The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014201	Lactobacillus rhamnosus strain BFE5264 chromosome, complete genome	3068152	3542	57318	3068152	holin,tail,transposase,tRNA	Lactobacillus_phage(61.54%)	45	NA	NA
WP_155772823.1|3542_4124_+|tail	phage tail protein	tail	A0A2D1GPC8	Lactobacillus_phage	95.1	2.7e-96
WP_081395908.1|4134_4350_+	Ig-like domain-containing protein	NA	A0A2D1GPF6	Lactobacillus_phage	88.1	9.1e-18
WP_033571039.1|4419_4833_+	hypothetical protein	NA	U5U4K9	Lactobacillus_phage	99.3	2.4e-51
WP_049175116.1|8193_9210_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	9.3e-36
WP_077069244.1|11009_12917_+|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	79.3	1.3e-293
WP_077069245.1|12916_15856_+|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	88.0	0.0e+00
WP_077069246.1|15852_16140_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	48.9	3.2e-18
WP_077069247.1|16293_16584_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	89.6	6.1e-41
WP_077069248.1|16576_17023_+|holin	phage holin	holin	B4XYQ8	Lactobacillus_phage	98.6	2.0e-67
WP_077069249.1|17033_18332_+	LysM peptidoglycan-binding domain-containing protein	NA	A8YQK7	Lactobacillus_phage	89.1	5.6e-203
WP_019896508.1|18491_19175_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_016383081.1|19205_19379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569323.1|20266_20920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005713641.1|21098_22283_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.0	1.1e-141
WP_014569324.1|22405_23899_+	MFS transporter	NA	NA	NA	NA	NA
WP_005688608.1|24075_24546_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005687221.1|24768_26247_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_005713248.1|26243_26969_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_014569326.1|27024_27705_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_014569327.1|28125_30537_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.1	0.0e+00
WP_014569330.1|31153_32797_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_014569331.1|32801_33512_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005688621.1|33597_33813_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_077069250.1|33945_34776_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_005687236.1|34772_35273_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005688627.1|35668_36142_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_014569332.1|36248_37457_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_014569335.1|39116_39383_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_014569336.1|39656_41000_+	PFL family protein	NA	NA	NA	NA	NA
WP_015764885.1|41165_42233_+	competence protein	NA	NA	NA	NA	NA
WP_005687248.1|42473_43109_-	DsbA family protein	NA	NA	NA	NA	NA
WP_005713275.1|43178_43772_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_014569338.1|43938_44616_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_005687253.1|44617_45415_+	NAD kinase	NA	NA	NA	NA	NA
WP_014569340.1|45414_46317_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_014569341.1|46460_47519_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_005687259.1|47734_48373_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_005687260.1|48392_49211_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_014569342.1|49414_50455_-	lactonase family protein	NA	NA	NA	NA	NA
WP_077069251.1|50698_51073_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_003564153.1|51122_51392_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_014569343.1|51506_52496_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.3	6.9e-137
WP_005688655.1|52679_53627_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_014568964.1|54645_56049_+|transposase	ISLre2-like element ISLrh4 family transposase	transposase	NA	NA	NA	NA
WP_005688659.1|56808_57318_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP014201	Lactobacillus rhamnosus strain BFE5264 chromosome, complete genome	3068152	265104	328453	3068152	tail,head,integrase,portal,capsid,holin,terminase,transposase	Lactobacillus_phage(82.98%)	74	266825:266840	299682:299697
WP_014569018.1|265104_266601_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_005685821.1|266803_267373_-	hypothetical protein	NA	NA	NA	NA	NA
266825:266840	attL	TGATAAGACAGGTGGT	NA	NA	NA	NA
WP_005685825.1|267382_268129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685827.1|268213_270472_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.5	2.6e-155
WP_005685829.1|271216_271822_+	VanZ family protein	NA	NA	NA	NA	NA
WP_005685830.1|272102_272960_+	glucose transporter GlcU	NA	NA	NA	NA	NA
WP_005685831.1|273156_274497_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_077069286.1|274623_275808_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.7	1.5e-226
WP_077069287.1|275918_276599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069288.1|276614_277013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069289.1|277055_277259_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	89.6	8.3e-29
WP_047676162.1|277282_277708_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	98.6	1.4e-62
WP_077069290.1|277911_278598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032800991.1|278671_279037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069291.1|279092_279662_-	hypothetical protein	NA	A0A1B0Y834	Lactobacillus_phage	47.9	9.1e-41
WP_077069292.1|279677_280361_-	LexA family transcriptional regulator	NA	A6M973	Geobacillus_virus	36.4	6.5e-09
WP_077069293.1|280490_280736_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064656586.1|280780_281260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764912.1|281681_281912_+	helix-turn-helix domain-containing protein	NA	A0A1B0Y6A3	Lactobacillus_phage	98.6	5.5e-37
WP_005716154.1|282274_282445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711348.1|282456_283332_+	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	52.2	2.0e-58
WP_077069295.1|283351_284116_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	53.6	7.6e-75
WP_077069296.1|284131_285088_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	89.0	1.2e-122
