The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012098	Anaerostipes hadrus strain BPB5 chromosome, complete genome	3172613	269505	305276	3172613	coat,tail,holin,tRNA,terminase,transposase,integrase,portal	Clostridium_phage(43.75%)	39	282989:283008	285315:285334
WP_008393634.1|269505_270225_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_008393633.1|270217_270733_-	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
WP_009265056.1|271233_272685_-	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_008393630.1|272697_273042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008393628.1|273071_273407_-	PqqD family protein	NA	NA	NA	NA	NA
WP_077325251.1|273487_275425_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_008393626.1|275587_276499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158520172.1|277386_277659_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174566393.1|277642_277999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325253.1|278384_279167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077325255.1|279700_281383_-	glycogen/starch synthase	NA	NA	NA	NA	NA
WP_077325257.1|281583_282132_-	N-acetylmuramoyl-L-alanine amidase	NA	Q8W5Y8	Listeria_phage	37.1	4.2e-19
WP_077325259.1|282131_282593_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_077325261.1|282689_282965_-	hypothetical protein	NA	NA	NA	NA	NA
282989:283008	attL	CAGCTAAATTCTGACTTAAA	NA	NA	NA	NA
WP_015530861.1|283323_283566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325263.1|283761_284757_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145983782.1|284845_285052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077325265.1|285058_285439_-	hypothetical protein	NA	NA	NA	NA	NA
285315:285334	attR	TTTAAGTCAGAATTTAGCTG	NA	NA	NA	NA
WP_077325267.1|285455_285686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325269.1|285700_286333_-	hypothetical protein	NA	A0A0A7S1G0	Clostridium_phage	32.9	1.3e-06
WP_077325271.1|286344_287562_-|tail	phage tail protein	tail	A0A1S5S9Z5	Streptococcus_phage	24.2	2.5e-19
WP_077325274.1|287562_288276_-	mtfA protein	NA	NA	NA	NA	NA
WP_077325276.1|288277_293716_-|tail	phage tail tape measure protein	tail	A0A0A7S163	Clostridium_phage	57.0	1.1e-85
WP_077325278.1|293819_294470_-	hypothetical protein	NA	A0A0A8WII3	Clostridium_phage	34.2	3.5e-28
WP_077325280.1|294466_294817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325282.1|294863_295370_-	hypothetical protein	NA	A0A0A8WJB7	Clostridium_phage	45.1	6.0e-28
WP_077325284.1|295371_295809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325286.1|295805_296135_-	hypothetical protein	NA	A0A0A8WIK8	Clostridium_phage	50.4	4.8e-26
WP_077325288.1|296137_296548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325290.1|296516_296924_-	hypothetical protein	NA	A0A1J1JB19	Escherichia_phage	34.5	2.5e-08
WP_077325292.1|296937_298065_-|coat	phage coat protein	coat	A0A0A7RTH8	Clostridium_phage	67.9	1.2e-137
WP_077325293.1|298080_298677_-	phage scaffolding protein	NA	Q9T1B8	Listeria_phage	36.6	1.9e-20
WP_077325295.1|298945_299266_-	YjcQ family protein	NA	A0A2K9V3K4	Faecalibacterium_phage	49.0	1.2e-21
WP_077325297.1|299258_299564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325299.1|299560_301324_-	hypothetical protein	NA	A0A2K9V3K1	Faecalibacterium_phage	37.0	3.9e-66
WP_077325301.1|301334_302726_-|portal	phage portal protein	portal	F6K8Q7	Clostridium_phage	53.6	2.2e-136
WP_077325303.1|302730_303996_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J4X1	uncultured_Caudovirales_phage	64.2	7.2e-163
WP_099046223.1|303980_304808_-|terminase	terminase small subunit	terminase	E5DV49	Deep-sea_thermophilic_phage	47.3	2.3e-53
WP_077325307.1|304985_305276_-	hypothetical protein	NA	Q5ULN6	Lactobacillus_virus	48.8	5.3e-13
>prophage 2
NZ_CP012098	Anaerostipes hadrus strain BPB5 chromosome, complete genome	3172613	309927	322205	3172613	transposase,integrase	Bacillus_phage(27.27%)	22	311764:311777	324086:324099
WP_077325323.1|309927_311013_-	hypothetical protein	NA	A0A2H4JC51	uncultured_Caudovirales_phage	68.2	1.3e-152
WP_167543146.1|311005_311164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325325.1|311157_311691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325327.1|311677_312040_-	hypothetical protein	NA	NA	NA	NA	NA
311764:311777	attL	CATGATCATCTTCT	NA	NA	NA	NA
WP_077325329.1|312052_312301_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077325331.1|312564_312783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325333.1|313043_313364_-	hypothetical protein	NA	U5J9F3	Bacillus_phage	37.8	2.2e-07
