The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017284	Klebsiella variicola strain GJ1 chromosome, complete genome	5600718	1788298	1797745	5600718	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_023297315.1|1788298_1789414_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_023297316.1|1789410_1791351_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	5.0e-38
WP_002896516.1|1791417_1791639_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1791964_1792282_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_012542332.1|1792312_1794592_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
WP_001040187.1|1794710_1794929_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_047666244.1|1795279_1795984_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_022065908.1|1796023_1797745_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.8	1.5e-14
>prophage 2
NZ_CP017284	Klebsiella variicola strain GJ1 chromosome, complete genome	5600718	1894061	1972398	5600718	terminase,capsid,plate,protease,integrase,portal,tail,head	Enterobacteria_phage(43.24%)	84	1935683:1935705	1970881:1970903
WP_002898458.1|1894061_1894721_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
WP_012968604.1|1894989_1896615_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023297339.1|1897152_1899579_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	5.5e-10
WP_023297340.1|1899643_1899982_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_023297341.1|1900020_1901556_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_004179245.1|1901958_1902975_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008805909.1|1902996_1904571_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_023297343.1|1904572_1905601_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	30.1	1.9e-12
WP_008805910.1|1905844_1906765_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	5.3e-14
WP_004183598.1|1906761_1907595_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004183607.1|1907856_1908624_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_008805913.1|1908637_1908979_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_008805914.1|1908994_1909870_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_077139098.1|1909835_1912133_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	46.2	1.0e-05
WP_004179264.1|1912182_1912503_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_032735166.1|1912523_1913600_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_023297345.1|1913909_1916411_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	3.9e-11
WP_008805919.1|1916448_1917414_-	oxidoreductase	NA	NA	NA	NA	NA
WP_077139099.1|1917470_1918919_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_008805921.1|1918937_1920062_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_032753974.1|1920098_1921706_-	BCCT family transporter	NA	NA	NA	NA	NA
WP_022065457.1|1922238_1923324_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_008805923.1|1923406_1924369_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008805924.1|1924365_1925646_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_023297349.1|1925648_1927136_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_002898590.1|1927456_1928014_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_162494428.1|1928039_1928792_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_008805927.1|1929017_1930439_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_008805929.1|1930792_1932184_+	APC family permease	NA	NA	NA	NA	NA
WP_002898600.1|1932303_1932426_-	small membrane protein	NA	NA	NA	NA	NA
WP_023297351.1|1932682_1932904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008805931.1|1932924_1933713_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012542276.1|1933828_1934278_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023297352.1|1934430_1935678_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
1935683:1935705	attL	AAAAACCCGGAGCAATCCGGGTT	NA	NA	NA	NA
WP_044784190.1|1935774_1936782_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.8	1.7e-98
WP_040150881.1|1936869_1937172_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	51.0	1.9e-21
WP_004201487.1|1937266_1937599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087638608.1|1937808_1937988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201494.1|1937999_1938239_+	DUF4754 family protein	NA	NA	NA	NA	NA
WP_077139494.1|1938241_1938514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279602.1|1938582_1938807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139100.1|1938803_1939382_+	3'-5' exoribonuclease	NA	A0A1Q1PW66	Pseudoalteromonas_phage	38.0	4.5e-27
WP_077139101.1|1939390_1939618_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	40.6	5.5e-05
WP_077139102.1|1939614_1939809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139103.1|1939801_1940755_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	55.0	2.1e-82
WP_158520298.1|1940929_1941091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139104.1|1941067_1941445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077139105.1|1941443_1944071_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.4	2.3e-195
WP_077139106.1|1944067_1944301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139107.1|1944968_1945700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139108.1|1946155_1947202_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.1	1.3e-141
