The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019442	Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 chromosome, complete genome	4974856	578119	641547	4974856	portal,terminase,lysis,protease,coat,integrase,transposase,holin	Salmonella_phage(48.05%)	85	595638:595683	637656:637701
WP_088895425.1|578119_579347_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001444474.1|580113_580485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016231257.1|580474_580912_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
WP_025693498.1|580973_583079_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	2.7e-90
WP_077141225.1|583078_584500_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	52.7	4.1e-122
WP_000909175.1|584499_585177_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_000420674.1|585170_585632_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001018524.1|585648_585810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077141226.1|586394_589151_-	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	1.5e-298
WP_001208878.1|589137_589509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628967.1|589501_589843_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001058748.1|589853_590456_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
WP_000181940.1|590448_590670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|590666_590930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|590926_591121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025693500.1|591113_592181_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	5.0e-16
WP_000476150.1|592174_592357_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032312024.1|592349_593183_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412531.1|593195_593627_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	2.3e-28
WP_000035054.1|593626_593830_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000772643.1|594257_595472_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
595638:595683	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|595971_596334_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|596330_597263_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|597252_598710_+	glucosyltransferase domain-containing protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129928.1|598768_600772_-	endorhamnosidase	NA	E7C9U9	Salmonella_phage	100.0	0.0e+00
WP_000532175.1|600907_601159_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
WP_001085430.1|601258_601438_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000757527.1|601451_601817_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_000889769.1|601847_602177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262317.1|602194_604108_-	hypothetical protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
WP_033572424.1|604107_605391_-	DNA transfer protein	NA	E7C9U5	Salmonella_phage	94.7	4.5e-221
WP_000964900.1|605401_606091_-	hypothetical protein	NA	E7C9U4	Salmonella_phage	100.0	4.3e-109
WP_000627695.1|606093_606549_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
WP_022631116.1|606548_607250_-	hypothetical protein	NA	B8K1I3	Salmonella_phage	98.7	1.8e-70
WP_033572423.1|607253_608672_-	packaged DNA stabilization protein gp10	NA	A0A220NQZ5	Salmonella_phage	99.6	5.4e-276
WP_001166093.1|608631_609132_-	packaged DNA stabilization gp4 family protein	NA	E7C9U0	Salmonella_phage	100.0	2.5e-90
WP_000538674.1|609115_609676_-	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_022630931.1|609716_611009_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.5	1.2e-242
WP_006831698.1|611008_611920_-	scaffolding protein	NA	Q5C834	Enterobacteria_phage	100.0	1.7e-161
WP_000774652.1|611933_614111_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000417860.1|614110_615610_-|terminase	terminase large subunit	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000729923.1|615587_616076_-	DNA-packaging protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|616079_616484_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|616483_616873_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|616876_617119_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_015995148.1|617341_617872_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	100.0	1.3e-94
WP_001687043.1|618084_618552_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|618548_619046_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|619023_619227_-|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_033572422.1|619764_620538_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	96.5	1.2e-128
WP_023217800.1|620695_620938_-	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	92.5	1.3e-36
WP_033572421.1|620934_621117_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	95.0	3.6e-23
WP_023250726.1|621555_621792_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	97.4	3.9e-38
WP_033572420.1|621784_621961_-	protein ninF	NA	A0A192Y808	Salmonella_phage	91.4	6.9e-24
WP_033572419.1|621953_622355_-	hypothetical protein	NA	G9L690	Escherichia_phage	85.7	2.7e-63
WP_000113767.1|622357_622534_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	98.3	7.9e-28
WP_000679699.1|622500_622674_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
WP_001573980.1|622670_623543_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
WP_000736920.1|623539_623980_-	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	2.9e-79
WP_001248409.1|624053_625430_-	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
WP_000067076.1|625426_626260_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	99.6	2.4e-151
WP_001125981.1|626252_626399_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|626433_626715_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000067726.1|626825_627041_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_023135942.1|627159_627822_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	100.0	1.7e-126
WP_077141227.1|628173_628476_+	regulator	NA	B8K1E6	Salmonella_phage	97.0	2.4e-48
WP_033572417.1|628488_629076_-	superinfection exclusion B family protein	NA	A0A0M4R594	Salmonella_phage	99.0	6.2e-85
WP_033572416.1|629268_629769_+	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.5	1.2e-31
WP_033572415.1|629802_630090_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	97.9	1.1e-47
WP_000141641.1|630424_630583_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|630563_630752_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902090.1|630741_630885_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	97.9	9.3e-19
WP_033572414.1|630881_631589_+	recombinase	NA	A0A1R3Y600	Salmonella_virus	98.7	2.9e-137
WP_001253476.1|631588_631873_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111312.1|631919_632213_+	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_001214769.1|632223_632394_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	94.6	5.7e-23
WP_050517928.1|632390_632915_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	96.9	4.2e-48
WP_033572412.1|633818_634037_+	DUF4014 family protein	NA	C6ZR28	Salmonella_phage	98.6	3.7e-35
WP_033572411.1|634040_634712_+	DUF550 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	64.6	5.6e-90
WP_001277764.1|635338_635518_+	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	100.0	1.9e-29
WP_033572425.1|635618_636248_+	DUF5420 family protein	NA	A0A220NQT7	Salmonella_phage	96.7	7.3e-116
WP_033572410.1|636477_637641_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	99.5	5.3e-229
WP_000893231.1|637846_639097_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
637656:637701	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|639108_640212_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|640494_641547_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
>prophage 2