WP_077069297.1|285100_285586_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	87.6	2.6e-60
WP_077069298.1|285893_286109_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	65.7	1.3e-19
WP_077069299.1|286105_286555_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	89.2	1.3e-66
WP_077069300.1|286557_286941_+	DUF1064 domain-containing protein	NA	B4XYT1	Lactobacillus_phage	96.9	2.7e-65
WP_077069301.1|286952_287135_+	hypothetical protein	NA	A8YQM8	Lactobacillus_phage	93.3	5.9e-26
WP_077069302.1|287131_287341_+	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	91.3	7.2e-28
WP_064535077.1|287412_287724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069303.1|287713_288079_+	hypothetical protein	NA	C1KFE5	Lactobacillus_virus	59.5	1.7e-32
WP_077069304.1|288075_288495_+	hypothetical protein	NA	A0A2D1GPA7	Lactobacillus_phage	56.4	1.0e-36
WP_077069305.1|288491_288674_+	hypothetical protein	NA	A0A0P0I365	Lactobacillus_phage	63.3	7.2e-16
WP_077069306.1|288752_288938_+	hypothetical protein	NA	A0A0N7IR95	Lactobacillus_phage	83.0	1.8e-14
WP_005711378.1|289132_289561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069307.1|290082_291216_+	hypothetical protein	NA	A0A2D1GPQ9	Lactobacillus_phage	46.5	3.9e-91
WP_077069908.1|291208_291532_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	86.9	1.0e-49
WP_191981984.1|291565_292057_+	sigma-70 region 4 domain-containing protein	NA	A0A0P0IZC1	Lactobacillus_phage	88.3	6.6e-72
WP_077069909.1|292040_293294_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	99.3	1.9e-248
WP_077069308.1|293298_294726_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	93.9	1.3e-248
WP_077069309.1|294691_295684_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	95.5	4.8e-178
WP_077069310.1|295808_296462_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	87.8	1.3e-62
WP_077069311.1|296477_297491_+|capsid	capsid protein	capsid	A0A0A7RVZ1	Clostridium_phage	26.2	9.0e-23
WP_077069312.1|297718_298093_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	87.9	1.3e-56
WP_016386765.1|298097_298400_+	hypothetical protein	NA	A0A0N7IR97	Lactobacillus_phage	92.0	1.1e-48
WP_077069313.1|298396_298762_+|tail	phage tail protein	tail	A0A0P0IUZ3	Lactobacillus_phage	95.0	7.6e-57
WP_003582636.1|298762_299167_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	99.3	6.0e-71
WP_077069314.1|299178_299781_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	93.5	1.4e-100
299682:299697	attR	TGATAAGACAGGTGGT	NA	NA	NA	NA
WP_048482132.1|299866_300199_+|tail	tail assembly chaperone	tail	A0A0P0IQQ6	Lactobacillus_phage	97.3	2.5e-51
WP_077069315.1|300303_300657_+	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	96.6	6.9e-55
WP_077069316.1|300649_303739_+	tape measure protein	NA	A0A0N7IR83	Lactobacillus_phage	88.5	2.4e-252
WP_077069317.1|303741_305721_+|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	68.8	3.5e-241
WP_077069318.1|305720_308660_+|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	90.6	0.0e+00
WP_077069246.1|308656_308944_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	48.9	3.2e-18
WP_077069247.1|309097_309388_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	89.6	6.1e-41
WP_077069248.1|309380_309827_+|holin	phage holin	holin	B4XYQ8	Lactobacillus_phage	98.6	2.0e-67
WP_077069319.1|309837_311022_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	90.1	3.2e-205
WP_077069320.1|311157_311547_+	hypothetical protein	NA	B4XYR0	Lactobacillus_phage	95.3	2.4e-64
WP_081395885.1|311565_312159_+	hypothetical protein	NA	B4XYR1	Lactobacillus_phage	93.9	7.2e-97
WP_077069321.1|312155_312398_+	hypothetical protein	NA	B4XYR2	Lactobacillus_phage	88.8	4.6e-34
WP_077069322.1|312820_314065_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	5.1e-12
WP_005685833.1|314460_314748_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005685835.1|315043_315895_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_032960936.1|315894_316638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005713749.1|316766_317930_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_077069323.1|318387_319305_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_005685839.1|319405_319873_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_005685842.1|321305_321443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005685844.1|321523_322717_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	35.8	1.0e-54
WP_005685846.1|323149_324580_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_005685847.1|324962_325148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005707453.1|325140_325476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005684929.1|326138_326873_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_070543786.1|327034_328453_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP014201	Lactobacillus rhamnosus strain BFE5264 chromosome, complete genome	3068152	1110002	1127341	3068152	transposase,protease	Helicoverpa_zea_nudivirus(50.0%)	12	NA	NA
WP_005685966.1|1110002_1110761_+|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	54.3	2.2e-05
WP_005685964.1|1111015_1114618_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005685962.1|1115274_1115601_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077069471.1|1116277_1117864_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_005685956.1|1117962_1118343_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_076638878.1|1118359_1119088_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_070543786.1|1120024_1121443_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014569018.1|1121585_1123082_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_005687345.1|1123195_1123459_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_077069473.1|1125400_1125919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069474.1|1125959_1126496_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155772831.1|1126447_1127341_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	1.1e-37
>prophage 4
NZ_CP014201	Lactobacillus rhamnosus strain BFE5264 chromosome, complete genome	3068152	1163222	1232164	3068152	transposase,tRNA,protease	Escherichia_phage(21.05%)	56	NA	NA