WP_077139109.1|1947201_1948923_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	64.9	7.1e-222
WP_077139110.1|1949082_1949916_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.1	3.2e-95
WP_077139111.1|1949940_1950990_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.8	7.4e-105
WP_077139112.1|1951037_1951952_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	74.5	1.5e-85
WP_077139113.1|1952054_1952552_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	68.5	6.5e-59
WP_077139114.1|1952551_1952752_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	66.2	2.3e-15
WP_044784790.1|1952742_1953024_+	hypothetical protein	NA	B9A7B8	Serratia_phage	57.1	1.4e-18
WP_077139115.1|1953020_1953572_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	40.8	1.6e-29
WP_145952626.1|1953568_1953958_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_077139117.1|1954102_1954561_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.4	5.6e-33
WP_077139118.1|1954557_1955199_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	47.3	4.5e-44
WP_077139119.1|1955198_1955783_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	63.5	5.1e-63
WP_077139120.1|1955779_1956145_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	59.1	1.0e-29
WP_077139121.1|1956131_1957031_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.2	4.4e-90
WP_077139122.1|1957023_1957620_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	47.9	2.1e-40
WP_158520299.1|1957624_1959994_+	hypothetical protein	NA	A0A1U9WR19	Escherichia_phage	47.1	2.9e-08
WP_077139124.1|1959996_1960260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145952627.1|1960252_1960441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139125.1|1960446_1961634_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	52.2	2.3e-46
WP_077139126.1|1961733_1962588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077139127.1|1962862_1963351_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	60.5	4.4e-52
WP_077139128.1|1963360_1966306_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	43.8	3.6e-205
WP_077139129.1|1966286_1966427_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	74.4	2.0e-10
WP_032421199.1|1966459_1966759_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	71.9	7.7e-31
WP_023328126.1|1966812_1967328_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.8	3.1e-64
WP_077139130.1|1967327_1968509_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	8.0e-156
WP_077139131.1|1968662_1969817_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.4	9.5e-178
WP_077139132.1|1969861_1970110_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_077139133.1|1970125_1970347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139134.1|1970386_1970773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008805934.1|1970943_1971171_-	hypothetical protein	NA	NA	NA	NA	NA
1970881:1970903	attR	AAAAACCCGGAGCAATCCGGGTT	NA	NA	NA	NA
WP_008805935.1|1971191_1971788_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_071822048.1|1972224_1972398_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 3
NZ_CP017284	Klebsiella variicola strain GJ1 chromosome, complete genome	5600718	2091107	2149597	5600718	terminase,tRNA,capsid,holin,integrase,portal,tail,head	Klebsiella_phage(46.34%)	57	2085461:2085476	2139929:2139944
2085461:2085476	attL	GTATCTGCCCGCTGGC	NA	NA	NA	NA
WP_012542211.1|2091107_2092214_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_008806030.1|2092270_2092729_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032729972.1|2092745_2093396_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_008806032.1|2093636_2094887_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_077139140.1|2095005_2096133_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	58.4	2.6e-119
WP_012542206.1|2096113_2096359_-	excisionase	NA	NA	NA	NA	NA
WP_077139141.1|2096411_2098550_-	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	2.5e-99
WP_014228879.1|2098691_2099036_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_077139142.1|2099078_2099273_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_040234937.1|2099663_2099978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228883.1|2100307_2100691_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	63.5	5.1e-19
WP_023328112.1|2100792_2101017_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	55.2	3.0e-11
WP_048270562.1|2101019_2101574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012542197.1|2101625_2102609_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	56.4	3.6e-45
WP_012542196.1|2102601_2103066_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	70.2	1.7e-61
WP_032754004.1|2103079_2103520_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032754005.1|2103832_2105596_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_021462586.1|2106042_2106270_-	DUF1737 domain-containing protein	NA	NA	NA	NA	NA
WP_021462587.1|2106588_2107335_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	29.8	3.0e-07
WP_021462588.1|2107405_2108095_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.8	5.4e-11
WP_032754006.1|2108533_2108767_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	67.1	1.3e-22
WP_077274161.1|2109109_2109502_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
WP_077139143.1|2109701_2110733_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	50.1	6.6e-98
WP_077139144.1|2110745_2111093_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	88.5	4.7e-56