NZ_CP019442	Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 chromosome, complete genome	4974856	1479588	1526632	4974856	tail,plate,tRNA,holin	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|1479588_1480587_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|1480674_1481985_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|1482231_1482747_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|1482845_1483055_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|1483076_1483190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|1483186_1484512_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|1484690_1485299_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|1485407_1485776_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|1485946_1488367_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|1488465_1489338_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|1489351_1489849_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|1490029_1490947_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|1491110_1492469_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|1492557_1493667_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|1494028_1495219_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|1495350_1496895_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|1496909_1497800_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|1497965_1498376_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|1498518_1500615_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|1500614_1501352_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_125572646.1|1501348_1502017_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|1502050_1502293_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|1502736_1504386_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|1504730_1506080_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|1506212_1506560_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|1507135_1507423_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|1507425_1508031_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|1508043_1508358_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|1508517_1508973_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_000875314.1|1508969_1509167_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|1509156_1510584_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|1510583_1511108_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|1511159_1511477_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|1511436_1511565_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|1511661_1514016_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|1514015_1514969_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|1514968_1515178_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|1515165_1516209_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|1516218_1516941_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|1517268_1517631_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|1517627_1518557_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|1518556_1520104_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|1520267_1520627_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|1520617_1521733_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|1521725_1522358_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|1522360_1524106_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|1524110_1524716_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|1524712_1525168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|1525416_1525707_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|1525903_1526632_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 3
NZ_CP019442	Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 chromosome, complete genome	4974856	2546741	2603408	4974856	portal,terminase,capsid,tail,head,plate,integrase,tRNA,holin	Cronobacter_phage(63.41%)	61	2562029:2562044	2594879:2594894
WP_000785626.1|2546741_2547140_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_033567197.1|2547142_2547448_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877297.1|2547489_2547858_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917516.1|2548002_2548386_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422143.1|2548389_2549052_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|2549501_2550746_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098833.1|2551000_2551969_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_000617687.1|2552241_2553240_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951049.1|2553328_2554021_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|2554172_2554670_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000019989.1|2554755_2555892_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000121523.1|2555972_2557991_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|2558161_2559541_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_000094651.1|2559970_2561491_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
WP_000478472.1|2561878_2563444_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
2562029:2562044	attL	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000983441.1|2563440_2564088_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213760.1|2564319_2565087_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|2565344_2567126_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|2567115_2568153_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568372.1|2568156_2568723_-	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_000514631.1|2568739_2569321_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|2569464_2569686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|2569716_2570220_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|2570229_2570457_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|2570446_2570872_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|2570871_2571273_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|2571340_2571574_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|2571564_2572425_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|2572421_2574443_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000353141.1|2574562_2574769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|2574742_2575066_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|2575062_2576124_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|2576120_2577896_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|2578056_2578860_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|2578921_2579944_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|2579947_2580649_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_001680743.1|2580745_2581198_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_000084218.1|2581194_2581701_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|2581697_2582405_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|2582401_2583529_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|2583525_2583981_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|2583990_2584284_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|2584280_2584622_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|2584621_2584954_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_001670161.1|2584925_2585114_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000411339.1|2585100_2585358_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|2585545_2587516_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|2587512_2587842_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|2587838_2589023_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|2589015_2589603_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|2589612_2591847_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|2591859_2592414_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|2592403_2593129_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|2593100_2593646_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000977530.1|2593645_2595349_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
2594879:2594894	attR	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000340945.1|2596717_2597020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|2597343_2597850_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|2597973_2599821_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|2599970_2601716_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|2601951_2602167_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264394.1|2602394_2603408_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
>prophage 4
NZ_CP019442	Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 chromosome, complete genome	4974856	3135840	3213944	4974856	portal,tRNA,terminase,capsid,tail,head,lysis,protease,integrase,transposase,holin	Salmonella_phage(40.68%)	89	3129297:3129313	3219791:3219807
