111_1202291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077348765.1|1202518_1202773_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_077348768.1|1202811_1203771_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_152024587.1|1205310_1205796_-	phosphotransferase	NA	NA	NA	NA	NA
WP_077348775.1|1205875_1206262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077348777.1|1206340_1206748_-	HIT family protein	NA	NA	NA	NA	NA
WP_152024821.1|1208052_1209276_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	75.9	2.0e-173
WP_077348781.1|1209715_1210612_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_161490146.1|1210909_1211653_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	28.2	3.1e-12
WP_152024820.1|1211889_1213113_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	75.9	2.0e-173
WP_077352769.1|1213254_1214517_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1214518:1214577	attL	CGACAGCTTCTCTCCAACCTCCACACCCCATCGTGGCCGGCCACTGTTTCCCGGGGAAAA	NA	NA	NA	NA
WP_152024588.1|1214708_1215965_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_161490147.1|1216390_1217179_+	hypothetical protein	NA	A0A0U3U8Y8	Bacillus_phage	27.1	1.2e-14
1215966:1216082	attR	CGACAGCTTCTCTCCAACCTCCACACCCCATCGTGGCCGGCCACTGTTTCCCGGGGAAAAGTATGTGAGGTACGGCCCCTTCGTTCGCGGGGACTATGTATGAGTGTCGTCGTCGTT	NA	NA	NA	NA
WP_077348790.1|1217386_1218715_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_077348793.1|1218711_1219518_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	2.3e-37
>prophage 81
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1234634	1235723	3603805		Planktothrix_phage(100.0%)	1	NA	NA
WP_077348826.1|1234634_1235723_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	4.3e-23
>prophage 82
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1241257	1241743	3603805		Streptococcus_phage(100.0%)	1	NA	NA
WP_077348834.1|1241257_1241743_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.0	7.8e-25
>prophage 83
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1255782	1258878	3603805		Chrysochromulina_ericina_virus(50.0%)	4	NA	NA
WP_077348854.1|1255782_1256847_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	33.4	1.0e-37
WP_077348856.1|1256868_1257363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077348858.1|1257600_1257906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077348860.1|1257996_1258878_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	8.1e-20
>prophage 84
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1265976	1270174	3603805		Moumouvirus(50.0%)	4	NA	NA
WP_077348872.1|1265976_1267065_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	31.2	2.6e-36
WP_077348874.1|1267065_1267659_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_077348876.1|1268243_1269326_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077352777.1|1269337_1270174_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	3.4e-12
>prophage 85
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1274927	1276358	3603805		Dickeya_phage(100.0%)	1	NA	NA
WP_179947141.1|1274927_1276358_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	65.9	2.5e-42
>prophage 86
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1280484	1312620	3603805	transposase,integrase,tRNA	Mycobacterium_phage(33.33%)	24	1286053:1286071	1318195:1318213
WP_077352779.1|1280484_1280751_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077348894.1|1282405_1284805_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_161490153.1|1285184_1285733_+	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_077348898.1|1285855_1287193_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
1286053:1286071	attL	CGACGAGGTCATCGTCGAG	NA	NA	NA	NA
WP_077348899.1|1287189_1288542_+	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_077348900.1|1288529_1291229_-	stealth conserved region 3 domain-containing protein	NA	NA	NA	NA	NA
WP_077348901.1|1291231_1292104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077348903.1|1292160_1293816_-	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_077348905.1|1293850_1294732_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_077348907.1|1294728_1295526_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_077348909.1|1295522_1296320_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_077352781.1|1296270_1297005_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077348911.1|1297272_1298079_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_077348913.1|1298128_1299403_-|tRNA	serine--tRNA ligase	tRNA	A0A2K9L088	Tupanvirus	35.3	4.2e-62
WP_179947142.1|1299481_1300663_+	MFS transporter	NA	NA	NA	NA	NA
WP_077348917.1|1300667_1301375_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077348919.1|1301456_1302956_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_077348921.1|1303242_1304544_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	57.0	7.5e-139
WP_058954393.1|1305059_1305512_+	DUF1931 family protein	NA	NA	NA	NA	NA
WP_077348923.1|1305846_1306788_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	24.7	2.3e-17
WP_161490154.1|1306784_1307720_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_152024821.1|1307986_1309210_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	75.9	2.0e-173
WP_077348925.1|1309202_1310180_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	23.6	4.5e-11
WP_077348927.1|1311153_1312620_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	2.9e-46
1318195:1318213	attR	CTCGACGATGACCTCGTCG	NA	NA	NA	NA
>prophage 87
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1316292	1320339	3603805		Bacillus_phage(100.0%)	1	NA	NA
WP_077348933.1|1316292_1320339_-	type VII secretion protein EccCa	NA	A0A0A0RUH6	Bacillus_phage	26.6	5.0e-16
>prophage 88
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1344913	1345600	3603805		Bacillus_phage(100.0%)	1	NA	NA
WP_077348971.1|1344913_1345600_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	1.4e-27
>prophage 89
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1353465	1354263	3603805		Streptococcus_phi-m46.1-like_phage(100.0%)	1	NA	NA
WP_077348989.1|1353465_1354263_+	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	41.1	1.7e-21
>prophage 90
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1358686	1360163	3603805		Planktothrix_phage(50.0%)	2	NA	NA
WP_077349003.1|1358686_1359385_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.7	4.7e-15
WP_077349005.1|1359377_1360163_-	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	26.7	2.0e-14
>prophage 91
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1373189	1374914	3603805		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_077349034.1|1373189_1374914_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.0	1.5e-33
>prophage 92
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1385862	1392760	3603805		Arthrobacter_phage(33.33%)	8	NA	NA
WP_077349063.1|1385862_1386396_-	single-stranded DNA-binding protein	NA	A0A0U4B2E8	Arthrobacter_phage	81.5	4.1e-51
WP_077349065.1|1386514_1386811_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_077349067.1|1386939_1387689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349068.1|1387685_1388066_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_077349070.1|1388217_1388697_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077349072.1|1388698_1389028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152024598.1|1389125_1390907_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	27.0	7.0e-55
WP_077349074.1|1391131_1392760_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	25.4	5.7e-11
>prophage 93
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1395949	1397887	3603805		Moraxella_phage(100.0%)	1	NA	NA
WP_077349081.1|1395949_1397887_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0R6PHP6	Moraxella_phage	24.8	2.2e-30
>prophage 94
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1421861	1424510	3603805		Vibrio_phage(100.0%)	1	NA	NA
WP_077349129.1|1421861_1424510_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.0	7.9e-79
>prophage 95
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1435343	1436477	3603805		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_077352797.1|1435343_1436477_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.9	5.5e-05
>prophage 96
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1441180	1442362	3603805		Listeria_phage(100.0%)	1	NA	NA
WP_077349154.1|1441180_1442362_-	M23 family metallopeptidase	NA	A8ATH6	Listeria_phage	39.8	1.3e-12
>prophage 97
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1454584	1459558	3603805	tRNA	Mycobacterium_phage(50.0%)	2	NA	NA
WP_077352803.1|1454584_1455991_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A249XS88	Mycobacterium_phage	33.3	4.3e-47
WP_161490166.1|1457923_1459558_-	serine/threonine protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	32.6	8.8e-20
>prophage 98
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1482441	1483203	3603805		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_077349206.1|1482441_1483203_-	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	31.9	2.7e-24
>prophage 99
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1487604	1488411	3603805		Enterobacteria_phage(100.0%)	1	NA	NA
WP_077348793.1|1487604_1488411_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	2.3e-37
>prophage 100
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1502902	1503892	3603805		Tupanvirus(100.0%)	1	NA	NA
WP_077349236.1|1502902_1503892_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	34.1	1.8e-44
>prophage 101
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1507749	1508949	3603805		Escherichia_phage(100.0%)	1	NA	NA
WP_077352809.1|1507749_1508949_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	31.8	1.3e-36
>prophage 102
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1513120	1514770	3603805		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077349251.1|1513120_1514770_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	6.6e-15
>prophage 103
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1529633	1530578	3603805		Bacillus_phage(100.0%)	1	NA	NA