WP_014569018.1|1163222_1164719_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_077069482.1|1164832_1165756_-	glucosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_070707012.1|1166319_1166829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069483.1|1166825_1168202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081395890.1|1168305_1168968_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_070543786.1|1168982_1170401_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070707009.1|1171175_1172018_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.2	1.9e-34
WP_032961565.1|1172077_1173103_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.9	6.2e-72
WP_064656404.1|1173105_1173678_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	44.1	4.4e-35
WP_070707007.1|1173691_1174564_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	56.9	3.6e-97
WP_077069484.1|1174858_1176805_-	SH3-like domain-containing protein	NA	F7V9F0	Lactobacillus_virus	31.0	4.9e-17
WP_049175116.1|1176934_1177951_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	9.3e-36
WP_070707004.1|1178189_1179590_-	sugar transferase	NA	NA	NA	NA	NA
WP_005687208.1|1179857_1180793_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	33.2	1.5e-35
WP_005687206.1|1181230_1181893_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005687204.1|1181908_1182553_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014571459.1|1182554_1183379_-	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005712878.1|1183572_1184304_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	2.1e-37
WP_047677298.1|1184617_1185577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047677299.1|1185597_1186041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047677300.1|1186297_1186750_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_005687187.1|1186858_1186972_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_005687185.1|1187172_1187775_-	guanylate kinase	NA	U5J9X2	Bacillus_phage	29.7	8.0e-11
WP_077069485.1|1187884_1188292_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048488274.1|1188687_1189887_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	45.5	1.4e-19
WP_014571463.1|1190188_1191460_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	43.7	7.2e-86
WP_077069486.1|1191865_1192804_-	cation transporter	NA	NA	NA	NA	NA
WP_005687178.1|1192978_1193314_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024305663.1|1193464_1194394_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_024305664.1|1194776_1196555_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_064658815.1|1196576_1198988_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.8	4.5e-12
WP_005692826.1|1199135_1200581_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_005687171.1|1200573_1201743_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_005687169.1|1201739_1202882_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_077069487.1|1202911_1204975_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_077069488.1|1205335_1206367_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_077069489.1|1206518_1207421_-	sortase	NA	NA	NA	NA	NA
WP_061713386.1|1207794_1208625_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	28.2	3.8e-19
WP_064658967.1|1208728_1210660_-	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_005697320.1|1210961_1211363_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_077069490.1|1212003_1214154_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	36.5	1.2e-120
WP_024129339.1|1214544_1215309_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_024305672.1|1215465_1216359_+	LCP family protein	NA	NA	NA	NA	NA
WP_064658965.1|1217178_1217847_-	sugar transferase	NA	NA	NA	NA	NA
WP_070543786.1|1218216_1219635_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_077069491.1|1220244_1221087_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.1	1.2e-33
WP_064520401.1|1221162_1222188_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	2.1e-67
WP_064520402.1|1222190_1222763_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.6	8.3e-34
WP_064520403.1|1222802_1223678_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	59.6	1.4e-96
WP_064520404.1|1223721_1225134_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_191981975.1|1225226_1226351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064520406.1|1226506_1227502_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_077069492.1|1227511_1228501_-	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_064520407.1|1228543_1229698_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_155736824.1|1229723_1230983_-	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_155736825.1|1231231_1232164_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	3.1e-22
>prophage 5
NZ_CP014201	Lactobacillus rhamnosus strain BFE5264 chromosome, complete genome	3068152	1504293	1570183	3068152	transposase,tRNA,protease	Staphylococcus_phage(20.0%)	59	NA	NA
WP_005686169.1|1504293_1505475_-|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	49.1	2.1e-100
WP_005686167.1|1506427_1507336_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_005686165.1|1507623_1509522_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005686164.1|1509694_1510138_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_005686161.1|1510134_1510722_+	Gx transporter family protein	NA	NA	NA	NA	NA
WP_005686160.1|1510696_1511674_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	24.8	2.8e-05
WP_077069546.1|1512118_1512616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069548.1|1513435_1514311_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	3.4e-18
WP_077069549.1|1514304_1515543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069550.1|1515532_1516648_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_155772835.1|1517106_1517793_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_049174661.1|1517789_1518845_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005686136.1|1519072_1519612_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_005692356.1|1519612_1520395_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005692354.1|1520366_1520795_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_033571717.1|1520791_1522198_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.3	1.0e-53