WP_077325335.1|313369_314107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325337.1|314111_314474_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	45.8	1.7e-16
WP_077325339.1|314400_315105_-	hypothetical protein	NA	D7RWH3	Brochothrix_phage	40.0	1.2e-37
WP_077325341.1|315104_315638_-	hypothetical protein	NA	A0A0E3Y6D2	Fusobacterium_phage	49.7	2.8e-39
WP_077325343.1|315647_316139_-	siphovirus Gp157 family protein	NA	H9A0R4	Staphylococcus_phage	44.8	7.4e-31
WP_077325345.1|316140_316458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325347.1|316447_317005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325350.1|317144_317537_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077325352.1|317745_318153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077325354.1|318127_318418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055257911.1|318460_318685_-	helix-turn-helix transcriptional regulator	NA	Q38329	Lactococcus_phage	43.8	4.9e-06
WP_055257768.1|318839_319280_+	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	42.0	2.1e-21
WP_077325356.1|319354_319714_+	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	43.7	2.3e-21
WP_158520173.1|319729_320635_+	InlB B-repeat-containing protein	NA	U5J9H5	Bacillus_phage	46.9	2.0e-10
WP_077325360.1|321179_322205_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BVF7	unidentified_phage	61.3	6.3e-117
324086:324099	attR	CATGATCATCTTCT	NA	NA	NA	NA
>prophage 3
NZ_CP012098	Anaerostipes hadrus strain BPB5 chromosome, complete genome	3172613	485017	534638	3172613	capsid,tail,holin,tRNA,head,plate,protease,terminase,integrase,portal	Clostridium_phage(25.0%)	67	485004:485019	521700:521715
485004:485019	attL	TTTGTTTAGCACTTTT	NA	NA	NA	NA
WP_077325476.1|485017_485524_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0B5D123	Listeria_phage	32.9	2.5e-13
WP_055160857.1|485513_485957_-|holin	phage holin family protein	holin	A0A090D848	Clostridium_phage	49.3	1.3e-29
WP_167543149.1|486030_486198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055160833.1|486197_486482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055160830.1|486478_486802_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_077325478.1|486811_487723_-	hypothetical protein	NA	H7BV37	unidentified_phage	59.1	3.7e-84
WP_145983785.1|487806_488013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077325480.1|488019_488424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325482.1|488425_488962_-	DUF2313 domain-containing protein	NA	A0A0A8WFE8	Clostridium_phage	32.4	1.6e-15
WP_158520175.1|488952_490011_-|plate	baseplate J/gp47 family protein	plate	H7BWD5	unidentified_phage	41.6	6.6e-69
WP_077325486.1|490003_490435_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_077325488.1|490413_490650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325490.1|490649_492380_-	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.0	4.4e-86
WP_055160807.1|492376_493057_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	43.8	4.5e-26
WP_077325492.1|493075_495223_-|tail	phage tail tape measure protein	tail	A0A0A7RUN0	Clostridium_phage	43.9	4.2e-94
WP_055160801.1|495403_495802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055160798.1|495811_496213_-|tail	phage tail tube protein	tail	A0A0A7RVT1	Clostridium_phage	49.6	7.4e-29
WP_077325494.1|496281_497286_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A1V0DZX4	Clostridioides_phage	41.0	2.9e-58
WP_077325496.1|497314_497773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055160789.1|497769_498228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055160786.1|498208_498568_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_055160783.1|498564_498855_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_155512798.1|498841_499003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077327698.1|499006_500212_-|capsid	phage major capsid protein	capsid	U3PDR8	Lactobacillus_phage	50.9	8.9e-94
WP_070097641.1|500241_500844_-|head,protease	HK97 family phage prohead protease	head,protease	NA	NA	NA	NA
WP_055160777.1|500834_502061_-|portal	phage portal protein	portal	A0A075KK59	Lactobacillus_phage	46.1	1.7e-92
WP_055160775.1|502073_503813_-|terminase	terminase	terminase	F7V9A2	Lactobacillus_virus	47.4	4.5e-139
WP_077325498.1|503802_504354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055160770.1|504480_504876_-	HNH endonuclease	NA	A0A0D4DD69	Staphylococcus_phage	36.8	2.4e-08
WP_055160768.1|505460_506009_-|integrase	tyrosine-type recombinase/integrase	integrase	Q8SBK8	Clostridium_phage	53.4	5.9e-45