WP_077349277.1|1529633_1530578_+	NAD-dependent protein deacetylase	NA	A0A068EPD4	Bacillus_phage	23.8	6.0e-13
>prophage 104
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1538647	1539901	3603805	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_077349293.1|1538647_1539901_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.9	6.1e-13
>prophage 105
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1548123	1549071	3603805		Vibrio_phage(100.0%)	1	NA	NA
WP_077349297.1|1548123_1549071_-	type I-E CRISPR-associated endonuclease Cas1	NA	A0A2D0YZM7	Vibrio_phage	23.9	3.7e-10
>prophage 106
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1575222	1576563	3603805	transposase	Mycobacterium_phage(100.0%)	1	NA	NA
WP_179947143.1|1575222_1576563_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	39.9	1.2e-67
>prophage 107
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1583240	1587990	3603805		Bacillus_virus(100.0%)	2	NA	NA
WP_077349331.1|1583240_1585871_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.0	5.6e-101
WP_077349333.1|1585923_1587990_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.0	7.2e-136
>prophage 108
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1595663	1601748	3603805		Synechococcus_phage(33.33%)	4	NA	NA
WP_077349347.1|1595663_1596542_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	42.9	1.5e-66
WP_077349349.1|1596620_1597781_-	DNA polymerase III subunit beta	NA	A0A0A7HEW5	Arthrobacter_phage	33.7	7.8e-47
WP_077349351.1|1598181_1600746_-	FtsX family ABC transporter permease	NA	NA	NA	NA	NA
WP_179947144.1|1600749_1601748_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.8	2.3e-31
>prophage 109
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1613234	1688065	3603805	transposase,integrase	Mycobacterium_phage(21.43%)	60	1646953:1646970	1686407:1686423
WP_077347044.1|1613234_1613978_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	29.2	8.1e-05
WP_077349379.1|1613974_1615525_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_077349381.1|1616541_1616880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161490174.1|1616991_1617306_+	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_077349385.1|1618484_1619456_+	ParA family protein	NA	Q8JL10	Natrialba_phage	35.0	4.4e-19
WP_077349387.1|1619458_1620346_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	41.0	9.0e-11
WP_077352829.1|1620497_1620797_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_161490175.1|1621151_1621934_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_179947145.1|1621936_1622872_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_077352831.1|1622888_1624121_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	2.2e-15
WP_077349392.1|1624245_1624905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349394.1|1624904_1625222_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.0	7.9e-18
WP_077349396.1|1625316_1626252_-	thioredoxin-disulfide reductase	NA	A0A2K9L4X0	Tupanvirus	45.0	2.5e-72
WP_077349398.1|1626588_1627569_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_077349400.1|1627713_1631580_-	phosphodiester glycosidase family protein	NA	NA	NA	NA	NA
WP_077349402.1|1631752_1632727_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077349404.1|1632833_1633469_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_077349406.1|1633492_1634077_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077349408.1|1634576_1636295_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_152024619.1|1636434_1637427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349412.1|1637604_1637973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077349414.1|1637980_1638706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349416.1|1638835_1639165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349418.1|1639204_1640980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349420.1|1641018_1641462_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_077349422.1|1641547_1642126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349424.1|1642514_1644260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349426.1|1644256_1645216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349428.1|1645323_1645656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077349430.1|1645706_1645952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349432.1|1645948_1646515_-	hypothetical protein	NA	NA	NA	NA	NA
1646953:1646970	attL	GAAGGCGAGCACGTCGGC	NA	NA	NA	NA
WP_077349434.1|1648397_1648586_+	hypothetical protein	NA	NA	NA	NA	NA
1646953:1646970	attL	GAAGGCGAGCACGTCGGC	NA	NA	NA	NA
WP_169836072.1|1648604_1648766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349436.1|1648853_1650014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349438.1|1650583_1651327_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0B5A387	Mycobacterium_phage	27.6	4.6e-08
WP_161490176.1|1651400_1651622_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077349442.1|1651901_1653152_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_077349444.1|1653345_1653576_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077349446.1|1653701_1654259_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_152024620.1|1654383_1655139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077352833.1|1655243_1656233_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_152024621.1|1656672_1658031_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	36.0	1.3e-32
WP_077349454.1|1658332_1658524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077349456.1|1658705_1659320_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_077349458.1|1659331_1661821_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_152024826.1|1662143_1662935_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_077352835.1|1662940_1663939_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_161490177.1|1663994_1665749_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_077349464.1|1665841_1667302_+	sulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	23.8	3.2e-13
WP_077349466.1|1667314_1669513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349468.1|1669509_1672197_-	glycoside hydrolase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_077349470.1|1672223_1675217_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.7	3.6e-136
WP_161490178.1|1675442_1677077_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_077349476.1|1677743_1678997_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_077349478.1|1679325_1679571_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077349480.1|1679628_1681479_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J790	uncultured_Caudovirales_phage	26.2	1.6e-06
WP_077352837.1|1681475_1682501_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_152024623.1|1682629_1683061_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	38.4	1.5e-19
WP_077349482.1|1685236_1686328_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	30.9	8.8e-08
WP_077349486.1|1686820_1688065_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.7	1.2e-82
1690974:1690991	attR	GCCGACGTGCTCGCCTTC	NA	NA	NA	NA
>prophage 110
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1696887	1697688	3603805		Planktothrix_phage(100.0%)	1	NA	NA
WP_077349498.1|1696887_1697688_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	1.2e-14
>prophage 111
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1730937	1732440	3603805		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077349556.1|1730937_1732440_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	6.8e-19
>prophage 112
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1739837	1740560	3603805		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077349572.1|1739837_1740560_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.1	7.1e-30
>prophage 113
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1756151	1814199	3603805	protease,transposase,integrase	Gordonia_phage(22.22%)	39	1768550:1768609	1808401:1809774
WP_179947154.1|1756151_1757420_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	24.7	8.6e-15
WP_161490184.1|1758034_1758355_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	69.8	3.0e-33
WP_152024630.1|1758527_1759352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349612.1|1759359_1765554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349614.1|1765713_1768353_+	hypothetical protein	NA	NA	NA	NA	NA
1768550:1768609	attL	TGTAGTGGGTCAGGTTCCTAAATCCCAAGGCGATCCCGCGGAGGTGTTCGAGGCGTCCGT	NA	NA	NA	NA
WP_077349616.1|1769972_1770275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077349618.1|1771803_1773048_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_077349620.1|1773144_1773333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152024631.1|1773362_1774256_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_077349622.1|1774258_1775650_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_152024632.1|1775900_1777019_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_077349626.1|1777094_1777541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161490185.1|1777537_1780258_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_077349630.1|1780291_1783774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077349631.1|1783754_1786385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077349633.1|1786394_1787177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152024634.1|1787173_1789366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077349637.1|1789365_1790736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077349639.1|1790735_1791755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077349641.1|1791751_1792723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077349643.1|1792722_1793292_+	TerD family protein	NA	NA	NA	NA	NA
WP_161490186.1|1793361_1794381_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_077349647.1|1794569_1796906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349649.1|1797121_1797520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349651.1|1797557_1797953_-	VOC family protein	NA	NA	NA	NA	NA