WP_077069552.1|1522334_1523729_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_077069553.1|1523851_1524421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069554.1|1524598_1525780_-|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	48.6	3.1e-99
WP_005686122.1|1527169_1528663_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077069555.1|1529334_1530165_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_077069556.1|1530178_1531195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069557.1|1531191_1531578_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077069558.1|1531769_1533086_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_077069559.1|1533398_1534514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069560.1|1534534_1535899_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_005686110.1|1535918_1536458_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.0	4.4e-37
WP_005686109.1|1537106_1537397_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_077069562.1|1537691_1539011_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.8	1.0e-63
WP_005686106.1|1539155_1540502_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.7	4.8e-72
WP_005686104.1|1540718_1541819_+	ABC transporter	NA	NA	NA	NA	NA
WP_077069563.1|1541815_1543012_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005686102.1|1543025_1543901_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	2.1e-12
WP_077069564.1|1544052_1546107_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.5	7.3e-64
WP_077069565.1|1546313_1548944_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.7	2.4e-83
WP_077069566.1|1549243_1549831_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_077069567.1|1550002_1550674_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_077069568.1|1550831_1551950_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_005686095.1|1551968_1552253_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_047677419.1|1552498_1553614_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_077069569.1|1553776_1553986_-	CsbD family protein	NA	NA	NA	NA	NA
WP_005686089.1|1555305_1555563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686086.1|1555752_1555959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686084.1|1556158_1556413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095691935.1|1557086_1557874_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003582473.1|1558248_1558797_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_003582479.1|1558806_1559028_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_077069571.1|1559069_1560968_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.2	3.9e-104
WP_005688111.1|1561173_1561845_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031547128.1|1561849_1563097_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005688112.1|1563074_1563818_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.5e-27
WP_003587210.1|1564064_1564532_-	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	29.2	1.6e-06
WP_005688131.1|1564652_1565336_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	53.3	1.6e-60
WP_005688133.1|1565350_1565533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003589707.1|1565653_1565932_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003589709.1|1565933_1566293_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003589711.1|1566446_1567316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031547137.1|1567318_1568557_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_155772837.1|1569395_1570183_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP014201	Lactobacillus rhamnosus strain BFE5264 chromosome, complete genome	3068152	1588900	1629526	3068152	transposase,protease,bacteriocin	Bacillus_phage(25.0%)	40	NA	NA
WP_005687851.1|1588900_1589191_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005686876.1|1590700_1592056_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_005686874.1|1592235_1592646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031547267.1|1592706_1594086_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_077069577.1|1594098_1596291_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	25.6	6.2e-37
WP_005686869.1|1596566_1596719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686867.1|1596905_1598201_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_005686865.1|1598205_1598982_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005686864.1|1600095_1600341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031546828.1|1600590_1600890_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005686855.1|1601067_1601226_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_005686851.1|1601694_1601880_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_005686849.1|1601939_1602125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686847.1|1602510_1602696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069580.1|1602745_1603552_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005686843.1|1603872_1604313_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_005686841.1|1604367_1605795_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.7	6.1e-33
WP_005686839.1|1605967_1606300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686837.1|1606590_1606932_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005686835.1|1607106_1608060_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_077069581.1|1608529_1609264_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005686831.1|1609293_1610439_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_077069582.1|1610463_1610781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686828.1|1610830_1612210_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_005686826.1|1612385_1613129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686824.1|1613654_1613792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099981497.1|1613775_1615353_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_005686820.1|1615782_1618500_+	HAD-IC family P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	27.5	1.9e-59