WP_055160766.1|506135_506333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055160764.1|506878_507286_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1X9I5X0	Streptococcus_phage	36.3	1.2e-15
WP_055160761.1|507376_507547_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PGU2	Moraxella_phage	50.0	3.1e-05
WP_055160758.1|507652_507844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325500.1|508086_508533_-	sigma-70 family RNA polymerase sigma factor	NA	A0A218MNE1	uncultured_virus	31.6	3.0e-07
WP_077325502.1|508609_508897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325504.1|508896_509763_-	hypothetical protein	NA	A0A0S2MYA8	Enterococcus_phage	54.1	1.3e-33
WP_077325506.1|509752_510874_-	ParB N-terminal domain-containing protein	NA	H7BVD1	unidentified_phage	29.9	1.7e-14
WP_077325508.1|510874_511591_-	AAA family ATPase	NA	E9LUK9	Lactobacillus_phage	27.7	4.4e-08
WP_077325510.1|511587_511827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145983787.1|511930_512152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325514.1|512695_513112_-	SPFH domain-containing protein	NA	A3F634	Streptococcus_phage	38.2	5.3e-22
WP_145983788.1|513472_513790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158520176.1|513907_514078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145983789.1|514392_514602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077325518.1|514588_515023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325520.1|515123_515324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077325522.1|515362_515566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325524.1|515672_516467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077325526.1|516450_516687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077325528.1|516761_516962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077325530.1|516979_517198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055160725.1|517304_517538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155512797.1|517518_517683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055160722.1|517706_517940_-	DUF739 family protein	NA	A0A2K9V3Z0	Faecalibacterium_phage	46.4	9.2e-08
WP_055160851.1|518102_518549_+	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	43.9	2.2e-21
WP_070097644.1|518569_518986_+	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	48.1	1.3e-28
WP_077325532.1|519158_520238_+	Abi family protein	NA	X2L062	Streptococcus_phage	29.7	4.4e-20
WP_158520177.1|520493_521684_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_009203066.1|521919_522504_-	cytidylate kinase-like family protein	NA	NA	NA	NA	NA
521700:521715	attR	TTTGTTTAGCACTTTT	NA	NA	NA	NA
WP_009203067.1|522521_523214_-	LrgB family protein	NA	NA	NA	NA	NA
WP_077325536.1|523206_523566_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_077327701.1|529940_531191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009204155.1|531458_532061_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1I9S6C0	Bacillus_phage	32.0	2.7e-06
WP_008391852.1|532064_532805_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_008391851.1|532794_533250_-	ribonuclease III	NA	NA	NA	NA	NA
WP_077325538.1|533234_534638_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	32.3	2.8e-46
>prophage 4
NZ_CP012098	Anaerostipes hadrus strain BPB5 chromosome, complete genome	3172613	1880127	1901980	3172613	transposase,integrase	Streptococcus_phage(94.12%)	28	1876159:1876174	1894448:1894463
1876159:1876174	attL	TATATGAAAATGGAAA	NA	NA	NA	NA
WP_009271880.1|1880127_1881318_-|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	67.3	3.1e-155
WP_004613735.1|1881395_1881599_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	82.1	2.5e-25
WP_025487352.1|1881973_1882213_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_008787630.1|1882205_1882634_-	hypothetical protein	NA	A0A1S5SEW0	Streptococcus_phage	43.1	3.2e-22
WP_008787629.1|1882913_1883138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008787628.1|1883169_1883595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008787627.1|1883569_1883854_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	A0A1X9I6W8	Streptococcus_phage	100.0	4.9e-35
WP_077325578.1|1884028_1885651_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	28.9	5.6e-51
WP_023948524.1|1886133_1886217_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_002292226.1|1886341_1887079_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	1.4e-134
WP_008787625.1|1887644_1888061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008787624.1|1888057_1888261_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008787623.1|1888361_1889273_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	53.6	2.2e-84