WP_077349653.1|1798418_1800176_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_179947155.1|1800179_1800683_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_077352847.1|1801112_1801484_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077349657.1|1801546_1802206_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161490187.1|1802202_1802358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077349659.1|1802405_1803659_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.5	1.6e-13
WP_077349661.1|1803658_1804429_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	43.1	4.0e-47
WP_077349663.1|1804461_1805025_+	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	33.6	3.7e-10
WP_077347052.1|1805420_1806359_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	23.0	3.1e-17
WP_152024508.1|1806355_1807291_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077348568.1|1807283_1808276_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	33.2	8.8e-15
WP_077349665.1|1809809_1810202_+	hypothetical protein	NA	NA	NA	NA	NA
1808401:1809774	attR	TGTAGTGGGTCAGGTTCCTAAATCCCAAGGCGATCCCGCGGAGGTGTTCGAGGCGTCCGTTGATCGCTTCGGTTGGGCCGTTGCTGGTGCCTGGGCGGTCGAAGAAGGCGAGCACGTCGGCCGCCCGTCGGTGGAGGGTCCGGCCCAGGCTGACGAGCTCGACGAGGTCTCTCGGGACGCCGGTGCTGACCGAGTCGATCACGCCTTGAAGGAGGAACCGTCCAAGTTGCTTGTCGGGATTCCGGTAAGCCACGACGAGTCGTTGGTAGATACTCCATGTCGCGTAGACCTCGGTGTGCTGTTCGTCGGCGAACAGTGCCTCCAGTCGGGCGACTTGCTTGTCGGTGAGTAGATCGACGCCGGTGAGCAGGGTGCGGCGGGCGCGGTAGAGCGGGTCACCGGCGCGGCCAGCCCCGATGCCCGCAGGTGTCTTGCTGGACGCGCTGGCGGCAGCGGGTGAGCGCTTCGCCGGCGAGCCGGACGACGTGGAACGGGTCCATCACCGTGGTGGCGTTGCCGAGTTCCTCGACCGCCGCGGTCTTGTAGCCGGTGAATCCGTCCATCGCGACGACCTCGATCCCCTTGCGCCAGGCTCGGGGGCGGGCGGCGAGCCACGTCTTGAACACCTGTTTCGAGCGTCCCTCGACCATGTCCAACAAGCGCGCCGGACCGGTGCCGTCCCTGGTGGGGGTGAGGTCGATGATCACGGTGACGTATTTCTCACCACGGCGGGTATGGCGCCAGCAATGCTCGTCGACCCCGATCACCTTGACCCCGTCGAACCGGGCCAGGTCGCTGATGAGGACGCGCTGTCCTTCTGCCAGCACGGCGTCGTTGGCGGTGTTCCACGCGACGTCGAGACCGGCGGCGATCCTGGACATGCTCAGGTGTTGGACCACAAGTCCTTCCAGTCCCCAACGCAGCGCCGCGCGCGACAGCTTCGAACGCGGCTCGGCTGCGGCACTGGTGTCTTGACGCCACACCCGCCCGCACTCGATGCACCGATAGCGCCGGAGCCGCACGTGCAGCACGGTAGGGCGCCACCCCAGCGGGACATGCGACAAGAGTCGCACCACCGAGCCCCGGATGAGGCCCTGGCCGCCGCAGTCTCGGCACCAGTCGTCGGCGTCGACCGGGCGGCAGGCCAGGATCGCACGGTCGGGTTCGATGCGCTGGCCGGTGACTTCCAACCCGAGGCCGTCGAGACGGCAGAAACTAGTCAGATCAGGGCACGTGAAGGTAGCGTCGGACACGTCGAGGTCTTCCAGATGGGGAGCGTGAGAACTTCCATCTTCGGAGGGCCTCGACCCCTTCAGCCAGCCGCCACGCCGCAACCCCGAACAGCGCTACCTACACCCTCGATTGTGAAGAGCC	NA	NA	NA	NA
WP_077349667.1|1810423_1812274_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	21.8	5.8e-12
WP_077349669.1|1812270_1814199_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.6	2.5e-34
>prophage 114
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1821035	1822154	3603805		Orpheovirus(100.0%)	1	NA	NA
WP_077349688.1|1821035_1822154_-	hypothetical protein	NA	A0A2I2L4E3	Orpheovirus	30.1	8.1e-25
>prophage 115
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1827133	1832265	3603805	transposase	Gordonia_phage(33.33%)	5	NA	NA
WP_077349701.1|1827133_1828048_-	Ltp family lipoprotein	NA	A0A0K0MWU9	Gordonia_phage	68.1	3.0e-09
WP_077352597.1|1828372_1829572_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077349703.1|1829631_1830519_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077349705.1|1830787_1830991_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	58.5	6.8e-15
WP_077349707.1|1831170_1832265_+	acyl-CoA desaturase	NA	A6N231	Microbacterium_phage	69.9	1.1e-146
>prophage 116
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1843089	1846383	3603805		Pseudomonas_phage(100.0%)	1	NA	NA
WP_077349733.1|1843089_1846383_-	SMC family ATPase	NA	A0A1S5R3N7	Pseudomonas_phage	23.4	9.4e-05
>prophage 117
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1859902	1861261	3603805	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_152024621.1|1859902_1861261_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	36.0	1.3e-32
>prophage 118
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1866476	1868104	3603805		Planktothrix_phage(50.0%)	2	NA	NA
WP_077349765.1|1866476_1867283_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.0e-16
WP_077352852.1|1867279_1868104_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.8	3.5e-09
>prophage 119
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1872355	1873162	3603805		Enterobacteria_phage(100.0%)	1	NA	NA
WP_077348793.1|1872355_1873162_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	2.3e-37
>prophage 120
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1877026	1879803	3603805		Clostridium_virus(50.0%)	2	NA	NA
WP_077349777.1|1877026_1877944_-	C40 family peptidase	NA	A3QSB3	Clostridium_virus	45.1	2.4e-14
WP_077349779.1|1878315_1879803_-	DEAD/DEAH box helicase	NA	A0A2K9L170	Tupanvirus	23.3	1.0e-11
>prophage 121
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1904222	1906505	3603805		uncultured_virus(100.0%)	1	NA	NA
WP_077349825.1|1904222_1906505_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.2	4.1e-92
>prophage 122
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1910092	1913532	3603805		Enterobacteria_phage(50.0%)	2	NA	NA
WP_077349833.1|1910092_1910644_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	37.6	7.0e-22
WP_077349835.1|1910817_1913532_-	LysM peptidoglycan-binding domain-containing protein	NA	H7BV89	unidentified_phage	53.6	4.1e-06
>prophage 123
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1925339	1929012	3603805		Tupanvirus(50.0%)	3	NA	NA
WP_077349860.1|1925339_1926386_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	42.7	1.1e-71
WP_077349862.1|1926683_1928024_+	MFS transporter	NA	NA	NA	NA	NA
WP_077349864.1|1928028_1929012_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	32.3	1.4e-44
>prophage 124
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1933068	1935959	3603805		Scale_drop_disease_virus(50.0%)	4	NA	NA
WP_077349872.1|1933068_1933566_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	43.9	1.3e-22
WP_077349874.1|1933620_1933812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349876.1|1933948_1934194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077349878.1|1934255_1935959_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	27.0	1.0e-39
>prophage 125
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1945753	1947565	3603805		Bacillus_phage(100.0%)	1	NA	NA
WP_077349898.1|1945753_1947565_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	1.3e-48
>prophage 126
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1958865	1966245	3603805		Sinorhizobium_phage(33.33%)	6	NA	NA
WP_077349910.1|1958865_1961358_-	polynucleotide kinase-phosphatase	NA	S5MD19	Sinorhizobium_phage	28.7	1.0e-11
WP_077349911.1|1961350_1962763_-	3' terminal RNA ribose 2'-O-methyltransferase Hen1	NA	A0A1V0SJM0	Klosneuvirus	26.8	4.9e-11
WP_077349913.1|1962820_1963351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349915.1|1963382_1963907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077349917.1|1964128_1965583_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_077349919.1|1965579_1966245_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.7	2.1e-28
>prophage 127
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	1984901	1986463	3603805		Planktothrix_phage(100.0%)	2	NA	NA
WP_077349954.1|1984901_1985669_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	5.9e-19
WP_077349956.1|1985665_1986463_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.0e-13
>prophage 128
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2015590	2016625	3603805		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_077350004.1|2015590_2016625_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	22.9	9.2e-07
>prophage 129
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2022717	2025349	3603805		Synechococcus_phage(50.0%)	3	NA	NA
WP_077352866.1|2022717_2023410_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.0	1.3e-17
WP_077350016.1|2023469_2024372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077350018.1|2024368_2025349_-	ADP-ribosylglycohydrolase family protein	NA	G3M9X5	Bacillus_virus	22.0	4.8e-05
>prophage 130
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2036407	2040245	3603805		Escherichia_phage(50.0%)	4	NA	NA
WP_077350042.1|2036407_2037766_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	40.3	1.4e-84
WP_077350043.1|2038356_2038671_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_077352872.1|2038707_2038890_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_077350045.1|2039060_2040245_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	58.4	2.3e-17
>prophage 131
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2045084	2049329	3603805		Streptococcus_phage(33.33%)	3	NA	NA
WP_077350055.1|2045084_2046152_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	33.6	1.0e-16
WP_077350057.1|2046159_2047722_-	thiol reductant ABC exporter subunit CydC	NA	A0A2H4UU96	Bodo_saltans_virus	26.7	2.3e-09
WP_077350059.1|2047718_2049329_-	thiol reductant ABC exporter subunit CydD	NA	A0A2R8FG22	Brazilian_cedratvirus	25.9	4.6e-05
>prophage 132
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2056191	2063578	3603805	tRNA	Bacillus_phage(66.67%)	5	NA	NA
WP_077352876.1|2056191_2058108_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	5.1e-59
WP_077350075.1|2058185_2060105_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	1.4e-37
WP_077350078.1|2060581_2060965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161490202.1|2061025_2061586_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077350082.1|2062060_2063578_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	33.0	8.3e-65
>prophage 133
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2066785	2069385	3603805		Acinetobacter_phage(50.0%)	2	NA	NA
WP_077350090.1|2066785_2067424_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	4.9e-43
WP_077350091.1|2067489_2069385_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	V5L5T2	Insectomime_virus	34.7	1.9e-18
>prophage 134
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2085285	2086143	3603805		Pseudomonas_phage(100.0%)	1	NA	NA