WP_069134952.1|2111116_2112295_-	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	29.9	1.5e-45
WP_040234927.1|2112284_2113316_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017880269.1|2114213_2114429_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_077139145.1|2114428_2114926_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	87.0	1.5e-79
WP_012542173.1|2114922_2115273_+	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	36.8	3.5e-11
WP_145952629.1|2116221_2116641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749552.1|2116696_2116921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162838183.1|2117099_2117264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|2117247_2117610_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_077139147.1|2117561_2117885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907818.1|2117881_2118313_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_012542168.1|2118561_2118996_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014228904.1|2118995_2120717_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.2	7.2e-190
WP_020318187.1|2120710_2120890_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.9	6.8e-11
WP_047666384.1|2120889_2122149_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.3	5.2e-222
WP_032754009.1|2122185_2123106_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.8e-148
WP_014228907.1|2123183_2124470_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_032754010.1|2124528_2124789_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	3.3e-22
WP_020317538.1|2124769_2125087_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_032754011.1|2125083_2125422_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	88.4	3.1e-52
WP_032754012.1|2125402_2125792_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	83.7	1.2e-55
WP_171972701.1|2125797_2126190_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	93.1	1.0e-59
WP_014228913.1|2126221_2126683_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228914.1|2126740_2127106_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_032754014.1|2127338_2130695_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.3	0.0e+00
WP_017880254.1|2130694_2131033_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
WP_023289191.1|2131029_2131785_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
WP_032754016.1|2131786_2132497_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	89.8	1.4e-134
WP_077274162.1|2132543_2133371_+	hypothetical protein	NA	A0A0S2SY43	Pseudomonas_phage	45.9	1.8e-05
WP_032754018.1|2133386_2133977_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	75.4	5.7e-78
WP_077139148.1|2134039_2146630_+	carbohydrate binding domain-containing protein	NA	Q6UAW1	Klebsiella_phage	48.1	0.0e+00
2139929:2139944	attR	GCCAGCGGGCAGATAC	NA	NA	NA	NA
WP_032754023.1|2146691_2148116_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	49.2	2.4e-98
WP_032754025.1|2148538_2149597_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	8.0e-14
>prophage 4
NZ_CP017284	Klebsiella variicola strain GJ1 chromosome, complete genome	5600718	2339297	2354471	5600718	integrase	Klebsiella_phage(40.0%)	14	2337829:2337842	2350113:2350126
2337829:2337842	attL	TGCCGGTGACGCTG	NA	NA	NA	NA
WP_022065867.1|2339297_2340797_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	33.6	2.3e-59
WP_004140269.1|2340825_2341635_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_008807804.1|2341636_2342629_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_008807805.1|2342628_2343519_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_162494433.1|2343665_2344883_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	2.5e-120
WP_040975856.1|2345453_2345753_-	hypothetical protein	NA	A0A1V0E5P0	Salmonella_phage	55.9	1.5e-13
WP_077139161.1|2345860_2346328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040975858.1|2346361_2346775_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	79.0	9.5e-48
WP_077139162.1|2347179_2347515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043875398.1|2347829_2348294_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	59.2	1.4e-52
WP_043875397.1|2348290_2348773_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	90.6	1.9e-79
WP_077139163.1|2348783_2349164_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	92.1	3.8e-67
WP_077139164.1|2349160_2352232_+	kinase	NA	A0A286S259	Klebsiella_phage	92.2	0.0e+00
2350113:2350126	attR	TGCCGGTGACGCTG	NA	NA	NA	NA
WP_077139165.1|2352287_2354471_+	hypothetical protein	NA	J7HXC9	Pseudomonas_phage	29.6	1.8e-15
>prophage 5
NZ_CP017284	Klebsiella variicola strain GJ1 chromosome, complete genome	5600718	2421462	2448472	5600718	transposase,plate	Cronobacter_phage(25.0%)	19	NA	NA
WP_162494436.1|2421462_2422806_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_046621187.1|2422802_2423492_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_046621190.1|2423488_2425192_+	OmpA family protein	NA	NA	NA	NA	NA
WP_023340018.1|2425196_2425688_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_077139171.1|2425953_2428608_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	1.2e-98
WP_162494480.1|2428609_2431300_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.8	2.1e-18
WP_049152609.1|2431296_2431713_+	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
