The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	27282	70036	4106294	tRNA,transposase	Synechococcus_phage(50.0%)	41	NA	NA
WP_010929577.1|27282_28233_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023995007.1|28314_28650_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929578.1|28674_29109_-	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_019247164.1|29141_30359_-	thiolase family protein	NA	NA	NA	NA	NA
WP_010929580.1|30364_30862_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_019247165.1|31069_32005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929582.1|32214_33006_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929583.1|33048_34470_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_010929584.1|34625_35576_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814398.1|35572_36763_-	MFS transporter	NA	NA	NA	NA	NA
WP_010929585.1|37012_37924_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_010929586.1|37925_40064_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003814404.1|40060_40600_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003814405.1|40603_41332_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929587.1|41318_42212_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_019247766.1|42282_42678_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_003814412.1|42687_43218_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
WP_010929588.1|43663_44614_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929589.1|45200_45749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815265.1|45720_45957_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003815255.1|46084_46978_+	AEC family transporter	NA	NA	NA	NA	NA
WP_010929590.1|48147_49395_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003817748.1|49391_50006_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_010929591.1|50141_51092_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443813.1|51134_52391_+	muropeptide transporter	NA	NA	NA	NA	NA
WP_010929592.1|53622_54357_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_019247224.1|54362_54953_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
WP_003817737.1|54977_55667_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023852650.1|55663_56425_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010929594.1|56504_57404_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|57497_58448_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929595.1|59248_60475_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_047122776.1|60474_60888_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929597.1|61077_62019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248755.1|62442_63417_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929599.1|63473_64055_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010929600.1|64067_64370_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_029443770.1|64488_65547_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_019247832.1|65581_66853_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010929603.1|67482_68664_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|69085_70036_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	77634	136108	4106294	tRNA,transposase	Planktothrix_phage(22.22%)	54	NA	NA
WP_005012067.1|77634_78585_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_041166334.1|78659_79604_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929608.1|79600_81475_-	O-antigen biosynthesis protein WlbL	NA	A0A2P1ELS8	Moumouvirus	26.9	2.0e-23
WP_003807102.1|82822_83527_-	O-antigen biosynthesis protein WlbI	NA	NA	NA	NA	NA
WP_010929609.1|83523_84696_-	O-antigen biosynthesis protein WlbH	NA	NA	NA	NA	NA
WP_010929610.1|84891_85485_-	O-antigen biosynthesis protein WlbG	NA	NA	NA	NA	NA
WP_010929611.1|85481_86714_-	O-antigen biosynthesis protein WlbF	NA	NA	NA	NA	NA
WP_010929612.1|86731_87991_-	O-antigen biosynthesis protein WlbE	NA	NA	NA	NA	NA
WP_010929613.1|88014_89103_-	O-antigen biosynthesis protein WlbD	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	36.3	4.8e-46
WP_010929614.1|89110_90211_-	O-antigen biosynthesis protein WlbC	NA	A0A2K9L0G1	Tupanvirus	29.7	3.3e-31
WP_003807114.1|90214_90790_-	O-antigen biosynthesis protein WlbB	NA	NA	NA	NA	NA
WP_003807115.1|90793_91846_-	O-antigen biosynthesis protein WlbA	NA	NA	NA	NA	NA
WP_010929615.1|91976_92984_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_010929616.1|92985_94272_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_003807124.1|94288_94444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929617.1|94468_95272_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_010929618.1|95268_96135_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_010929619.1|96209_97340_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003807131.1|97339_98179_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.4	9.1e-21
WP_010929620.1|99111_99714_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_010929621.1|99743_100397_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003807138.1|100529_101786_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.5	6.2e-66
WP_010929622.1|101833_102733_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003818417.1|102808_103084_+	YbeD family protein	NA	NA	NA	NA	NA
WP_010929623.1|103091_103754_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003807146.1|103815_104817_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003807148.1|104831_105380_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.4	3.7e-47
WP_010929624.1|105437_106334_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_010929625.1|106330_107392_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.8	1.6e-78
WP_010929626.1|107427_108378_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929627.1|109277_110471_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_010929628.1|110552_111182_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_010927242.1|111243_111927_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_023853376.1|111936_113619_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003815933.1|113906_114254_+	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_003815930.1|114344_114662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931363.1|114944_115961_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815929.1|116036_116837_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003815927.1|116833_117709_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_010929633.1|117719_119012_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929634.1|119054_120095_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
WP_010929635.1|120200_121022_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_005012067.1|121122_122073_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014905488.1|122171_123077_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	9.8e-21
WP_003815918.1|123073_123907_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010929637.1|124743_125754_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_019247800.1|125750_126140_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010929638.1|127033_128287_+	amidase	NA	NA	NA	NA	NA