WP_077350117.1|2085285_2086143_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.6	3.4e-23
>prophage 135
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2105133	2107991	3603805		Bacillus_virus(50.0%)	2	NA	NA
WP_077350153.1|2105133_2107209_+	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.9	5.4e-14
WP_077350155.1|2107205_2107991_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	1.9e-20
>prophage 136
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2114232	2115378	3603805		Mycobacterium_phage(100.0%)	1	NA	NA
WP_152024654.1|2114232_2115378_+	hypothetical protein	NA	A0A0F6SJV5	Mycobacterium_phage	35.8	3.0e-06
>prophage 137
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2122198	2123539	3603805		Bacillus_phage(100.0%)	1	NA	NA
WP_077350180.1|2122198_2123539_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.6	5.6e-73
>prophage 138
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2127330	2128965	3603805	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_077350188.1|2127330_2128965_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	35.6	3.8e-79
>prophage 139
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2153594	2154605	3603805		Bacillus_virus(100.0%)	1	NA	NA
WP_077350237.1|2153594_2154605_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.2	3.6e-24
>prophage 140
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2159962	2164684	3603805	transposase	Burkholderia_virus(50.0%)	3	NA	NA
WP_077350253.1|2159962_2160964_-	ATP-dependent DNA ligase	NA	C5IHN5	Burkholderia_virus	34.4	6.6e-18
WP_077348636.1|2161806_2163438_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_179947156.1|2163502_2164684_-	glycine C-acetyltransferase	NA	G9E4Q1	Emiliania_huxleyi_virus	29.0	5.4e-35
>prophage 141
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2168648	2171216	3603805		Cronobacter_phage(100.0%)	1	NA	NA
WP_077350265.1|2168648_2171216_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	35.7	2.2e-126
>prophage 142
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2179556	2180886	3603805		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_077350289.1|2179556_2180096_+	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	39.3	6.7e-17
WP_077352888.1|2180172_2180886_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	29.6	5.0e-12
>prophage 143
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2184572	2191813	3603805	transposase	Shigella_phage(33.33%)	6	NA	NA
WP_152024657.1|2184572_2185756_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.0	1.2e-45
WP_077350299.1|2186026_2186281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077348793.1|2186535_2187342_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	2.3e-37
WP_077350301.1|2187338_2188667_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_077350303.1|2188800_2188992_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_077350305.1|2189020_2191813_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.5	9.9e-80
>prophage 144
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2196316	2197456	3603805		Bacillus_phage(100.0%)	1	NA	NA
WP_077350311.1|2196316_2197456_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.4	1.6e-23
>prophage 145
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2200464	2201648	3603805	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_152024659.1|2200464_2201648_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.3	4.0e-46
>prophage 146
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2205505	2207419	3603805		Streptococcus_phage(100.0%)	1	NA	NA
WP_174718230.1|2205505_2207419_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.8	2.2e-91
>prophage 147
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2215216	2218387	3603805		Bacillus_phage(100.0%)	1	NA	NA
WP_077350347.1|2215216_2218387_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	32.7	5.3e-13
>prophage 148
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2223856	2225374	3603805		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077350352.1|2223856_2225374_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	3.5e-15
>prophage 149
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2234929	2238651	3603805		Staphylococcus_phage(50.0%)	3	NA	NA
WP_077350366.1|2234929_2236477_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	1.1e-16
WP_077350368.1|2236754_2237912_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_077350370.1|2237901_2238651_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.0	1.4e-12
>prophage 150
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2245953	2246631	3603805		Synechococcus_phage(100.0%)	1	NA	NA
WP_077352904.1|2245953_2246631_-	fructose-6-phosphate aldolase	NA	A0A1D8KKK9	Synechococcus_phage	29.2	9.0e-19
>prophage 151
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2251532	2252906	3603805		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_152024664.1|2251532_2252906_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	2.7e-38
>prophage 152
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2264906	2308134	3603805	transposase,integrase,tRNA	Mycobacterium_phage(33.33%)	43	2257206:2257222	2296022:2296038
2257206:2257222	attL	CGCGATCACCGTCAACG	NA	NA	NA	NA
WP_077350418.1|2264906_2265920_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	33.6	5.3e-15
WP_152024821.1|2266193_2267417_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	75.9	2.0e-173
WP_077347437.1|2267566_2268829_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077350420.1|2268776_2269376_-|transposase	transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	57.5	4.5e-46
WP_077350422.1|2269495_2270482_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077350424.1|2270478_2271420_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_152024667.1|2271416_2272646_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077350428.1|2272726_2273545_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	57.1	1.1e-76
WP_152024668.1|2273603_2273870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077350432.1|2274184_2274586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152024669.1|2274600_2274882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077350436.1|2275153_2276452_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	54.9	1.8e-129
WP_077347052.1|2276590_2277529_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	23.0	3.1e-17
WP_152024508.1|2277525_2278461_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077348568.1|2278453_2279446_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	33.2	8.8e-15
WP_077349454.1|2279683_2279875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077350438.1|2279871_2281119_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.4	5.6e-83
WP_077350440.1|2281144_2281948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077350442.1|2282134_2283628_+	methylmalonyl-CoA carboxytransferase subunit 5S	NA	NA	NA	NA	NA
WP_077350444.1|2283641_2285198_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_152024670.1|2285209_2285470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077350446.1|2285479_2285839_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_161490209.1|2285990_2287391_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_152024672.1|2287779_2288004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077350450.1|2288073_2288805_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_077350452.1|2288903_2289653_-	phosphoglyceromutase	NA	NA	NA	NA	NA
WP_077350454.1|2289721_2290726_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_077350456.1|2290849_2291515_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_077350458.1|2291710_2292874_+	hypothetical protein	NA	W8CYF6	Bacillus_phage	29.6	2.6e-26
WP_077352910.1|2292876_2293557_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.8	6.4e-41
WP_077350460.1|2293612_2294104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077350462.1|2294259_2294745_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_077352912.1|2294710_2295439_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_077350464.1|2295438_2295912_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_161490210.1|2295917_2297585_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
2296022:2296038	attR	CGCGATCACCGTCAACG	NA	NA	NA	NA
WP_077350468.1|2297659_2299096_-	glycine hydroxymethyltransferase	NA	G9I092	Helicoverpa_zea_nudivirus	40.7	1.4e-74
WP_152024673.1|2299200_2300364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077350472.1|2300377_2301331_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_077350474.1|2301330_2302767_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0U2SJ70	Niemeyer_virus	30.9	7.4e-39
WP_077350476.1|2302836_2304339_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077352913.1|2304402_2305113_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_077350480.1|2305856_2306684_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152024675.1|2306823_2308134_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 153
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2311404	2312493	3603805		Planktothrix_phage(100.0%)	1	NA	NA
WP_077350490.1|2311404_2312493_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	36.0	8.7e-24
>prophage 154
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2316082	2316358	3603805		Gordonia_phage(100.0%)	1	NA	NA
WP_077350498.1|2316082_2316358_+	DUF3263 domain-containing protein	NA	A0A2H4PF05	Gordonia_phage	37.7	8.7e-05
>prophage 155
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2320369	2322001	3603805		uncultured_virus(100.0%)	1	NA	NA
WP_077350508.1|2320369_2322001_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	56.0	2.1e-154
>prophage 156
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2341229	2341613	3603805		Lactococcus_phage(100.0%)	1	NA	NA
WP_077350537.1|2341229_2341613_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	44.4	4.0e-08
>prophage 157
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2354915	2355275	3603805		Indivirus(100.0%)	1	NA	NA
WP_077350557.1|2354915_2355275_+	thioredoxin	NA	A0A1V0SD63	Indivirus	34.1	1.2e-09