WP_023157869.1|2433650_2434172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015874726.1|2434340_2434445_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015874727.1|2434416_2434608_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077274163.1|2434658_2435453_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	30.4	2.4e-07
WP_023157866.1|2435439_2436510_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	35.0	3.3e-07
WP_049152832.1|2437779_2438988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077258941.1|2438984_2442440_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_015874732.1|2442439_2444038_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_049152830.1|2444068_2445124_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032739739.1|2445120_2445591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032739741.1|2445668_2447423_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032739743.1|2447386_2448472_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP017284	Klebsiella variicola strain GJ1 chromosome, complete genome	5600718	2678308	2689187	5600718		Escherichia_phage(87.5%)	9	NA	NA
WP_012541792.1|2678308_2678929_-	aldolase	NA	A0A077SK32	Escherichia_phage	98.1	5.7e-113
WP_077139200.1|2678921_2680187_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.4	3.4e-229
WP_008804983.1|2680198_2681101_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.7	1.1e-157
WP_008804982.1|2681361_2682123_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
WP_012968280.1|2682140_2683001_-	class A beta-lactamase LEN-13	NA	A0A077SL40	Escherichia_phage	90.2	3.9e-144
WP_008804980.1|2683295_2683556_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	95.3	3.0e-39
WP_077139201.1|2683642_2684731_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	97.8	7.7e-206
WP_008804978.1|2684759_2686025_-	MFS transporter	NA	NA	NA	NA	NA
WP_077139202.1|2686079_2689187_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.4	0.0e+00
>prophage 7
NZ_CP017284	Klebsiella variicola strain GJ1 chromosome, complete genome	5600718	3794260	3809442	5600718		Bacillus_phage(18.18%)	12	NA	NA
WP_077139363.1|3794260_3795577_-	O9 family phosphomannomutase RfbK1	NA	A0A127AWJ1	Bacillus_phage	26.1	2.6e-30
WP_012967599.1|3795600_3797016_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	3.1e-53
WP_008804104.1|3798093_3799098_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	1.2e-30
WP_004144151.1|3799497_3799620_+	small membrane protein	NA	NA	NA	NA	NA
WP_000704907.1|3800042_3801209_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_023297948.1|3801389_3801944_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
WP_044650166.1|3801958_3802849_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.9	5.3e-27
WP_000676431.1|3802880_3803750_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	9.8e-111
WP_044650165.1|3803776_3804841_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.0e-105
WP_077139364.1|3804999_3806370_-	O9 family phosphomannomutase RfbK1	NA	A0A127AWJ1	Bacillus_phage	26.0	8.4e-32
WP_012967599.1|3806393_3807809_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	3.1e-53
WP_064160974.1|3808035_3809442_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.8e-37
>prophage 8
NZ_CP017284	Klebsiella variicola strain GJ1 chromosome, complete genome	5600718	3851584	3858512	5600718	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_008804077.1|3851584_3853087_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
WP_004201558.1|3853083_3853806_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_008804076.1|3854124_3855486_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.0e-207
WP_162494462.1|3855728_3856625_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	2.1e-15
WP_016161506.1|3856864_3857638_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.0e-26
WP_032736203.1|3857648_3858512_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.5	2.0e-07
>prophage 9
NZ_CP017284	Klebsiella variicola strain GJ1 chromosome, complete genome	5600718	4872976	4890953	5600718	terminase,tRNA,capsid,protease,tail,portal,head	uncultured_Caudovirales_phage(66.67%)	18	NA	NA
WP_008806537.1|4872976_4873990_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	3.7e-109
WP_001144069.1|4874227_4874443_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_008806538.1|4874554_4876300_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	1.2e-75
WP_008806539.1|4876518_4878360_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_008806540.1|4878459_4878966_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_071959634.1|4879304_4880060_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_057201115.1|4880104_4880992_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_077139444.1|4881207_4882869_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	95.7	0.0e+00
WP_004174262.1|4882852_4883209_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	98.3	1.6e-59
WP_032455328.1|4883473_4883917_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	62.6	7.1e-49
WP_023323295.1|4883916_4884210_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	82.5	4.2e-42
WP_004174258.1|4884202_4884541_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	47.7	7.3e-22
WP_004174256.1|4884537_4885773_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	95.9	1.0e-233
WP_077139445.1|4885774_4886335_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	97.8	5.0e-100
WP_004174253.1|4886386_4887547_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.6	6.3e-206