WP_005686819.1|1618788_1619154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005686817.1|1619468_1620839_-	MFS transporter	NA	NA	NA	NA	NA
WP_005686815.1|1620872_1622402_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_005692195.1|1622505_1622700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005686811.1|1622846_1623455_+	cation transporter	NA	NA	NA	NA	NA
WP_005686809.1|1623574_1623907_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005686806.1|1623997_1624939_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005686804.1|1624935_1625829_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005686802.1|1625825_1626569_-	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	4.6e-16
WP_005686799.1|1626908_1627178_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_005686796.1|1627262_1627382_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_070543786.1|1628107_1629526_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP014201	Lactobacillus rhamnosus strain BFE5264 chromosome, complete genome	3068152	1755775	1764097	3068152		Streptococcus_phage(85.71%)	10	NA	NA
WP_031546590.1|1755775_1757143_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	61.3	5.2e-151
WP_010491202.1|1757153_1757429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031546588.1|1757425_1757686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031546586.1|1758001_1759192_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	43.4	1.1e-93
WP_031546584.1|1759181_1759508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031546582.1|1759638_1760373_+	site-specific DNA-methyltransferase	NA	A0A2K8IKC3	Lactococcus_phage	53.6	1.1e-67
WP_003606383.1|1760471_1760693_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.6	1.7e-27
WP_031546580.1|1760696_1761194_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	45.2	1.7e-35
WP_010491186.1|1761255_1761648_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	73.6	6.5e-46
WP_031546577.1|1761631_1764097_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	64.4	0.0e+00
>prophage 8
NZ_CP014201	Lactobacillus rhamnosus strain BFE5264 chromosome, complete genome	3068152	1775149	1867998	3068152	holin,transposase,tRNA,protease	Lactobacillus_phage(15.0%)	77	NA	NA
WP_002816285.1|1775149_1775401_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_031547201.1|1777200_1777917_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_031547198.1|1779455_1780562_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022669518.1|1780755_1781136_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_032962076.1|1782593_1782803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069597.1|1783080_1783638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003591692.1|1783838_1785167_-	MFS transporter	NA	NA	NA	NA	NA
WP_032962027.1|1785334_1785922_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	39.5	5.9e-19
WP_003582348.1|1786083_1786512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572054.1|1788058_1788301_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	36.1	4.0e-06
WP_032962024.1|1788347_1788998_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.1	2.2e-22
WP_003572050.1|1788994_1789750_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_032962113.1|1790909_1791140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012537722.1|1791159_1791663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586220.1|1791775_1792426_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.5e-18
WP_002819966.1|1792431_1792716_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_077069598.1|1793139_1794558_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014571624.1|1796088_1797000_+	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.2	5.4e-59
WP_032953848.1|1797041_1798226_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_014571622.1|1798191_1798701_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_031547296.1|1798916_1800092_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_123021480.1|1800276_1801439_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	4.3e-29
WP_016386516.1|1803123_1803633_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003554840.1|1805242_1806151_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_014569018.1|1807895_1809392_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_032962056.1|1809718_1811833_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.0	1.4e-118
WP_032962051.1|1812137_1812527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014568964.1|1812650_1814054_+|transposase	ISLre2-like element ISLrh4 family transposase	transposase	NA	NA	NA	NA
WP_002816607.1|1814513_1815197_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_021353390.1|1815758_1815848_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_031546167.1|1816002_1817127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010491013.1|1817130_1817346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031546164.1|1819610_1820021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002816285.1|1821390_1821642_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_077069603.1|1823572_1823971_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_019899265.1|1823991_1824249_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010490992.1|1824598_1824871_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070543786.1|1826136_1827555_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_005691061.1|1827887_1828139_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_005686643.1|1828235_1829495_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_155772852.1|1829572_1829806_-	ATP-dependent nuclease subunit B	NA	NA	NA	NA	NA
WP_005686647.1|1829985_1831590_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	48.8	7.1e-139
WP_032961799.1|1831852_1833310_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_005685266.1|1833675_1834863_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005685263.1|1835555_1836431_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_005713414.1|1836657_1837338_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_005685261.1|1837381_1837828_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_032964331.1|1838198_1839047_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_077069606.1|1839036_1840389_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.5	3.5e-30
