The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017849	Klebsiella variicola strain GJ2 chromosome, complete genome	5600717	1788297	1797744	5600717	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_023297315.1|1788297_1789413_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_023297316.1|1789409_1791350_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	5.0e-38
WP_002896516.1|1791416_1791638_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1791963_1792281_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_012542332.1|1792311_1794591_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
WP_001040187.1|1794709_1794928_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_047666244.1|1795278_1795983_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_022065908.1|1796022_1797744_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.8	1.5e-14
>prophage 2
NZ_CP017849	Klebsiella variicola strain GJ2 chromosome, complete genome	5600717	1894060	1972397	5600717	head,tail,integrase,protease,terminase,capsid,portal,plate	Enterobacteria_phage(43.24%)	84	1935682:1935704	1970880:1970902
WP_002898458.1|1894060_1894720_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
WP_012968604.1|1894988_1896614_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023297339.1|1897151_1899578_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	5.5e-10
WP_023297340.1|1899642_1899981_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_023297341.1|1900019_1901555_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_004179245.1|1901957_1902974_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008805909.1|1902995_1904570_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_023297343.1|1904571_1905600_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	30.1	1.9e-12
WP_008805910.1|1905843_1906764_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	5.3e-14
WP_004183598.1|1906760_1907594_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004183607.1|1907855_1908623_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_008805913.1|1908636_1908978_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_008805914.1|1908993_1909869_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_077139098.1|1909834_1912132_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	46.2	1.0e-05
WP_004179264.1|1912181_1912502_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_032735166.1|1912522_1913599_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_023297345.1|1913908_1916410_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	3.9e-11
WP_008805919.1|1916447_1917413_-	oxidoreductase	NA	NA	NA	NA	NA
WP_077139099.1|1917469_1918918_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_008805921.1|1918936_1920061_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_032753974.1|1920097_1921705_-	BCCT family transporter	NA	NA	NA	NA	NA
WP_022065457.1|1922237_1923323_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_008805923.1|1923405_1924368_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008805924.1|1924364_1925645_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_023297349.1|1925647_1927135_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_002898590.1|1927455_1928013_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_162494428.1|1928038_1928791_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_008805927.1|1929016_1930438_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_008805929.1|1930791_1932183_+	APC family permease	NA	NA	NA	NA	NA
WP_002898600.1|1932302_1932425_-	small membrane protein	NA	NA	NA	NA	NA
WP_023297351.1|1932681_1932903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008805931.1|1932923_1933712_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012542276.1|1933827_1934277_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023297352.1|1934429_1935677_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
1935682:1935704	attL	AAAAACCCGGAGCAATCCGGGTT	NA	NA	NA	NA
WP_044784190.1|1935773_1936781_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.8	1.7e-98
WP_040150881.1|1936868_1937171_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	51.0	1.9e-21
WP_004201487.1|1937265_1937598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087638608.1|1937807_1937987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201494.1|1937998_1938238_+	DUF4754 family protein	NA	NA	NA	NA	NA
WP_077139494.1|1938240_1938513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279602.1|1938581_1938806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139100.1|1938802_1939381_+	3'-5' exoribonuclease	NA	A0A1Q1PW66	Pseudoalteromonas_phage	38.0	4.5e-27
WP_077139101.1|1939389_1939617_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	40.6	5.5e-05
WP_077139102.1|1939613_1939808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139103.1|1939800_1940754_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	55.0	2.1e-82
WP_158520298.1|1940928_1941090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139104.1|1941066_1941444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077139105.1|1941442_1944070_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.4	2.3e-195
WP_077139106.1|1944066_1944300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139107.1|1944967_1945699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139108.1|1946154_1947201_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.1	1.3e-141
WP_077139109.1|1947200_1948922_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	64.9	7.1e-222
WP_077139110.1|1949081_1949915_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.1	3.2e-95