>prophage 158
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2367478	2368312	3603805		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077350569.1|2367478_2368312_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.0	1.5e-47
>prophage 159
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2383822	2384329	3603805		Tupanvirus(100.0%)	1	NA	NA
WP_077350594.1|2383822_2384329_-	VOC family protein	NA	A0A2K9L121	Tupanvirus	35.6	2.6e-15
>prophage 160
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2388739	2473375	3603805	transposase,integrase,tRNA	Streptococcus_phage(20.0%)	66	2458504:2458522	2469229:2469247
WP_077350607.1|2388739_2389831_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077350609.1|2391187_2392486_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077350611.1|2392615_2393725_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	38.3	6.5e-51
WP_161490215.1|2393728_2395606_-	ATP-binding protein	NA	A0A2H4J2R8	uncultured_Caudovirales_phage	21.4	2.2e-06
WP_077350615.1|2396976_2397342_+	sulfate permease	NA	NA	NA	NA	NA
WP_077352928.1|2397344_2397839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077350617.1|2398361_2399465_-	transaldolase	NA	NA	NA	NA	NA
WP_179947113.1|2405737_2405881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_179947114.1|2405893_2407906_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.4	1.4e-67
WP_077352930.1|2407984_2409208_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077350621.1|2409194_2409929_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_077352932.1|2410048_2410495_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_077350623.1|2410678_2412055_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_161490216.1|2412629_2413043_+	ROK family protein	NA	NA	NA	NA	NA
WP_077350625.1|2413086_2414532_-	nitrate reductase	NA	Q9KX94	Enterobacteria_phage	42.4	2.5e-79
WP_077350627.1|2414663_2415737_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_077350631.1|2416595_2418176_-	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_077350633.1|2418174_2419023_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	38.5	1.8e-37
WP_077350635.1|2419019_2419886_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_077350637.1|2419878_2420727_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_077350639.1|2420803_2421706_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_077350641.1|2421702_2422191_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077350643.1|2422247_2423012_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161490217.1|2423543_2424911_-	DUF222 domain-containing protein	NA	NA	NA	NA	NA
WP_152024683.1|2425948_2426509_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_077350649.1|2426840_2427287_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_077350651.1|2427929_2428508_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077352936.1|2428556_2430134_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	32.5	1.4e-22
WP_077350653.1|2430139_2431114_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.5	2.0e-51
WP_077352938.1|2431144_2431363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077350655.1|2431440_2432643_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_077350657.1|2432822_2433563_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	9.1e-33
WP_077350659.1|2433562_2436001_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_077350661.1|2436053_2438525_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_077350663.1|2438637_2439657_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_077350665.1|2439718_2441173_+	MFS transporter	NA	NA	NA	NA	NA
WP_077350667.1|2441177_2443466_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.6	1.0e-98
WP_152024684.1|2443536_2444523_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_077350669.1|2444519_2445686_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_077352940.1|2445880_2446885_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_161490218.1|2447048_2447201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077350671.1|2447209_2447443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077350673.1|2447990_2448386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152024820.1|2448460_2449684_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	75.9	2.0e-173
WP_077352942.1|2449886_2450723_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077350675.1|2450964_2451588_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_077350677.1|2451584_2452169_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_077350679.1|2452261_2455750_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_152024685.1|2455750_2456251_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_077350683.1|2456406_2456916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077350685.1|2456918_2457533_+	MazG family protein	NA	NA	NA	NA	NA
WP_077350687.1|2457797_2459078_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.7	1.1e-137
2458504:2458522	attL	ACATCGCGCTCGCCATGGA	NA	NA	NA	NA
WP_152024686.1|2459237_2459729_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_077350691.1|2459762_2460275_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
WP_077350693.1|2460271_2461192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077350695.1|2461346_2463920_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_077350697.1|2463930_2465709_+	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_077347437.1|2465847_2467110_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077350699.1|2467286_2467523_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	55.4	2.9e-17
WP_077350701.1|2467455_2467968_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_077352944.1|2468006_2470106_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.7	1.4e-208
2469229:2469247	attR	ACATCGCGCTCGCCATGGA	NA	NA	NA	NA
WP_077352946.1|2470120_2471086_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	80.8	1.4e-150
WP_077350703.1|2471286_2471469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161490219.1|2471594_2471726_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_077352948.1|2471996_2472554_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_077350707.1|2472580_2473375_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0A0RUJ6	Bacillus_phage	26.8	3.5e-14
>prophage 161
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2477642	2478113	3603805		Wolbachia_phage(100.0%)	1	NA	NA
WP_077350715.1|2477642_2478113_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	33.1	2.6e-09
>prophage 162
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2488474	2489356	3603805		Rhodococcus_phage(100.0%)	1	NA	NA
WP_077350733.1|2488474_2489356_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	37.3	3.1e-35
>prophage 163
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2494236	2548567	3603805	protease,transposase,integrase	Gordonia_phage(23.08%)	53	2495251:2495310	2513910:2514009
WP_077350747.1|2494236_2495250_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	33.2	2.0e-14
2495251:2495310	attL	ACCCCGCACGGTTATGTTGATCGGCTCAGGCCCCAACCCGCACTGGAACAGGCACCCCAC	NA	NA	NA	NA
WP_152024691.1|2497196_2497400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077350301.1|2497487_2498816_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_077348793.1|2498812_2499619_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	2.3e-37
WP_077350751.1|2500132_2500735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152024692.1|2500736_2501402_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_077350753.1|2501460_2501664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077350755.1|2501668_2502358_-	uracil-DNA glycosylase	NA	I7E756	Human_herpesvirus	39.5	1.0e-30
WP_077350757.1|2502474_2503284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077350759.1|2503286_2503727_+	DUF2089 domain-containing protein	NA	NA	NA	NA	NA
WP_077350761.1|2503804_2504308_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_161490221.1|2504320_2504725_-	DUF4307 domain-containing protein	NA	NA	NA	NA	NA
WP_077350763.1|2504788_2505685_+	mycothiol conjugate amidase Mca	NA	NA	NA	NA	NA
WP_077350765.1|2505688_2506288_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_077350767.1|2506361_2508371_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_077352957.1|2508380_2508908_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_077350769.1|2510368_2511217_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_077350771.1|2511452_2512757_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.6	3.3e-179
WP_077350747.1|2512895_2513909_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	33.2	2.0e-14
WP_077350773.1|2514086_2514317_+	hypothetical protein	NA	NA	NA	NA	NA
2513910:2514009	attR	ACCCCGCACGGTTATGTTGATCGGCTCAGGCCCCAACCCGCACTGGAACAGGCACCCCACGACGTCGGTCAACATAACCCCGAGGTCGACATACCATAGC	NA	NA	NA	NA
WP_077352959.1|2514377_2514746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077350775.1|2514748_2515696_+	hypothetical protein	NA	A0A068CDF3	Rhizobium_phage	30.5	7.9e-13
WP_077350777.1|2515904_2517242_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_152024693.1|2517338_2518319_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_161490222.1|2518452_2519448_+	asparaginase	NA	NA	NA	NA	NA
WP_077350781.1|2519596_2521042_+	cytosine permease	NA	NA	NA	NA	NA
WP_077352963.1|2521685_2522147_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_077350783.1|2522521_2523049_-	ROK family protein	NA	NA	NA	NA	NA
WP_077350784.1|2523026_2523749_-	ROK family protein	NA	NA	NA	NA	NA
WP_179947115.1|2524385_2525717_-	PhoH family protein	NA	A0A2I7S805	Vibrio_phage	28.2	9.9e-38
WP_152024831.1|2525946_2526597_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_077350790.1|2526657_2527329_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_077350792.1|2527521_2528322_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	34.6	1.6e-14
WP_161490223.1|2528414_2528981_+	DUF4245 domain-containing protein	NA	NA	NA	NA	NA
WP_077350796.1|2529272_2529494_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_077350798.1|2529486_2530713_-	exodeoxyribonuclease VII large subunit	NA	A0A160DEV2	Gordonia_phage	43.3	1.4e-57