WP_070544411.1|4887802_4888576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004174250.1|4888628_4888874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004174245.1|4889153_4890953_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.0	5.1e-130
>prophage 1
NZ_CP017283	Klebsiella variicola strain GJ1 plasmid pKPGJ-1a, complete sequence	108867	3382	51386	108867	integrase,transposase	Escherichia_phage(12.5%)	48	3331:3390	16249:16362
3331:3390	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067858.1|3382_4087_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032495672.1|4380_5193_+	subclass B1 metallo-beta-lactamase NDM-9	NA	NA	NA	NA	NA
WP_004201167.1|5196_5562_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|5566_6205_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|6215_7247_-	protein-disulfide reductase DsbD N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004201171.1|7251_7581_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000050481.1|8021_9563_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|9967_10807_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|10800_11148_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|11311_12103_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|12108_12399_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|12510_13008_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|13152_14166_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|14440_15145_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|15295_16111_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_040217779.1|16511_17780_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.4	1.5e-59
16249:16362	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATG	NA	NA	NA	NA
WP_046499093.1|17784_21042_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_046499086.1|21045_22335_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_077138923.1|22331_24359_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_077138924.1|24501_24825_-	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	37.2	1.0e-12
WP_077138925.1|24821_25550_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_077138926.1|25546_25978_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_077138927.1|26027_28037_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.2	3.5e-26
WP_077138928.1|28107_28326_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_016247540.1|28951_29269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324193.1|29303_29558_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	2.1e-13
WP_015493073.1|29750_29942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044789508.1|29984_30491_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_077138929.1|30889_31669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008455408.1|31722_32142_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_008455410.1|32152_32374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008455412.1|32373_33051_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	37.0	9.5e-29
WP_077138930.1|33410_34082_+	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	9.0e-80
WP_015493080.1|34261_34684_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_077138931.1|34683_35958_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.8	4.3e-155
WP_077138932.1|36006_37380_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_000143877.1|37429_37753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843283.1|37749_38187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077138933.1|38186_39218_-	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.2e-08
WP_040118447.1|39217_40084_-	ParA family protein	NA	NA	NA	NA	NA
WP_042005150.1|40577_41210_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.2	9.6e-07
WP_045358108.1|41263_41464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113343.1|41609_42539_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.4e-75
WP_072094655.1|43764_45168_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|45201_46416_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001749988.1|46655_47225_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_001067855.1|47542_48247_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001553819.1|48488_51386_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 1
NZ_CP017281	Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence	92219	19095	29879	92219	integrase	Macacine_betaherpesvirus(25.0%)	12	16839:16852	26483:26496
16839:16852	attL	GCGGTTTTCCCAGC	NA	NA	NA	NA
WP_029497485.1|19095_19875_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	7.1e-52
WP_032433931.1|19932_20190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072094.1|20317_20431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012539983.1|21062_21818_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_015632469.1|22608_23814_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_032741647.1|23813_24788_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.3	4.2e-86
WP_077138871.1|24869_26141_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.2	2.3e-148
WP_020805749.1|26140_26572_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
26483:26496	attR	GCTGGGAAAACCGC	NA	NA	NA	NA
WP_077138872.1|26804_27776_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_001568039.1|27778_28450_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_048322267.1|28511_28742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|29177_29879_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