WP_077139111.1|1949939_1950989_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.8	7.4e-105
WP_077139112.1|1951036_1951951_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	74.5	1.5e-85
WP_077139113.1|1952053_1952551_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	68.5	6.5e-59
WP_077139114.1|1952550_1952751_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	66.2	2.3e-15
WP_044784790.1|1952741_1953023_+	hypothetical protein	NA	B9A7B8	Serratia_phage	57.1	1.4e-18
WP_077139115.1|1953019_1953571_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	40.8	1.6e-29
WP_145952626.1|1953567_1953957_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_077139117.1|1954101_1954560_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.4	5.6e-33
WP_077139118.1|1954556_1955198_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	47.3	4.5e-44
WP_077139119.1|1955197_1955782_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	63.5	5.1e-63
WP_077139120.1|1955778_1956144_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	59.1	1.0e-29
WP_077139121.1|1956130_1957030_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.2	4.4e-90
WP_077139122.1|1957022_1957619_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	47.9	2.1e-40
WP_158520299.1|1957623_1959993_+	hypothetical protein	NA	A0A1U9WR19	Escherichia_phage	47.1	2.9e-08
WP_077139124.1|1959995_1960259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145952627.1|1960251_1960440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139125.1|1960445_1961633_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	52.2	2.3e-46
WP_077139126.1|1961732_1962587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077139127.1|1962861_1963350_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	60.5	4.4e-52
WP_077139128.1|1963359_1966305_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	43.8	3.6e-205
WP_077139129.1|1966285_1966426_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	74.4	2.0e-10
WP_032421199.1|1966458_1966758_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	71.9	7.7e-31
WP_023328126.1|1966811_1967327_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.8	3.1e-64
WP_077139130.1|1967326_1968508_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	8.0e-156
WP_077139131.1|1968661_1969816_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.4	9.5e-178
WP_077139132.1|1969860_1970109_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_077139133.1|1970124_1970346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139134.1|1970385_1970772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008805934.1|1970942_1971170_-	hypothetical protein	NA	NA	NA	NA	NA
1970880:1970902	attR	AAAAACCCGGAGCAATCCGGGTT	NA	NA	NA	NA
WP_008805935.1|1971190_1971787_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_071822048.1|1972223_1972397_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 3
NZ_CP017849	Klebsiella variicola strain GJ2 chromosome, complete genome	5600717	2091106	2149596	5600717	head,tail,integrase,terminase,capsid,portal,holin,tRNA	Klebsiella_phage(46.34%)	57	2085460:2085475	2139928:2139943
2085460:2085475	attL	GTATCTGCCCGCTGGC	NA	NA	NA	NA
WP_012542211.1|2091106_2092213_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_008806030.1|2092269_2092728_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032729972.1|2092744_2093395_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_008806032.1|2093635_2094886_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_077139140.1|2095004_2096132_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	58.4	2.6e-119
WP_012542206.1|2096112_2096358_-	excisionase	NA	NA	NA	NA	NA
WP_077139141.1|2096410_2098549_-	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	2.5e-99
WP_014228879.1|2098690_2099035_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_077139142.1|2099077_2099272_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_040234937.1|2099662_2099977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228883.1|2100306_2100690_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	63.5	5.1e-19
WP_023328112.1|2100791_2101016_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	55.2	3.0e-11
WP_048270562.1|2101018_2101573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012542197.1|2101624_2102608_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	56.4	3.6e-45
WP_012542196.1|2102600_2103065_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	70.2	1.7e-61
WP_032754004.1|2103078_2103519_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032754005.1|2103831_2105595_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_021462586.1|2106041_2106269_-	DUF1737 domain-containing protein	NA	NA	NA	NA	NA
WP_021462587.1|2106587_2107334_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	29.8	3.0e-07
WP_021462588.1|2107404_2108094_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.8	5.4e-11
WP_032754006.1|2108532_2108766_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	67.1	1.3e-22
WP_077274161.1|2109108_2109501_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
WP_077139143.1|2109700_2110732_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	50.1	6.6e-98
WP_077139144.1|2110744_2111092_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	88.5	4.7e-56
WP_069134952.1|2111115_2112294_-	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	29.9	1.5e-45
WP_040234927.1|2112283_2113315_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017880269.1|2114212_2114428_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_077139145.1|2114427_2114925_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	87.0	1.5e-79