WP_008787622.1|1889290_1890298_-	bifunctional lysozyme/C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	67.6	6.4e-130
WP_008787621.1|1890294_1892499_-	MFS transporter	NA	A0A1S5SF30	Streptococcus_phage	51.1	1.6e-181
WP_008787620.1|1892498_1894949_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.4	0.0e+00
1894448:1894463	attR	TTTCCATTTTCATATA	NA	NA	NA	NA
WP_009243016.1|1894926_1895325_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	73.0	4.1e-48
WP_002323345.1|1895441_1895945_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	60.8	7.5e-55
WP_008787619.1|1895962_1896466_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_008787618.1|1896384_1896681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008787617.1|1896790_1897411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323342.1|1897500_1897722_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	87.7	9.0e-29
WP_017143882.1|1897722_1897857_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_008787615.1|1897869_1899066_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	62.3	4.7e-148
WP_077326645.1|1899249_1900644_-	ATP-binding protein	NA	A0A1S5SFB5	Streptococcus_phage	65.9	8.7e-178
WP_021738773.1|1900740_1901154_-	DUF3795 domain-containing protein	NA	NA	NA	NA	NA
WP_077326647.1|1901254_1901638_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	55.1	4.0e-32
WP_002323337.1|1901653_1901980_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	52.4	2.4e-25
>prophage 5
NZ_CP012098	Anaerostipes hadrus strain BPB5 chromosome, complete genome	3172613	1960168	2058915	3172613	capsid,tail,holin,tRNA,head,plate,protease,terminase,transposase,integrase,portal	Clostridium_phage(20.69%)	112	1981902:1981932	2027438:2027468
WP_077326702.1|1960168_1961344_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077326704.1|1961653_1963723_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_077326706.1|1963736_1965707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077326708.1|1965877_1966879_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_015530752.1|1966968_1967385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077326710.1|1968162_1969620_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_077326712.1|1969616_1971260_+	bifunctional anthranilate synthase component II/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	43.7	7.1e-70
WP_008390653.1|1971260_1972052_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	43.7	1.5e-46
WP_077326714.1|1972048_1972708_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_077326716.1|1972700_1973891_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_009265333.1|1973880_1974669_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_009265332.1|1974782_1975973_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_077326718.1|1975999_1977055_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_008390647.1|1977158_1978103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044922292.1|1978192_1979338_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_008390644.1|1979334_1980183_+	thymidylate synthase	NA	A0A0H3V0R8	Geobacillus_virus	45.0	2.2e-62
WP_008390643.1|1980198_1980684_+	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	43.8	3.4e-28
WP_077326720.1|1980975_1981680_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
1981902:1981932	attL	ATGATGAGAGTGTCAAAAGTAAATTTTGCCA	NA	NA	NA	NA
WP_077326722.1|1982150_1983809_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_077326724.1|1983860_1984154_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162494565.1|1984405_1984849_+	hypothetical protein	NA	V9QKZ6	Oenococcus_phage	50.5	6.5e-18
WP_077326728.1|1984872_1985742_+	YARHG domain-containing protein	NA	NA	NA	NA	NA
WP_077326730.1|1985827_1986184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077326732.1|1986273_1987731_+	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_077326733.1|1988026_1988413_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_009204015.1|1988824_1990288_-	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	29.1	2.9e-30
WP_009204016.1|1990547_1990760_+	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	46.7	2.4e-07
WP_009204018.1|1990985_1992044_-	3'-5' exoribonuclease	NA	X2KQX9	Campylobacter_phage	41.4	1.4e-58
WP_009204019.1|1992071_1992461_-	helix-turn-helix transcriptional regulator	NA	A0A2K9V305	Faecalibacterium_phage	63.8	2.3e-19