WP_005685256.1|1840400_1840853_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_014569018.1|1841896_1843393_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_191981983.1|1843426_1843564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005714120.1|1843626_1844007_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_005716693.1|1844158_1844593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069607.1|1844681_1845011_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005691037.1|1845107_1846082_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.1	2.0e-43
WP_064520135.1|1846179_1847568_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.6	1.5e-28
WP_049173594.1|1847901_1849107_-	VanZ family protein	NA	NA	NA	NA	NA
WP_049173596.1|1849103_1849952_-	pur operon repressor	NA	A0A1V0SKE5	Klosneuvirus	26.4	1.1e-05
WP_005685245.1|1850173_1850824_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.2	1.1e-16
WP_005685244.1|1850820_1851582_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005685242.1|1851674_1852553_-	cation transporter	NA	NA	NA	NA	NA
WP_005716698.1|1852608_1853487_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005685240.1|1853732_1853984_-	Veg family protein	NA	NA	NA	NA	NA
WP_077069608.1|1854329_1855214_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_005685238.1|1855206_1855776_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_077069609.1|1855772_1856552_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_014570140.1|1856558_1857035_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005685235.1|1857264_1858263_+	tagatose 1,6-diphosphate aldolase	NA	NA	NA	NA	NA
WP_005685233.1|1858684_1859566_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_005685232.1|1859701_1860406_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005685231.1|1860392_1861304_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005685229.1|1861357_1863184_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	31.1	9.8e-20
WP_005716716.1|1863170_1865084_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.0	2.7e-20
WP_005685226.1|1865247_1865460_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	40.9	1.8e-05
WP_005685225.1|1865510_1865957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005685224.1|1866015_1867998_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.3	3.5e-95
>prophage 9
NZ_CP014201	Lactobacillus rhamnosus strain BFE5264 chromosome, complete genome	3068152	1887859	1952708	3068152	transposase,tRNA,protease,bacteriocin	Bacillus_virus(11.11%)	56	NA	NA
WP_005685198.1|1887859_1888876_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077069941.1|1891529_1892855_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005690949.1|1892860_1893820_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	8.2e-26
WP_077069611.1|1893819_1895352_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_077069612.1|1895489_1896893_-|transposase	ISLre2-like element ISLrh4 family transposase	transposase	NA	NA	NA	NA
WP_077069613.1|1897045_1897246_+	Malolactic regulator	NA	NA	NA	NA	NA
WP_077069614.1|1897348_1899637_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077069615.1|1899766_1900594_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077069616.1|1900662_1901634_-	TDT family transporter	NA	NA	NA	NA	NA
WP_005685184.1|1902038_1902686_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_077069617.1|1903017_1904619_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.8	6.2e-26
WP_077069618.1|1904829_1905474_-	HD domain-containing protein	NA	S4W232	Pandoravirus	33.6	5.2e-16
WP_005714141.1|1905625_1906042_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077069619.1|1906210_1908739_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.9	1.3e-110
WP_049170740.1|1908844_1909849_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005717288.1|1909957_1910770_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005685172.1|1910960_1911305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069620.1|1912000_1912264_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_077069621.1|1912553_1913243_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_005685162.1|1913239_1913929_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_077069622.1|1913972_1914785_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_077069623.1|1914878_1915361_+	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	37.7	2.3e-21
WP_005685159.1|1915366_1916269_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077069624.1|1916557_1917760_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.3	5.3e-22
WP_077069625.1|1918133_1918439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093997732.1|1918610_1919397_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115656753.1|1919531_1919900_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	42.6	4.7e-14
WP_070651016.1|1920212_1921169_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003569650.1|1921352_1922210_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_077069626.1|1922212_1923571_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_070651021.1|1923624_1924857_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_070651023.1|1924948_1926556_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_070651025.1|1926568_1927696_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.3	2.3e-19
WP_003569641.1|1927688_1928369_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_070651026.1|1928361_1930620_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_077069627.1|1930738_1932478_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_070543888.1|1932480_1934148_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_172493494.1|1934515_1935302_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_077069628.1|1935581_1935908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069629.1|1936099_1937287_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	58.6	3.4e-106