WP_012542173.1|2114921_2115272_+	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	36.8	3.5e-11
WP_145952629.1|2116220_2116640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749552.1|2116695_2116920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162838183.1|2117098_2117263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|2117246_2117609_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_077139147.1|2117560_2117884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907818.1|2117880_2118312_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_012542168.1|2118560_2118995_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014228904.1|2118994_2120716_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.2	7.2e-190
WP_020318187.1|2120709_2120889_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.9	6.8e-11
WP_047666384.1|2120888_2122148_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.3	5.2e-222
WP_032754009.1|2122184_2123105_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.8e-148
WP_014228907.1|2123182_2124469_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_032754010.1|2124527_2124788_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	3.3e-22
WP_020317538.1|2124768_2125086_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_032754011.1|2125082_2125421_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	88.4	3.1e-52
WP_032754012.1|2125401_2125791_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	83.7	1.2e-55
WP_171972701.1|2125796_2126189_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	93.1	1.0e-59
WP_014228913.1|2126220_2126682_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228914.1|2126739_2127105_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_032754014.1|2127337_2130694_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.3	0.0e+00
WP_017880254.1|2130693_2131032_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
WP_023289191.1|2131028_2131784_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
WP_032754016.1|2131785_2132496_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	89.8	1.4e-134
WP_077274162.1|2132542_2133370_+	hypothetical protein	NA	A0A0S2SY43	Pseudomonas_phage	45.9	1.8e-05
WP_032754018.1|2133385_2133976_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	75.4	5.7e-78
WP_077139148.1|2134038_2146629_+	carbohydrate binding domain-containing protein	NA	Q6UAW1	Klebsiella_phage	48.1	0.0e+00
2139928:2139943	attR	GCCAGCGGGCAGATAC	NA	NA	NA	NA
WP_032754023.1|2146690_2148115_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	49.2	2.4e-98
WP_032754025.1|2148537_2149596_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	8.0e-14
>prophage 4
NZ_CP017849	Klebsiella variicola strain GJ2 chromosome, complete genome	5600717	2339296	2354758	5600717	integrase	Klebsiella_phage(40.0%)	14	2337828:2337841	2350112:2350125
2337828:2337841	attL	TGCCGGTGACGCTG	NA	NA	NA	NA
WP_022065867.1|2339296_2340796_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	33.6	2.3e-59
WP_004140269.1|2340824_2341634_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_008807804.1|2341635_2342628_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_008807805.1|2342627_2343518_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_162494433.1|2343664_2344882_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	2.5e-120
WP_040975856.1|2345452_2345752_-	hypothetical protein	NA	A0A1V0E5P0	Salmonella_phage	55.9	1.5e-13
WP_077139161.1|2345859_2346327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040975858.1|2346360_2346774_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	79.0	9.5e-48
WP_077139162.1|2347178_2347514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043875398.1|2347828_2348293_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	59.2	1.4e-52
WP_043875397.1|2348289_2348772_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	90.6	1.9e-79
WP_077139163.1|2348782_2349163_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	92.1	3.8e-67
WP_077139164.1|2349159_2352231_+	kinase	NA	A0A286S259	Klebsiella_phage	92.2	0.0e+00
2350112:2350125	attR	TGCCGGTGACGCTG	NA	NA	NA	NA
WP_077143823.1|2352286_2354758_+	hypothetical protein	NA	J7HXC9	Pseudomonas_phage	33.3	5.8e-15
>prophage 5
NZ_CP017849	Klebsiella variicola strain GJ2 chromosome, complete genome	5600717	2421461	2448471	5600717	plate,transposase	Cronobacter_phage(25.0%)	19	NA	NA
WP_162494436.1|2421461_2422805_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_046621187.1|2422801_2423491_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_046621190.1|2423487_2425191_+	OmpA family protein	NA	NA	NA	NA	NA
WP_023340018.1|2425195_2425687_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_077139171.1|2425952_2428607_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	1.2e-98
WP_162494480.1|2428608_2431299_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.8	2.1e-18
WP_049152609.1|2431295_2431712_+	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
WP_023157869.1|2433649_2434171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015874726.1|2434339_2434444_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015874727.1|2434415_2434607_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077274163.1|2434657_2435452_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	30.4	2.4e-07
WP_023157866.1|2435438_2436509_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	35.0	3.3e-07