WP_161490224.1|2531179_2532001_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_077350801.1|2532220_2532982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077350803.1|2533034_2534015_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_077350805.1|2534229_2535495_-	threonine ammonia-lyase IlvA	NA	NA	NA	NA	NA
WP_077350807.1|2536054_2536528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152024694.1|2536857_2538360_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_077350809.1|2538478_2539045_-	NADAR family protein	NA	A0A2D2W261	Stenotrophomonas_phage	48.2	1.3e-31
WP_077350811.1|2539192_2539684_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_161490225.1|2539785_2540661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077350814.1|2540754_2541744_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_077352969.1|2541647_2542151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077350816.1|2542501_2543368_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	2.0e-15
WP_077350818.1|2543364_2544411_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_077350820.1|2544403_2545390_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	39.0	1.8e-60
WP_077350822.1|2545482_2546493_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077350824.1|2546884_2547958_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_077350826.1|2548246_2548567_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	52.7	1.4e-19
>prophage 164
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2562883	2570305	3603805	transposase,integrase	Mycobacterium_phage(33.33%)	7	2565599:2565614	2570522:2570537
WP_152024699.1|2562883_2564122_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	42.4	6.8e-57
WP_152024700.1|2564339_2565596_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2565599:2565614	attL	CGGCTCTTCACAGAAG	NA	NA	NA	NA
WP_161490230.1|2565781_2566645_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	58.2	3.1e-93
WP_077350864.1|2566699_2567953_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.5	2.5e-14
WP_077350866.1|2567952_2568723_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.3	6.8e-47
WP_161490231.1|2568791_2569223_+|transposase	transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	54.0	2.6e-32
WP_077350747.1|2569291_2570305_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	33.2	2.0e-14
2570522:2570537	attR	CTTCTGTGAAGAGCCG	NA	NA	NA	NA
>prophage 165
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2578422	2584748	3603805		Bacillus_phage(100.0%)	7	NA	NA
WP_077350892.1|2578422_2580087_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	2.4e-20
WP_077350894.1|2580083_2581787_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	7.8e-19
WP_077350896.1|2581790_2582183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077350898.1|2582258_2582615_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077350900.1|2582617_2583544_+	cation transporter	NA	NA	NA	NA	NA
WP_077350902.1|2583609_2583834_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077350904.1|2583830_2584748_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.8	2.0e-13
>prophage 166
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2593580	2594186	3603805		Streptococcus_phage(100.0%)	1	NA	NA
WP_077350928.1|2593580_2594186_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	30.0	8.3e-16
>prophage 167
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2598722	2600399	3603805		Achromobacter_phage(100.0%)	1	NA	NA
WP_077350940.1|2598722_2600399_+	signal peptide peptidase SppA	NA	A0A0K2FHL6	Achromobacter_phage	27.7	3.4e-11
>prophage 168
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2604462	2605299	3603805		Streptomyces_phage(100.0%)	1	NA	NA
WP_152024703.1|2604462_2605299_-	hypothetical protein	NA	A0A223FZV2	Streptomyces_phage	52.5	7.9e-25
>prophage 169
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2614483	2618619	3603805		Synechococcus_phage(50.0%)	5	NA	NA
WP_077350970.1|2614483_2615221_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KU27	Synechococcus_phage	35.8	1.1e-22
WP_077350972.1|2615223_2615772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077350974.1|2615872_2616040_+	DUF3117 domain-containing protein	NA	NA	NA	NA	NA
WP_077352975.1|2616107_2617295_-	glycogen synthase	NA	NA	NA	NA	NA
WP_077350976.1|2617392_2618619_+	glucose-1-phosphate adenylyltransferase	NA	A0A291LA53	Escherichia_phage	23.6	1.7e-07
>prophage 170
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2633238	2636161	3603805		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_077351002.1|2633238_2635071_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	37.7	2.5e-100
WP_077351004.1|2635228_2636161_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	2.8e-31
>prophage 171
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2640704	2645861	3603805	tRNA	Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	5	NA	NA
WP_077351012.1|2640704_2642756_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.0	1.3e-33
WP_077351014.1|2642781_2643702_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_077351016.1|2643698_2644343_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_077351018.1|2644339_2644825_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077351020.1|2644817_2645861_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.1	3.5e-54
>prophage 172
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2650557	2652282	3603805		Planktothrix_phage(100.0%)	1	NA	NA
WP_077351028.1|2650557_2652282_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	1.1e-25
>prophage 173
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2661354	2665386	3603805		uncultured_virus(66.67%)	3	NA	NA
WP_077351046.1|2661354_2661651_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	3.2e-21
WP_077351048.1|2661666_2663256_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.3	2.6e-154
WP_077351050.1|2663373_2665386_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	26.4	1.2e-50
>prophage 174
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2670671	2672162	3603805		Klosneuvirus(100.0%)	1	NA	NA
WP_179947158.1|2670671_2672162_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.2	1.8e-96
>prophage 175
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2675937	2679999	3603805		Staphylococcus_phage(50.0%)	4	NA	NA
WP_077351078.1|2675937_2676822_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	3.9e-22
WP_077351080.1|2676818_2678462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152024708.1|2678381_2678969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077351084.1|2679069_2679999_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	54.4	1.1e-83
>prophage 176
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2687532	2691047	3603805		Bacillus_phage(50.0%)	2	NA	NA
WP_077352995.1|2687532_2689950_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	37.2	2.9e-120
WP_077351101.1|2690018_2691047_-	M23 family metallopeptidase	NA	A0A222YWR8	Streptomyces_phage	44.2	6.1e-11
>prophage 177
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2696504	2698636	3603805		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_077351109.1|2696504_2697080_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	33.3	1.1e-17
WP_077351111.1|2697058_2698636_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	44.9	3.8e-60
>prophage 178
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2714160	2715000	3603805		Synechococcus_phage(100.0%)	1	NA	NA
WP_077351137.1|2714160_2715000_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	44.2	1.9e-10
>prophage 179
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2718958	2720530	3603805		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077351143.1|2718958_2720530_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.2e-18
>prophage 180
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2725595	2729003	3603805		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_077351155.1|2725595_2727869_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	35.8	2.9e-106
WP_077351159.1|2728154_2729003_+	ribonuclease HI	NA	V9SDF5	Tunisvirus	40.3	9.5e-18
>prophage 181
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2734033	2741226	3603805	transposase,tRNA	Burkholderia_virus(33.33%)	5	NA	NA
WP_179947154.1|2734033_2735302_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	24.7	8.6e-15
WP_077351175.1|2735703_2736261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077351177.1|2736523_2737807_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_077351179.1|2737743_2739045_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	55.3	5.5e-134
WP_077351181.1|2739438_2741226_+|tRNA	methionine--tRNA ligase	tRNA	A0A2K9L3E6	Tupanvirus	31.3	1.3e-69
>prophage 182
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2746148	2751753	3603805		Streptococcus_phage(50.0%)	4	NA	NA
WP_077351191.1|2746148_2747813_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	34.8	1.9e-62
WP_077351193.1|2747812_2748613_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_077351195.1|2748660_2750073_+	NAD(P)H-quinone dehydrogenase	NA	NA	NA	NA	NA
WP_077351197.1|2750079_2751753_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	34.9	2.1e-53
>prophage 183
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2765248	2765749	3603805		Tetraselmis_virus(100.0%)	1	NA	NA
WP_077351225.1|2765248_2765749_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.8	2.1e-20
>prophage 184
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2775090	2777252	3603805		Hokovirus(50.0%)	3	NA	NA
WP_077351237.1|2775090_2776170_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	23.0	1.4e-18
WP_077351239.1|2776202_2776859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077351241.1|2776994_2777252_+	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	73.3	2.9e-26
>prophage 185
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2785635	2790708	3603805		Pandoravirus(25.0%)	5	NA	NA
WP_077351259.1|2785635_2787033_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.3	3.7e-43