WP_009204020.1|1992659_1992824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009204021.1|1992804_1993038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077326735.1|1993148_1993370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077326737.1|1993902_1994556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055232120.1|1994560_1994860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167543158.1|1995175_1995325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145983799.1|1995545_1995758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055232118.1|1995851_1996316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015530765.1|1996308_1996758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015530766.1|1996768_1996945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055232116.1|1997122_1997668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009204034.1|1997699_1997885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055232113.1|1997887_1998319_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	41.4	6.1e-13
WP_055232111.1|1998330_1998543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077326741.1|1998983_1999412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055232100.1|1999807_2000218_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_055232098.1|2000227_2000581_+	hypothetical protein	NA	A0A2I7R1U5	Vibrio_phage	28.0	1.7e-05
WP_055232096.1|2000567_2000783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145983800.1|2000776_2000872_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_077327827.1|2001097_2001403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158520186.1|2001910_2002087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077326743.1|2002306_2002720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158520187.1|2002734_2002896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077326745.1|2003126_2003594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009204053.1|2003675_2004164_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_040344398.1|2005901_2007149_+|portal	phage portal protein	portal	A6M949	Geobacillus_virus	50.7	1.1e-115
WP_077327830.1|2007205_2007991_+|protease	Clp protease ClpP	protease	A0A0A7RTN2	Clostridium_phage	54.2	4.3e-57
WP_009204057.1|2007965_2009285_+|capsid	phage major capsid protein	capsid	H7BVF4	unidentified_phage	40.4	1.2e-80
WP_077326747.1|2009288_2009588_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_145983801.1|2009580_2009940_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_040344399.1|2009899_2010085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009204061.1|2010074_2010545_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_077326749.1|2010541_2011000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009204063.1|2010980_2012039_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A090D804	Clostridium_phage	41.0	1.4e-63
WP_009204064.1|2012048_2012483_+|tail	phage tail tube protein	tail	A0A0A7RVT1	Clostridium_phage	47.5	2.1e-29
WP_009204065.1|2012496_2012901_+	phage XkdN-like protein	NA	NA	NA	NA	NA
WP_009204066.1|2012927_2013071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077326751.1|2013060_2015256_+|tail	phage tail tape measure protein	tail	A0A0A7RUN0	Clostridium_phage	45.5	2.2e-90
WP_009204068.1|2015266_2015950_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	44.6	3.4e-26
WP_077326753.1|2015946_2017665_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	39.0	2.7e-88
WP_009204070.1|2017664_2017901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009204071.1|2017900_2018308_+	DUF2634 domain-containing protein	NA	A0A1V0DZX2	Clostridioides_phage	31.2	3.9e-09
WP_077326757.1|2018300_2019359_+|plate	baseplate J/gp47 family protein	plate	H7BWD5	unidentified_phage	38.0	1.9e-60
WP_009204073.1|2019349_2019886_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_077326759.1|2019888_2020269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145983802.1|2020275_2020599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055160824.1|2020621_2021617_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	30.0	7.4e-38
WP_008393607.1|2022093_2022336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077326761.1|2022431_2023343_+	hypothetical protein	NA	H7BV37	unidentified_phage	58.4	6.9e-83
WP_077326763.1|2023352_2023646_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_015530789.1|2023642_2023927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009204619.1|2023926_2024094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009204620.1|2024173_2024656_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_077326765.1|2024656_2025355_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_009204623.1|2025814_2026009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015530792.1|2026055_2026943_-	stage II sporulation protein	NA	NA	NA	NA	NA