WP_010929639.1|128377_130078_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_010929640.1|130504_131152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023853393.1|131150_132590_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003815905.1|132682_132985_+	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_010929512.1|133012_133891_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|135157_136108_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	164894	225405	4106294	tRNA,protease,transposase	Diachasmimorpha_longicaudata_entomopoxvirus(11.11%)	51	NA	NA
WP_005015810.1|164894_165845_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929659.1|167288_168191_-	YgcG family protein	NA	NA	NA	NA	NA
WP_003815889.1|168168_168798_-	LemA family protein	NA	NA	NA	NA	NA
WP_010929660.1|169080_170511_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	5.8e-44
WP_010929661.1|170544_171174_+	LysE family transporter	NA	NA	NA	NA	NA
WP_003815895.1|171222_172830_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.8	9.3e-14
WP_010929663.1|172854_173538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815898.1|173619_174096_-	bacterioferritin	NA	NA	NA	NA	NA
WP_010929591.1|174302_175253_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929664.1|176368_176896_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_010929665.1|176987_177803_+	META and DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_003808370.1|177863_178598_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_010929666.1|178635_180714_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.6	1.5e-27
WP_003808374.1|180963_181236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446322.1|181337_182423_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010929668.1|182426_184331_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_014486044.1|184327_188002_+	translocation/assembly module TamB domain-containing protein	NA	NA	NA	NA	NA
WP_010929670.1|188062_188626_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.3	2.6e-72
WP_003808385.1|188633_189056_-	VOC family protein	NA	NA	NA	NA	NA
WP_010929671.1|189083_189503_-	VOC family protein	NA	NA	NA	NA	NA
WP_076879599.1|189531_190005_-	GNAT family N-acetyltransferase	NA	Q9AZG4	Lactococcus_phage	31.1	2.2e-11
WP_003808391.1|190104_190602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003808393.1|190756_193027_+	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_010929672.1|193075_194308_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010929591.1|194406_195357_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929673.1|195459_196095_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	2.8e-83
WP_019248671.1|196091_196985_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_010929675.1|197379_198480_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_010929676.1|198561_198936_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_010929677.1|198995_201860_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.4	1.2e-261
WP_010929678.1|202004_202745_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929679.1|202814_204026_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929680.1|204054_205023_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931070.1|205636_206587_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929699.1|206743_207067_+	phosphate starvation-inducible protein	NA	NA	NA	NA	NA
WP_023853200.1|207171_208212_-	cyclase family protein	NA	NA	NA	NA	NA
WP_010929697.1|208217_208997_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_003807672.1|209042_209339_-	YciI family protein	NA	NA	NA	NA	NA
WP_003807674.1|209364_209640_-	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_003819086.1|209696_210341_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_010929696.1|210340_211027_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_010929695.1|211156_212008_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929694.1|212058_212784_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929693.1|212815_214165_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_010929692.1|214276_215209_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033455792.1|215666_218462_-|protease	serine protease autotransporter SphB1	protease	NA	NA	NA	NA
WP_010929690.1|219055_221998_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_010929689.1|222069_222789_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
WP_010929688.1|222827_223376_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
WP_010929687.1|223530_224430_+	virginiamycin B lyase	NA	NA	NA	NA	NA
WP_005012808.1|224454_225405_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	233337	286925	4106294	tRNA,protease,transposase	Bacillus_phage(25.0%)	48	NA	NA
WP_005012067.1|233337_234288_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927663.1|234374_235325_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930742.1|235321_236272_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929700.1|236370_237168_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003814363.1|238117_238528_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003814358.1|239549_240293_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814356.1|240336_241380_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814355.1|241550_243653_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_003814351.1|245063_246020_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929701.1|246038_246530_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_010929702.1|246526_247882_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
WP_010929703.1|247882_248581_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010929704.1|248577_249279_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_003814339.1|249531_250581_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
WP_003814337.1|250686_251628_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_010929705.1|251624_253514_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	3.3e-79
WP_003814332.1|253600_254239_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_019247543.1|254381_255767_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
WP_010929706.1|255697_256234_-|tRNA	bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_010929707.1|256385_257777_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_010929708.1|257793_258774_-	AEC family transporter	NA	NA	NA	NA	NA
WP_003814324.1|258909_259893_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_010929709.1|259957_260857_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814321.1|260963_262718_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_010929710.1|262725_263850_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929711.1|263863_264844_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012067.1|265574_266525_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929712.1|267084_267630_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929713.1|267713_269333_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004567834.1|269348_270503_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003817696.1|270516_270642_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_010929714.1|270638_272390_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.8	3.4e-09
WP_010929715.1|272386_274066_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	27.6	3.6e-16