WP_049152832.1|2437778_2438987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077258941.1|2438983_2442439_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_015874732.1|2442438_2444037_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_049152830.1|2444067_2445123_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032739739.1|2445119_2445590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032739741.1|2445667_2447422_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032739743.1|2447385_2448471_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP017849	Klebsiella variicola strain GJ2 chromosome, complete genome	5600717	2678307	2689186	5600717		Escherichia_phage(87.5%)	9	NA	NA
WP_012541792.1|2678307_2678928_-	aldolase	NA	A0A077SK32	Escherichia_phage	98.1	5.7e-113
WP_077139200.1|2678920_2680186_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.4	3.4e-229
WP_008804983.1|2680197_2681100_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.7	1.1e-157
WP_008804982.1|2681360_2682122_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
WP_012968280.1|2682139_2683000_-	class A beta-lactamase LEN-13	NA	A0A077SL40	Escherichia_phage	90.2	3.9e-144
WP_008804980.1|2683294_2683555_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	95.3	3.0e-39
WP_077139201.1|2683641_2684730_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	97.8	7.7e-206
WP_008804978.1|2684758_2686024_-	MFS transporter	NA	NA	NA	NA	NA
WP_077139202.1|2686078_2689186_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.4	0.0e+00
>prophage 7
NZ_CP017849	Klebsiella variicola strain GJ2 chromosome, complete genome	5600717	3793482	3808664	5600717		Bacillus_phage(18.18%)	12	NA	NA
WP_077139363.1|3793482_3794799_-	O9 family phosphomannomutase RfbK1	NA	A0A127AWJ1	Bacillus_phage	26.1	2.6e-30
WP_012967599.1|3794822_3796238_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	3.1e-53
WP_008804104.1|3797315_3798320_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	1.2e-30
WP_004144151.1|3798719_3798842_+	small membrane protein	NA	NA	NA	NA	NA
WP_000704907.1|3799264_3800431_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_023297948.1|3800611_3801166_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
WP_044650166.1|3801180_3802071_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.9	5.3e-27
WP_000676431.1|3802102_3802972_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	9.8e-111
WP_044650165.1|3802998_3804063_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.0e-105
WP_077139364.1|3804221_3805592_-	O9 family phosphomannomutase RfbK1	NA	A0A127AWJ1	Bacillus_phage	26.0	8.4e-32
WP_012967599.1|3805615_3807031_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	3.1e-53
WP_064160974.1|3807257_3808664_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.8e-37
>prophage 8
NZ_CP017849	Klebsiella variicola strain GJ2 chromosome, complete genome	5600717	3850806	3857734	5600717	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_008804077.1|3850806_3852309_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
WP_004201558.1|3852305_3853028_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_008804076.1|3853346_3854708_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.0e-207
WP_162494462.1|3854950_3855847_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	2.1e-15
WP_016161506.1|3856086_3856860_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.0e-26
WP_032736203.1|3856870_3857734_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.5	2.0e-07
>prophage 9
NZ_CP017849	Klebsiella variicola strain GJ2 chromosome, complete genome	5600717	4872974	4890951	5600717	tail,head,terminase,protease,capsid,portal,tRNA	uncultured_Caudovirales_phage(66.67%)	18	NA	NA
WP_008806537.1|4872974_4873988_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	3.7e-109
WP_001144069.1|4874225_4874441_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_008806538.1|4874552_4876298_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	1.2e-75
WP_008806539.1|4876516_4878358_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_008806540.1|4878457_4878964_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_071959634.1|4879302_4880058_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_057201115.1|4880102_4880990_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_077139444.1|4881205_4882867_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	95.7	0.0e+00
WP_004174262.1|4882850_4883207_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	98.3	1.6e-59
WP_032455328.1|4883471_4883915_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	62.6	7.1e-49
WP_023323295.1|4883914_4884208_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	82.5	4.2e-42
WP_004174258.1|4884200_4884539_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	47.7	7.3e-22
WP_004174256.1|4884535_4885771_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	95.9	1.0e-233
WP_077139445.1|4885772_4886333_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	97.8	5.0e-100
WP_004174253.1|4886384_4887545_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.6	6.3e-206
WP_070544411.1|4887800_4888574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004174250.1|4888626_4888872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004174245.1|4889151_4890951_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.0	5.1e-130
>prophage 1
NZ_CP017850	Klebsiella variicola strain GJ2 plasmid pKPGJ-2a, complete sequence	108965	8773	15428	108965		Pectobacterium_phage(16.67%)	10	NA	NA
WP_008324193.1|8773_9028_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	2.1e-13