WP_077351261.1|2787115_2787358_-	DUF3039 domain-containing protein	NA	A0A2R4A1S7	Microbacterium_phage	51.5	5.3e-14
WP_077351263.1|2787426_2788788_+	MFS transporter	NA	NA	NA	NA	NA
WP_077351265.1|2788816_2789929_-	serine/threonine protein kinase	NA	A0A1V0SDC3	Indivirus	29.5	2.4e-16
WP_077351267.1|2789997_2790708_+	RDD family protein	NA	A0A088F7R2	Mycobacterium_phage	65.6	1.8e-06
>prophage 187
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2973431	2974988	3603805		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077351545.1|2973431_2974988_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	1.7e-12
>prophage 188
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2981174	2981753	3603805		Burkholderia_phage(100.0%)	1	NA	NA
WP_077351558.1|2981174_2981753_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	35.7	1.9e-22
>prophage 189
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2985558	2986842	3603805	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_152024731.1|2985558_2986842_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.4	1.8e-36
>prophage 190
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	2993155	2994964	3603805		Planktothrix_phage(50.0%)	3	NA	NA
WP_077353038.1|2993155_2993869_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	2.0e-32
WP_077351576.1|2994016_2994391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077351578.1|2994673_2994964_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.3	5.4e-05
>prophage 191
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3013510	3014764	3603805		Tupanvirus(100.0%)	1	NA	NA
WP_077351620.1|3013510_3014764_+	cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase	NA	A0A2K9L6B7	Tupanvirus	30.7	4.8e-26
>prophage 192
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3019060	3022410	3603805	tRNA	Vibrio_phage(50.0%)	5	NA	NA
WP_077351632.1|3019060_3019801_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	36.0	3.6e-13
WP_077351634.1|3019836_3020043_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_077351636.1|3020105_3020474_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_077351637.1|3020485_3021286_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_077351639.1|3021300_3022410_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	32.4	1.5e-26
>prophage 193
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3039848	3041102	3603805	tRNA	Serratia_phage(100.0%)	1	NA	NA
WP_077353042.1|3039848_3041102_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	39.4	1.7e-63
>prophage 194
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3057213	3064516	3603805		Only_Syngen_Nebraska_virus(25.0%)	8	NA	NA
WP_077351679.1|3057213_3058857_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.0	2.6e-136
WP_077351681.1|3058861_3059485_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_077353044.1|3059481_3060399_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	32.3	3.1e-30
WP_077351683.1|3060406_3061672_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077353046.1|3061828_3062737_+	ParA family protein	NA	Q8JL10	Natrialba_phage	34.7	7.5e-21
WP_077351685.1|3062733_3063099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152024745.1|3063095_3063929_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_077351689.1|3063925_3064516_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.4	6.2e-08
>prophage 195
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3071550	3078142	3603805		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_077353050.1|3071550_3074286_+	DEAD/DEAH box helicase	NA	M1HM79	Paramecium_bursaria_Chlorella_virus	30.7	2.0e-61
WP_077351707.1|3074338_3075100_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_077351709.1|3075125_3075527_+	HIT family protein	NA	NA	NA	NA	NA
WP_077351711.1|3075631_3076138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077351713.1|3076399_3078142_+	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	1.5e-46
>prophage 196
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3092738	3141368	3603805	protease,transposase,integrase,tRNA	Mycobacterium_phage(27.27%)	44	3095628:3095644	3146481:3146497
WP_077351737.1|3092738_3093662_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_077351739.1|3094735_3095461_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077351741.1|3095561_3096959_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
3095628:3095644	attL	GACCTGCTCTACATCGA	NA	NA	NA	NA
WP_077351743.1|3096976_3097582_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_161490256.1|3097953_3098100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077351745.1|3098144_3098615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077351747.1|3099166_3101242_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_077351749.1|3101523_3101826_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077351751.1|3101829_3102423_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	41.5	2.2e-37
WP_077351753.1|3102419_3103031_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	R9TQF0	Rhizobium_phage	26.2	8.4e-08
WP_161490257.1|3103200_3103500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161490258.1|3103499_3104273_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_162494735.1|3104302_3105421_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_077351759.1|3105422_3106346_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_077351761.1|3106346_3107072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152024748.1|3107354_3109913_+	DNA translocase FtsK 4TM domain-containing protein	NA	S5VNE3	Mycobacterium_phage	55.0	3.2e-101
WP_077351765.1|3109927_3111340_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_077351769.1|3111336_3111945_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_077351770.1|3111977_3112457_+	CinA family protein	NA	NA	NA	NA	NA
WP_077351771.1|3112546_3112822_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077353054.1|3112771_3113593_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_077351772.1|3113806_3114001_+	DUF3046 domain-containing protein	NA	NA	NA	NA	NA
WP_077351773.1|3114206_3115256_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	73.1	2.2e-133
WP_161490259.1|3115245_3115764_+	RecX family transcriptional regulator	NA	NA	NA	NA	NA
WP_077351775.1|3115961_3117569_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_152024749.1|3117629_3118508_-	aldose epimerase	NA	NA	NA	NA	NA
WP_077351778.1|3118578_3119349_-	phosphotransferase	NA	NA	NA	NA	NA
WP_077351780.1|3119443_3120931_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_161490260.1|3121779_3122397_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_179947119.1|3123096_3124389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077351784.1|3124718_3124919_-	antitoxin	NA	NA	NA	NA	NA
WP_077353056.1|3125009_3125954_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_077353058.1|3125953_3126769_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_077351785.1|3126850_3128311_+	GTPase HflX	NA	NA	NA	NA	NA
WP_077353060.1|3128378_3130295_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	27.6	1.3e-46
WP_077351786.1|3130298_3131027_-	transcriptional repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	50.8	3.9e-12
WP_077351787.1|3131225_3131555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077351788.1|3131737_3132253_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_077351789.1|3132303_3135129_+	vitamin B12-dependent ribonucleotide reductase	NA	A0A0H3UYX6	Geobacillus_virus	37.2	2.3e-169
WP_077351791.1|3135565_3136864_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	54.1	1.1e-129
WP_077347052.1|3137002_3137941_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	23.0	3.1e-17
WP_152024508.1|3137937_3138873_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077348568.1|3138865_3139858_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	33.2	8.8e-15
WP_152024751.1|3140084_3141368_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.8	1.1e-36
3146481:3146497	attR	GACCTGCTCTACATCGA	NA	NA	NA	NA
>prophage 197
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3164536	3171867	3603805		Synechococcus_phage(66.67%)	4	NA	NA
WP_077351831.1|3164536_3168334_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	30.3	1.8e-47
WP_077351833.1|3168363_3169203_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_077351835.1|3169317_3170250_-	sigma-70 family RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	35.9	5.3e-38
WP_077351837.1|3170511_3171867_+	RNA polymerase sigma factor	NA	F4YCU2	Synechococcus_phage	38.4	2.3e-42
>prophage 198
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3176339	3178055	3603805		Brevibacillus_phage(100.0%)	1	NA	NA
WP_077351845.1|3176339_3178055_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	23.6	3.1e-15
>prophage 199
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3184312	3186346	3603805		Bacillus_phage(100.0%)	1	NA	NA
WP_152024752.1|3184312_3186346_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	25.6	1.3e-36
>prophage 200
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3201615	3202662	3603805		Escherichia_phage(100.0%)	1	NA	NA
WP_077351873.1|3201615_3202662_-	TerC family protein	NA	A0A1D7XFL1	Escherichia_phage	30.0	3.6e-27
>prophage 201
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3211061	3214646	3603805		Planktothrix_phage(50.0%)	3	NA	NA
WP_077351889.1|3211061_3211835_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	5.4e-20
WP_077351891.1|3211932_3212940_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_077353072.1|3213452_3214646_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	42.3	9.1e-91
>prophage 202
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3219595	3223381	3603805		Stenotrophomonas_phage(50.0%)	6	NA	NA
WP_077351903.1|3219595_3220291_+	SOS response-associated peptidase	NA	V9IQW7	Stenotrophomonas_phage	36.4	4.9e-28
WP_152024840.1|3220393_3221020_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077351907.1|3221019_3221280_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_161490263.1|3221341_3221491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077351909.1|3221526_3222945_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_077351911.1|3223129_3223381_-	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	50.0	5.1e-12