3129297:3129313	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000183639.1|3135840_3136521_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|3136593_3137013_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|3137216_3138254_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|3138369_3139059_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|3139377_3139761_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|3139822_3140410_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|3140512_3141412_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|3141429_3142764_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|3142894_3143632_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|3143616_3145239_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|3145502_3145667_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|3145663_3146239_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|3146270_3146921_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|3146920_3147877_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|3147873_3148353_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|3148850_3150080_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|3150057_3150342_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|3150382_3150622_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|3150664_3151822_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|3151784_3154712_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|3154838_3155189_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|3155210_3155369_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|3155767_3156172_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|3156301_3156538_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|3156503_3156878_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|3156962_3157946_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|3157948_3158698_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|3158708_3159056_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|3159052_3159577_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|3159576_3160050_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_001217666.1|3160914_3161154_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_000929803.1|3161488_3162091_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|3162299_3162911_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|3162907_3163048_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|3163044_3163722_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|3163994_3164558_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|3165064_3165253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077141236.1|3165467_3166154_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	4.7e-132
WP_088895425.1|3166398_3167627_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001574216.1|3167765_3168095_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|3168078_3168531_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|3168548_3169001_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|3169236_3169638_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|3169924_3170470_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|3170441_3172373_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|3172356_3172560_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|3172556_3174137_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|3174126_3175623_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|3175635_3175983_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|3176037_3177066_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|3177123_3177483_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|3177493_3177877_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|3177904_3178483_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|3178531_3179662_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|3179770_3180172_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_077248250.1|3180179_3180926_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|3180976_3181372_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|3181368_3181707_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|3181678_3184774_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|3184776_3185106_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|3185115_3185814_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|3185820_3186558_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|3186455_3187103_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|3187164_3190527_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|3190565_3190808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|3190861_3193234_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|3193230_3194055_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|3194044_3194623_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|3194719_3194947_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_001738443.1|3195053_3195266_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|3196018_3196138_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|3196850_3196988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|3197466_3198960_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|3199364_3201164_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|3201180_3202155_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|3202428_3203109_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|3203105_3204011_+	GTPase Era	NA	NA	NA	NA	NA
WP_033567169.1|3204022_3204751_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|3204762_3205494_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|3205493_3205874_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|3205985_3206246_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|3206283_3207210_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|3207325_3208522_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684027.1|3208543_3209461_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|3209499_3210348_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|3210463_3211357_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|3211367_3212729_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|3212732_3213368_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|3213392_3213944_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
3219791:3219807	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 5
NZ_CP019442	Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 chromosome, complete genome	4974856	3568096	3597689	4974856	tail,holin,protease	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|3568096_3568591_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|3569004_3569496_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|3569485_3569749_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|3569745_3572232_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|3572238_3572934_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|3572920_3573790_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|3573905_3574355_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|3574364_3574967_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|3574987_3575605_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|3575601_3576261_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|3576312_3577050_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|3577046_3577259_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|3577255_3577735_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|3577731_3579663_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|3579659_3580217_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_033572444.1|3580213_3581257_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|3581300_3581948_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|3582677_3583241_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|3583432_3583636_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|3583938_3584730_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|3585026_3585230_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|3585398_3587765_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|3588093_3589083_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|3589097_3589466_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|3589494_3590826_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|3591122_3591452_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|3592044_3593286_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|3593288_3593816_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|3594193_3594637_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|3594690_3596520_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|3596867_3597158_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|3597185_3597689_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 6