WP_008390638.1|2026978_2027434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008390637.1|2027500_2027983_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
2027438:2027468	attR	ATGATGAGAGTGTCAAAAGTAAATTTTGCCA	NA	NA	NA	NA
WP_008390636.1|2027995_2028541_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_077326767.1|2028560_2029430_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_039862599.1|2029472_2029832_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_009265326.1|2030545_2031709_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	57.8	1.6e-116
WP_008390627.1|2031900_2032074_+	DUF4250 domain-containing protein	NA	NA	NA	NA	NA
WP_040344614.1|2032131_2032833_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.3	2.3e-17
WP_009265322.1|2036069_2037386_+	cyclomaltodextrinase	NA	NA	NA	NA	NA
WP_008390622.1|2037455_2039003_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_008390621.1|2039081_2039612_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_008390620.1|2039680_2040244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008390619.1|2040267_2041296_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	32.2	5.9e-46
WP_009204631.1|2041784_2042402_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_077326769.1|2042465_2042858_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_022091036.1|2043024_2043645_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_022091037.1|2043648_2044107_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_055072676.1|2044129_2045266_+	amidohydrolase	NA	NA	NA	NA	NA
WP_008390612.1|2045366_2046857_+	threonine synthase	NA	NA	NA	NA	NA
WP_077326771.1|2047352_2051063_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_009203573.1|2051138_2051456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008390608.1|2051537_2052299_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_077326773.1|2052220_2053804_+	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	30.6	4.4e-08
WP_077326776.1|2053800_2055906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077326778.1|2055964_2056672_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009265489.1|2056684_2057785_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.6	3.8e-75
WP_008390603.1|2057787_2058915_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.1	4.3e-90
>prophage 6
NZ_CP012098	Anaerostipes hadrus strain BPB5 chromosome, complete genome	3172613	3000582	3020628	3172613	integrase	Streptococcus_phage(94.74%)	22	2991502:2991517	3024911:3024926
2991502:2991517	attL	ATAAAACCAGAGGATA	NA	NA	NA	NA
WP_001291561.1|3000582_3001800_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
WP_000814511.1|3001881_3002085_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
WP_000857133.1|3002545_3002776_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000804885.1|3002772_3003195_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_001227347.1|3003699_3004053_+	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_000336323.1|3004112_3004280_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_077327446.1|3004398_3006318_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.2	0.0e+00
WP_001791010.1|3006333_3006450_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001224320.1|3006694_3007630_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.0	7.7e-170
WP_000769868.1|3007626_3008628_-	bifunctional lysozyme/C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
WP_000804748.1|3008624_3010802_-	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
WP_000331160.1|3010804_3013252_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
WP_000506270.1|3013235_3013742_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000342539.1|3013716_3014214_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_001009056.1|3014330_3014552_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000398284.1|3014594_3015800_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_000879507.1|3015822_3015975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813488.1|3015977_3017363_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000985015.1|3017391_3017778_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000420682.1|3017793_3018108_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_077327449.1|3018675_3019740_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_055159336.1|3019755_3020628_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.5	8.2e-33
3024911:3024926	attR	TATCCTCTGGTTTTAT	NA	NA	NA	NA