>prophage 203
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3236943	3239754	3603805		Pseudomonas_phage(50.0%)	3	NA	NA
WP_077353074.1|3236943_3238011_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	44.8	6.8e-05
WP_077351931.1|3238007_3238835_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_077351933.1|3238890_3239754_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.3	6.9e-16
>prophage 204
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3275057	3276167	3603805		Faustovirus(100.0%)	1	NA	NA
WP_077351998.1|3275057_3276167_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	26.9	2.1e-17
>prophage 205
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3286823	3290354	3603805	integrase	Pseudomonas_phage(50.0%)	2	3282983:3282998	3295796:3295811
3282983:3282998	attL	GGTCATGAAGGCCATG	NA	NA	NA	NA
WP_077352018.1|3286823_3288290_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.0	5.8e-55
WP_077350747.1|3289340_3290354_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	33.2	2.0e-14
3295796:3295811	attR	GGTCATGAAGGCCATG	NA	NA	NA	NA
>prophage 206
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3295825	3296611	3603805		Acinetobacter_phage(100.0%)	1	NA	NA
WP_077352030.1|3295825_3296611_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	37.8	1.9e-33
>prophage 207
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3308282	3311822	3603805		Saccharomonospora_phage(100.0%)	1	NA	NA
WP_077352046.1|3308282_3311822_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	53.6	0.0e+00
>prophage 208
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3327755	3346094	3603805	tRNA	Tupanvirus(42.86%)	15	NA	NA
WP_077352084.1|3327755_3328895_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	29.6	6.3e-25
WP_077352086.1|3328891_3329431_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.0	6.7e-25
WP_077352088.1|3329481_3330522_+	potassium channel family protein	NA	NA	NA	NA	NA
WP_077352090.1|3330612_3332886_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	39.7	6.1e-11
WP_077352092.1|3332950_3334195_-	DUF349 domain-containing protein	NA	NA	NA	NA	NA
WP_077352094.1|3334225_3334891_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_077352096.1|3334901_3336233_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	29.2	1.2e-30
WP_161490267.1|3336229_3336859_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077352100.1|3336908_3338720_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	25.8	1.6e-14
WP_077352102.1|3339424_3340651_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_077352104.1|3340849_3341365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077352106.1|3341393_3342752_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.2	7.4e-81
WP_152024761.1|3342808_3343189_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_152024762.1|3343185_3343419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077352111.1|3343442_3346094_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	33.2	1.3e-60
>prophage 209
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3362961	3364131	3603805		Mycobacterium_phage(100.0%)	1	NA	NA
WP_077352147.1|3362961_3364131_-	RtcB family protein	NA	G8I4I6	Mycobacterium_phage	60.2	1.5e-122
>prophage 210
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3367435	3368563	3603805		Halovirus(100.0%)	1	NA	NA
WP_077352157.1|3367435_3368563_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.6	9.6e-42
>prophage 211
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3375292	3387195	3603805	tRNA	Staphylococcus_phage(25.0%)	11	NA	NA
WP_077352171.1|3375292_3376480_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.5	5.6e-125
WP_152024766.1|3376482_3378420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077352175.1|3378416_3379328_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	27.5	5.3e-06
WP_077352177.1|3379324_3380713_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_077352179.1|3380932_3381139_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_077352181.1|3381135_3382086_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077352183.1|3382072_3384349_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.3	7.5e-86
WP_179947121.1|3384350_3384692_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_077352185.1|3384831_3385485_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_077352187.1|3385495_3386350_-	PAC2 family protein	NA	NA	NA	NA	NA
WP_169836083.1|3386517_3387195_+	HAD family phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.2	1.9e-05
>prophage 212
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3413979	3416414	3603805	protease	Agrobacterium_phage(50.0%)	2	NA	NA
WP_077352229.1|3413979_3415821_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2L0V0F4	Agrobacterium_phage	36.1	6.6e-40
WP_077352231.1|3415817_3416414_+	radical SAM protein	NA	A0A0U4JTC1	Vibrio_phage	34.5	4.2e-12
>prophage 213
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3436143	3436744	3603805		Brucella_phage(100.0%)	2	NA	NA
WP_077352263.1|3436143_3436437_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	39.5	5.6e-10
WP_077352264.1|3436429_3436744_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	55.8	2.3e-22
>prophage 214
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3442238	3442805	3603805		Propionibacterium_phage(100.0%)	1	NA	NA
WP_161490270.1|3442238_3442805_+	HNH endonuclease	NA	A0A1D8EUE9	Propionibacterium_phage	50.0	8.6e-07
>prophage 215
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3462379	3472126	3603805		Bacillus_phage(33.33%)	8	NA	NA
WP_077353104.1|3462379_3463261_-	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	28.7	6.9e-11
WP_077352311.1|3463316_3464831_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_077352313.1|3464866_3465643_+	polyprenol monophosphomannose synthase	NA	A0A0N9P7Z4	Sulfolobales_Virus_YNP2	34.6	3.1e-23
WP_077352315.1|3465648_3466179_+	FxsA family protein	NA	NA	NA	NA	NA
WP_077352317.1|3466236_3466578_-	RNA polymerase-binding protein RbpA	NA	NA	NA	NA	NA
WP_077352319.1|3466632_3467403_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_077352321.1|3467513_3468389_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_077352323.1|3468370_3472126_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	66.1	5.0e-18
>prophage 216
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3485115	3486897	3603805		Escherichia_phage(100.0%)	1	NA	NA
WP_077352351.1|3485115_3486897_+	site-specific DNA-methyltransferase	NA	A0A023MI13	Escherichia_phage	28.1	8.9e-42
>prophage 217
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3496181	3496622	3603805		Mycobacterium_virus(100.0%)	1	NA	NA
WP_077352365.1|3496181_3496622_+	HIT family protein	NA	G8I9U4	Mycobacterium_virus	40.2	2.1e-08
>prophage 218
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3515163	3517200	3603805	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_077352410.1|3515163_3517200_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.4	5.5e-104
>prophage 219
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3523724	3525224	3603805		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077352427.1|3523724_3525224_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	1.1e-16
>prophage 220
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3542269	3543505	3603805	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_077353110.1|3542269_3543505_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.3	4.4e-80
>prophage 221
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3552498	3553719	3603805		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_077352480.1|3552498_3553719_+	HRDC domain-containing protein	NA	K7XYU9	uncultured_Mediterranean_phage	27.7	1.2e-05
>prophage 222
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3561502	3562630	3603805		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_077352490.1|3561502_3562630_-	class I SAM-dependent RNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	30.6	3.4e-23
>prophage 223
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3569965	3573722	3603805		Streptomyces_phage(50.0%)	7	NA	NA
WP_077352502.1|3569965_3570421_-	dUTP diphosphatase	NA	A0A2L1IVN2	Streptomyces_phage	55.8	2.7e-35
WP_077352504.1|3570417_3570867_-	DUF3093 domain-containing protein	NA	NA	NA	NA	NA
WP_077352506.1|3570929_3571223_+	DUF4235 domain-containing protein	NA	NA	NA	NA	NA
WP_077353116.1|3571292_3571589_-	DUF4193 domain-containing protein	NA	NA	NA	NA	NA
WP_161490283.1|3571767_3572730_+	DUF3071 domain-containing protein	NA	NA	NA	NA	NA
WP_152024794.1|3572701_3572911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077352512.1|3573071_3573722_-	thymidine kinase	NA	E3SFJ8	Shigella_phage	35.9	2.3e-27
>prophage 224
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3577863	3580350	3603805		Bacillus_virus(100.0%)	1	NA	NA
WP_077352522.1|3577863_3580350_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.4	4.4e-87
>prophage 225
NZ_CP019607	Tessaracoccus flavescens strain SST-39T chromosome, complete genome	3603805	3586338	3599519	3603805		Bacillus_virus(25.0%)	9	NA	NA
WP_077352534.1|3586338_3588414_-	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	36.7	3.7e-108
WP_077352536.1|3588539_3588740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161490285.1|3588726_3589557_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_161490286.1|3589553_3592727_-	UvrD-helicase domain-containing protein	NA	Q331U3	Clostridium_botulinum_C_phage	24.5	5.2e-08
WP_077352543.1|3592723_3595816_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	19.5	9.8e-12
WP_152024796.1|3595888_3596857_+	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_161490287.1|3596870_3597677_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_077352549.1|3597708_3597933_+	DUF3107 domain-containing protein	NA	NA	NA	NA	NA
WP_077352551.1|3598088_3599519_+	DEAD/DEAH box helicase	NA	A0A2K9L170	Tupanvirus	24.5	2.6e-20