NZ_CP019442	Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 chromosome, complete genome	4974856	3669741	3678912	4974856	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|3669741_3670689_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|3670672_3671404_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3671384_3671492_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|3671551_3672283_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|3672505_3674191_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|3674187_3674907_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3674953_3675421_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|3675477_3676008_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|3676179_3676638_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|3676878_3678912_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 7
NZ_CP019442	Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 chromosome, complete genome	4974856	3747220	3757726	4974856		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|3747220_3748624_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|3748801_3749695_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|3750071_3751157_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|3751156_3752056_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|3752103_3752982_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|3752982_3753534_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|3753539_3754532_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|3754528_3755302_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|3755306_3756386_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|3756412_3757726_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 8
NZ_CP019442	Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 chromosome, complete genome	4974856	3843720	3894407	4974856	portal,terminase,capsid,tail,head,protease,plate,integrase,holin	Salmonella_phage(81.54%)	70	3838298:3838312	3854428:3854442
3838298:3838312	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|3843720_3844194_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_000598920.1|3845503_3846301_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|3846592_3847582_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|3847583_3847811_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061334.1|3847850_3848420_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|3848423_3849005_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|3849015_3849273_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|3849274_3849808_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|3849878_3850418_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|3850554_3851382_-	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|3851439_3851811_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|3852350_3852575_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|3852537_3852876_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|3853081_3853777_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|3853874_3854099_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|3854127_3854682_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
3854428:3854442	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087404.1|3854678_3855821_+	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|3855817_3856042_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_033567233.1|3856038_3857013_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000054228.1|3857009_3857483_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567232.1|3857479_3858355_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000779148.1|3858363_3858753_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061452.1|3858769_3859630_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_070793644.1|3859637_3860627_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_020899401.1|3860640_3861393_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|3861543_3861801_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|3861946_3862333_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|3862319_3862601_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|3862600_3863215_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|3863211_3863604_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|3864066_3864399_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|3864449_3864800_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|3864925_3865420_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_033567282.1|3865416_3867150_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000605609.1|3867161_3867344_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466255.1|3867343_3868585_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_033567207.1|3868562_3869213_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_033572441.1|3869227_3870433_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033572442.1|3870482_3870683_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_000927721.1|3870685_3871009_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033567256.1|3871005_3871410_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_033567257.1|3871381_3871894_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_000779213.1|3871890_3872448_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_065305283.1|3872469_3872634_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_033567258.1|3872623_3874120_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515953.1|3874119_3874476_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|3874472_3874799_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|3874883_3876809_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|3876825_3877275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033567259.1|3877334_3878675_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001066632.1|3878671_3879730_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|3879729_3880263_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|3880267_3880681_+	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|3880673_3881753_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|3881755_3882343_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|3882329_3883892_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_022742744.1|3883861_3884467_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|3884580_3884814_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|3884888_3885002_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|3885049_3885463_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|3885459_3885672_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|3886865_3887027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|3887153_3887573_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|3887575_3888844_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|3889298_3889511_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|3889521_3889710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|3889970_3891167_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|3891816_3892116_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|3892207_3892903_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|3892976_3894407_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 9
NZ_CP019442	Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 chromosome, complete genome	4974856	4792343	4883260	4974856	terminase,tail,lysis,protease,tRNA,holin	Salmonella_phage(58.7%)	91	NA	NA