WP_005690907.1|1937535_1938237_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_005688159.1|1938300_1938774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069630.1|1939614_1941597_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_077069631.1|1941600_1942530_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_049173471.1|1942678_1943431_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049173472.1|1943493_1945026_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_005688149.1|1945310_1945430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069632.1|1945751_1946192_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014571670.1|1946324_1947707_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005690883.1|1947935_1948664_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_005714162.1|1948660_1948897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077069633.1|1948889_1950458_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_005690878.1|1950530_1950851_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_077069634.1|1950872_1951352_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_077069635.1|1951557_1952352_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_005690873.1|1952444_1952708_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
NZ_CP014201	Lactobacillus rhamnosus strain BFE5264 chromosome, complete genome	3068152	2155811	2168616	3068152	tail,head,integrase,portal,capsid,terminase	Lactobacillus_phage(30.0%)	19	2155694:2155714	2169687:2169707
2155694:2155714	attL	CTATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
WP_064520395.1|2155811_2156969_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.3	7.8e-47
WP_005690523.1|2157086_2157698_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029944073.1|2157812_2158025_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014570223.1|2158049_2158325_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077069698.1|2158392_2158614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069699.1|2158724_2158916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069700.1|2158964_2159237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586080.1|2159233_2159422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069701.1|2159405_2160233_+	bifunctional DNA primase/polymerase	NA	A0A1B3B066	Gordonia_phage	28.1	7.3e-15
WP_077069702.1|2160225_2161650_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.6	1.5e-63
WP_077069703.1|2161929_2162352_+	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	44.1	6.0e-13
WP_191981971.1|2162433_2162808_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	41.7	7.6e-12
WP_077069704.1|2162932_2163403_+|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	29.3	2.1e-06
WP_077069705.1|2163399_2165103_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.0	1.7e-119
WP_003604811.1|2165068_2165248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069706.1|2165252_2166437_+|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	34.2	1.7e-60
WP_077069707.1|2166423_2167938_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.9	3.5e-39
WP_003577144.1|2168000_2168291_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_077069708.1|2168274_2168616_+|head	phage head closure protein	head	I7AUE6	Enterococcus_phage	38.4	1.2e-08
2169687:2169707	attR	CTATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
>prophage 11
NZ_CP014201	Lactobacillus rhamnosus strain BFE5264 chromosome, complete genome	3068152	2313807	2384402	3068152	transposase	Streptococcus_phage(37.5%)	54	NA	NA
WP_014569018.1|2313807_2315304_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_005687012.1|2315363_2316245_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005687014.1|2316344_2317112_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_005687015.1|2317108_2318014_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_005687017.1|2318214_2319366_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_005687018.1|2319372_2320077_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_005687019.1|2320086_2321430_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_077069948.1|2321867_2321972_-	Malolactic regulator	NA	NA	NA	NA	NA
WP_049173210.1|2322499_2323879_+	aspartate kinase	NA	NA	NA	NA	NA
WP_077069753.1|2323881_2324889_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_077069754.1|2324896_2325955_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_077069755.1|2326170_2326548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069756.1|2326716_2327130_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_077069757.1|2327122_2328001_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014569018.1|2328213_2329710_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_077069758.1|2330324_2330966_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005690235.1|2331202_2332159_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005690233.1|2332161_2332902_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005690231.1|2332915_2333851_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	6.8e-25
WP_005687033.1|2334175_2336182_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_005687035.1|2336198_2336654_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005690229.1|2337063_2338449_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.6	2.9e-125
WP_032965241.1|2338511_2339675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069759.1|2339797_2341789_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_005687044.1|2341775_2342708_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_005687045.1|2342748_2343795_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_014568958.1|2344001_2344871_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005687049.1|2344977_2345583_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005687051.1|2345878_2346583_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	4.2e-35
WP_032960672.1|2346593_2349899_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_005687056.1|2350090_2351146_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_005687058.1|2351360_2352653_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	9.6e-62
WP_014568961.1|2352977_2354876_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	2.0e-87