WP_015493073.1|9220_9412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044789508.1|9454_9961_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_077138929.1|10359_11139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008455408.1|11192_11612_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_008455410.1|11622_11844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008455412.1|11843_12521_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	37.0	9.5e-29
WP_077138930.1|12880_13552_+	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	9.0e-80
WP_015493080.1|13731_14154_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_077138931.1|14153_15428_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.8	4.3e-155
>prophage 2
NZ_CP017850	Klebsiella variicola strain GJ2 plasmid pKPGJ-2a, complete sequence	108965	20047	30856	108965	transposase	Burkholderia_phage(42.86%)	9	NA	NA
WP_042005150.1|20047_20680_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.2	9.6e-07
WP_045358108.1|20733_20934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113343.1|21079_22009_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.4e-75
WP_072094655.1|23234_24638_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|24671_25886_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001749988.1|26125_26695_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_001067855.1|27012_27717_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_077138935.1|27722_27962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001553819.1|27958_30856_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 1
NZ_CP017851	Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence	92232	22245	33029	92232	integrase	Macacine_betaherpesvirus(25.0%)	12	19989:20002	29633:29646
19989:20002	attL	GCGGTTTTCCCAGC	NA	NA	NA	NA
WP_029497485.1|22245_23025_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	7.1e-52
WP_032433931.1|23082_23340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072094.1|23467_23581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012539983.1|24212_24968_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_015632469.1|25758_26964_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_032741647.1|26963_27938_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.3	4.2e-86
WP_077138871.1|28019_29291_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.2	2.3e-148
WP_020805749.1|29290_29722_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
29633:29646	attR	GCTGGGAAAACCGC	NA	NA	NA	NA
WP_077138872.1|29954_30926_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_001568039.1|30928_31600_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_048322267.1|31661_31892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|32327_33029_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 1
NZ_CP017852	Klebsiella variicola strain GJ2 plasmid pKPGJ-2c, complete sequence	66447	1256	44332	66447	protease,transposase	Escherichia_phage(35.71%)	39	NA	NA
WP_001067858.1|1256_1961_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_050190632.1|2727_3588_-	class A beta-lactamase TEM-215	NA	Q1MVP3	Enterobacteria_phage	99.7	5.1e-160
WP_001235713.1|3770_4328_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|4563_5268_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001398199.1|6578_6980_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|6912_7170_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|7262_7916_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000130646.1|8854_9712_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|9704_9779_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083830.1|10016_10271_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000184001.1|10603_11809_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|11819_12125_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|12351_13116_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|13608_14193_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|14192_15431_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|15427_16333_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067834.1|16454_17159_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000018329.1|17309_18125_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|18314_19019_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|20408_21077_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|21112_21349_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|21345_21708_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|21725_23420_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001447540.1|23471_23894_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|23929_24205_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|24218_24569_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|24640_25075_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000766807.1|25202_25793_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001298565.1|25830_26040_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001233838.1|26085_26547_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001309245.1|26791_27004_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139323.1|27132_27693_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704523.1|27795_28656_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.9e-10
WP_000205725.1|28714_29461_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	2.4e-09
WP_015059148.1|29480_34751_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_077138923.1|36484_38512_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_046499086.1|38508_39798_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_046499093.1|39801_43059_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_040217779.1|43063_44332_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.4	1.5e-59