WP_000938191.1|4792343_4793024_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|4793644_4794304_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|4794390_4794720_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|4794716_4794998_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|4795046_4795826_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859419.1|4795851_4796400_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|4796614_4797826_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|4797883_4798201_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|4798245_4798659_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|4798832_4799495_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|4799589_4800048_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|4800083_4802138_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|4802261_4802708_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|4802726_4804880_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|4804866_4805472_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|4805688_4806198_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|4806554_4807607_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|4807678_4808131_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|4808316_4810077_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|4810145_4810664_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|4810763_4810931_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_033567177.1|4811186_4811750_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|4811746_4813387_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|4813391_4814645_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|4814659_4816567_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|4816579_4818688_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|4818786_4819896_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|4819892_4820435_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|4820600_4821611_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|4821818_4824431_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|4824857_4825049_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|4825319_4826006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|4825990_4826290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|4826358_4826985_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|4827632_4828601_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|4829076_4829658_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|4829657_4832096_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|4832149_4832392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|4832430_4835781_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_001576012.1|4835852_4836557_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|4836454_4837192_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|4837201_4837897_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|4837986_4838520_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|4838636_4839134_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|4839233_4839566_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|4840686_4841232_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|4841700_4842147_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000984584.1|4842164_4842617_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|4842600_4842930_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_001141973.1|4843205_4843892_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|4844252_4844702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|4844837_4844963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097242.1|4845157_4845847_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_000801757.1|4845843_4845984_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|4845980_4846592_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|4846800_4847403_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|4847487_4847709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|4847818_4848052_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|4848643_4849240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|4849251_4850229_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|4850283_4850541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077141244.1|4850540_4851185_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.3	9.1e-29
WP_000850457.1|4851188_4851497_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|4851500_4851959_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_020899441.1|4851955_4852303_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000800012.1|4852313_4853063_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062943.1|4853065_4854049_-	replication protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|4854133_4854454_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|4854488_4854716_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|4854821_4855256_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|4855552_4855684_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|4855732_4856083_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_020899444.1|4856209_4859410_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_014344386.1|4859372_4860530_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|4860572_4860812_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|4860852_4861101_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|4861145_4862438_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000191399.1|4862632_4863835_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|4863912_4865349_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_077141245.1|4865593_4866808_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|4867124_4867586_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|4867786_4869187_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|4869793_4870885_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|4871069_4872260_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|4872321_4872969_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|4872996_4873545_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|4873804_4875646_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|4875990_4880457_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|4880456_4881161_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|4881141_4882464_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|4882456_4883260_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP019442	Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 chromosome, complete genome	4974856	4933323	4942055	4974856	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|4933323_4934578_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|4935041_4935500_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|4935691_4937968_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|4937998_4938319_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|4938642_4938864_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|4938993_4940940_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|4940936_4942055_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP019443	Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 plasmid unnamed1, complete sequence	233802	62296	176135	233802	protease,transposase,integrase	Escherichia_phage(25.71%)	113	123776:123835	136770:137593
WP_087522250.1|62296_63665_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_000783758.1|63764_63923_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001015182.1|64341_64545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743060.1|64590_64941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001031421.1|65000_65600_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
WP_000778030.1|65699_66644_-	DUF5417 domain-containing protein	NA	NA	NA	NA	NA
WP_001371930.1|67153_67330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272970.1|67745_68930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000710431.1|68995_69277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000893963.1|69533_69740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744346.1|69860_70157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000286107.1|70201_70639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000800252.1|70706_71243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537761.1|71407_71776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000442694.1|72208_72511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032029.1|72867_73152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210769.1|73217_73571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338612.1|73857_74589_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_000952983.1|74590_75772_-	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	3.4e-13