WP_005687062.1|2354971_2355316_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005687063.1|2355668_2356883_+	MFS transporter	NA	NA	NA	NA	NA
WP_005687066.1|2357245_2359429_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.7	1.3e-255
WP_005687068.1|2359611_2360307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688296.1|2361721_2361988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029943751.1|2362005_2362614_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_076638900.1|2362968_2363100_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_077069760.1|2363316_2364720_-|transposase	ISLre2-like element ISLrh4 family transposase	transposase	NA	NA	NA	NA
WP_005688236.1|2366428_2367409_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005688238.1|2367509_2368586_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_005688240.1|2368842_2369094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014568966.1|2369223_2370306_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_005710972.1|2370595_2370862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688248.1|2371291_2371936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048516665.1|2371953_2373345_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_081395903.1|2373952_2375449_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_005688325.1|2376337_2378164_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.1	2.0e-60
WP_003597460.1|2378524_2379208_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	1.6e-60
WP_005688376.1|2379436_2380699_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_005688360.1|2381563_2382718_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_014569018.1|2382905_2384402_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP014201	Lactobacillus rhamnosus strain BFE5264 chromosome, complete genome	3068152	3041736	3068082	3068152	terminase,transposase,integrase,portal	Lactobacillus_phage(90.32%)	42	3034771:3034785	3056718:3056732
3034771:3034785	attL	GACTATGACAATGCC	NA	NA	NA	NA
WP_077069875.1|3041736_3042864_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	98.4	2.8e-211
WP_077069876.1|3042971_3043235_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.2	5.5e-09
WP_010489722.1|3043332_3043590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070543786.1|3043751_3045170_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010489720.1|3045365_3046043_-	tcdA-E operon negative regulator	NA	A0A2D1GPN7	Lactobacillus_phage	97.3	1.7e-86
WP_025014107.1|3046104_3046752_-	LexA family transcriptional regulator	NA	B4XYR6	Lactobacillus_phage	43.1	9.7e-39
WP_020752157.1|3046900_3047167_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020752159.1|3047543_3048284_+	phage regulatory protein/antirepressor Ant	NA	B4XYR8	Lactobacillus_phage	84.8	7.8e-109
WP_015764320.1|3048284_3048545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764321.1|3048537_3048843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005712707.1|3048917_3049274_+	DUF771 domain-containing protein	NA	B4XYS0	Lactobacillus_phage	100.0	1.1e-63
WP_005712709.1|3049358_3049511_+	hypothetical protein	NA	A0A0P0HRK6	Lactobacillus_phage	100.0	2.4e-20
WP_005712711.1|3049515_3049719_+	hypothetical protein	NA	Q6J1W0	Lactobacillus_phage	89.6	2.7e-27
WP_077069878.1|3049737_3050223_+	siphovirus Gp157 family protein	NA	B4XYS3	Lactobacillus_phage	97.5	7.7e-81
WP_049152790.1|3050223_3050931_+	AAA family ATPase	NA	Q6J1V8	Lactobacillus_phage	98.7	8.2e-132
WP_021354142.1|3050934_3051492_+	DUF669 domain-containing protein	NA	A8YQL6	Lactobacillus_phage	99.5	1.5e-104
WP_077069879.1|3051508_3052336_+	helix-turn-helix domain-containing protein	NA	U5U793	Lactobacillus_phage	75.1	1.0e-112
WP_077069880.1|3052332_3053595_+	DNA helicase	NA	A8YQM1	Lactobacillus_phage	96.9	8.6e-233
WP_077069881.1|3053596_3053941_+	hypothetical protein	NA	A8YQM2	Lactobacillus_phage	96.5	9.0e-60
WP_077069882.1|3053982_3054384_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	71.5	1.2e-50
WP_077069883.1|3054399_3054882_+	hypothetical protein	NA	A8ATW6	Listeria_phage	43.9	3.2e-26
WP_077069884.1|3054896_3055082_+	hypothetical protein	NA	Q6J1V0	Lactobacillus_phage	93.4	1.2e-26
WP_077069885.1|3055078_3055363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069886.1|3055359_3055923_+	DUF1642 domain-containing protein	NA	A0A2D1GPC7	Lactobacillus_phage	50.0	8.8e-36
WP_077069887.1|3055912_3056092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069888.1|3056078_3056297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069889.1|3056286_3056595_+	hypothetical protein	NA	C1KFE8	Lactobacillus_virus	79.2	1.0e-38
WP_077069891.1|3057007_3057364_+	hypothetical protein	NA	C1KFE7	Lactobacillus_virus	59.5	1.4e-26
3056718:3056732	attR	GACTATGACAATGCC	NA	NA	NA	NA
WP_077069892.1|3057360_3057780_+	hypothetical protein	NA	A0A2D1GPA7	Lactobacillus_phage	60.0	7.4e-40
WP_077069894.1|3058174_3058393_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IK26	Lactobacillus_phage	75.0	1.7e-24
WP_005686946.1|3058745_3059189_+	hypothetical protein	NA	A0A0P0IZI6	Lactobacillus_phage	96.6	2.3e-76
WP_005686948.1|3059476_3060337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582255.1|3060587_3060806_-	CsbD family protein	NA	NA	NA	NA	NA
WP_077069896.1|3061215_3062364_+	hypothetical protein	NA	B4XYU0	Lactobacillus_phage	95.5	3.5e-217
WP_077069897.1|3062376_3062907_+	HNH endonuclease	NA	Q8LTA0	Lactobacillus_phage	67.8	3.1e-67
WP_077069898.1|3062910_3063234_+	ribonucleoside-diphosphate reductase	NA	U5U741	Lactobacillus_phage	84.8	4.1e-46
WP_155772846.1|3063235_3063400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077069899.1|3063436_3064231_+	HNH endonuclease	NA	B4XYU4	Lactobacillus_phage	97.3	7.0e-148
WP_005686963.1|3064431_3064887_+|terminase	P27 family phage terminase small subunit	terminase	B4XYP1	Lactobacillus_phage	98.0	6.7e-79
WP_077069900.1|3064908_3066621_+|terminase	terminase large subunit	terminase	B4XYP2	Lactobacillus_phage	97.9	0.0e+00
WP_003661399.1|3066632_3066824_+	hypothetical protein	NA	A0A2D1GPE7	Lactobacillus_phage	100.0	3.0e-28
WP_077069901.1|3066828_3068082_+|portal	phage portal protein	portal	B4XYP4	Lactobacillus_phage	97.4	2.3e-230