WP_000718549.1|75782_76445_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_046788496.1|76431_77541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046788497.1|77540_79625_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001011151.1|79624_82771_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_000128631.1|82780_83518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071885.1|83514_84000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004209.1|84758_85559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140953.1|85560_86073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196728.1|86666_87713_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001257292.1|87702_89118_+	IncHI-type conjugal transfer protein TrhH	NA	NA	NA	NA	NA
WP_046788498.1|89126_93080_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284752.1|93260_94550_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	32.9	5.5e-09
WP_015059500.1|94657_95176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494967.1|95306_95846_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000720274.1|95993_96743_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_000843244.1|96767_97160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025803.1|97193_97616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000620990.1|97675_98287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031377.1|98393_99203_+	DsbA family protein	NA	NA	NA	NA	NA
WP_042634445.1|99248_100508_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.3	2.6e-96
WP_000111290.1|100491_100926_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
WP_001130842.1|101119_101737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770127.1|101886_102243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152919720.1|102493_102664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|102700_103405_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000434930.1|105617_106244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|106748_107624_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|107658_108627_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_000147567.1|110644_111205_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|111207_114159_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|114167_114569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|114653_115358_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|116282_117167_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_058657119.1|117383_118598_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|118625_118931_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|119042_120536_+|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|120566_120818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|121100_121916_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_085940648.1|122005_123095_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_072202717.1|123292_123772_-	phenol hydroxylase	NA	NA	NA	NA	NA
123776:123835	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|123827_124532_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|126187_126892_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001814923.1|127657_127774_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_025989258.1|127789_129709_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	96.4	0.0e+00
WP_000336323.1|129827_129995_+	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_136655701.1|130002_130233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077141251.1|131290_131785_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_170386723.1|131848_132820_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_077141252.1|132863_133784_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077141253.1|133887_134862_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.5	2.3e-52
WP_000027057.1|134929_135790_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|135972_136530_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|136821_137526_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000939727.1|137678_138500_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
136770:137593	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCACTT	NA	NA	NA	NA
WP_065800310.1|138631_139423_-	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|140421_141126_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000587837.1|141543_142086_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|142098_142959_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|143649_144354_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_031613424.1|146043_146394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|146770_147088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|147138_147546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|147575_148037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|148373_148604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|149265_149499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975182.1|149720_150617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572389.1|150619_151135_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833382.1|151349_152777_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000220758.1|152837_153005_+	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000078514.1|153027_154347_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_001572381.1|154626_155832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|155828_156647_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001426317.1|157289_157670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|157727_158393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053276223.1|159417_160233_-	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
WP_000985911.1|160245_160656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134171.1|160757_160964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088046.1|161024_162350_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_024136327.1|162354_162648_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000341066.1|163251_163644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151575.1|164016_164358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|164449_164641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000077926.1|164690_164972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053338.1|165534_166776_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000301242.1|167204_167780_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_000116677.1|167847_168426_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000255079.1|168474_169515_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007448.1|169537_169993_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054787.1|170015_171173_-	TerD family protein	NA	NA	NA	NA	NA
WP_042634303.1|171172_171754_-	tellurium resistance TerZ family protein	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001035162.1|172077_173136_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001285478.1|173145_174288_+	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001040059.1|174280_175054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042634304.1|175055_176135_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
>prophage 1
NZ_CP019444	Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 plasmid unnamed2, complete sequence	84565	676	24804	84565	transposase	Escherichia_phage(55.56%)	19	NA	NA
WP_001067855.1|676_1381_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_024210412.1|1392_2874_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000948429.1|3202_4402_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|4411_4600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199413.1|5994_9012_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_023408311.1|9231_10233_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	2.6e-51
WP_001310555.1|10341_11358_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_023408309.1|11556_12369_+	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_004201167.1|12372_12738_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|12742_13381_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|13391_14423_-	protein-disulfide reductase DsbD N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|14620_15325_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023063803.1|15446_16361_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|16357_17596_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|17595_18180_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|18672_19437_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001235713.1|19738_20296_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|20478_21339_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|24099_24804_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