WP_010929716.1|274128_274677_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	1.3e-28
WP_010929717.1|275819_276098_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|277141_278092_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_173651708.1|278109_278256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929718.1|278369_278531_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_010929719.1|278538_278679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815821.1|279197_279647_-|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
WP_003815819.1|279656_280268_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_019247426.1|280426_281281_-	cytochrome c1	NA	NA	NA	NA	NA
WP_003815816.1|281300_282683_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_003815815.1|282747_283389_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_010929721.1|283528_283987_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_010927226.1|284011_284788_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_014906092.1|284841_285978_+	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	31.2	1.2e-07
WP_005015810.1|285974_286925_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	390858	448367	4106294	transposase	Orpheovirus(14.29%)	50	NA	NA
WP_005012067.1|390858_391809_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927231.1|391945_392863_+	reductase	NA	NA	NA	NA	NA
WP_003815842.1|392859_393108_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_003815840.1|393104_394310_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486045.1|394382_395378_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014486046.1|395400_396621_-	CoA transferase	NA	NA	NA	NA	NA
WP_014486047.1|396617_397262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248476.1|398992_399802_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014486048.1|400106_401060_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	5.6e-59
WP_014486049.1|401158_402142_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486050.1|402068_402770_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014486051.1|402818_403589_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_019247259.1|403585_404764_-	CoA transferase	NA	NA	NA	NA	NA
WP_014486052.1|404931_406638_-	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_014486053.1|406634_407531_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014486054.1|407571_409161_-	rhodanese homology domain-containing protein	NA	NA	NA	NA	NA
WP_003807867.1|409210_410203_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807865.1|410271_410871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014486055.1|411331_412312_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929577.1|412387_413338_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_047122777.1|413426_414341_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010929782.1|414337_414997_+	LysE family translocator	NA	NA	NA	NA	NA
WP_003814709.1|415086_416010_+	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.2	4.8e-07
WP_010929783.1|416015_416471_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_010929784.1|416467_417571_-	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_157734656.1|417529_417799_+	GtrA family protein	NA	NA	NA	NA	NA
WP_010927086.1|417758_419378_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_003814720.1|419374_420433_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	40.5	2.8e-59
WP_033446199.1|420562_421057_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_022997984.1|421149_422127_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929785.1|422322_423528_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_010929786.1|423524_425036_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_003814726.1|425051_426365_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_003814728.1|426555_426735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814730.1|427144_427879_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	43.8	1.4e-41
WP_010929577.1|430323_431274_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247421.1|431405_431804_-	GTP-binding protein	NA	E4ZFJ7	Streptococcus_phage	44.3	9.0e-19
WP_003814701.1|432214_432685_-	universal stress protein	NA	NA	NA	NA	NA
WP_003820700.1|432773_433118_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_010929788.1|433217_434618_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010929789.1|436406_436925_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	2.1e-12
WP_003814694.1|437035_437791_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	40.8	2.9e-42
WP_003814691.1|437986_439219_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929791.1|439211_439997_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_003814685.1|440063_441035_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003814681.1|441045_442023_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247419.1|442148_443321_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929793.1|443347_444376_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003814674.1|444441_445635_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|447416_448367_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	589372	650563	4106294	protease,transposase	uncultured_Mediterranean_phage(40.0%)	56	NA	NA
WP_005013747.1|589372_590323_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023998122.1|590819_591689_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_010931496.1|591685_592507_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_019247235.1|592706_593198_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_019247236.1|593216_594290_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_023853086.1|594336_595440_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_003808577.1|595515_596136_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003808574.1|596156_596666_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.1	1.2e-28
WP_003808570.1|596720_596972_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.4	1.6e-18
WP_010931494.1|597035_598169_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_003808567.1|598176_598563_-	MOSC N-terminal beta barrel domain-containing protein	NA	NA	NA	NA	NA
WP_010931493.1|598559_601079_-	AsmA family protein	NA	NA	NA	NA	NA
WP_003808563.1|601507_601846_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003808562.1|601842_602349_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_010931492.1|602410_603211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931491.1|603321_604263_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931490.1|604356_605892_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931489.1|607571_609422_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.6e-17
WP_003808549.1|609425_610259_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931488.1|610258_611200_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931487.1|611451_612423_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931486.1|612564_614853_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003808542.1|615159_616068_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010931485.1|616122_617088_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_062810229.1|617162_618824_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_010931483.1|618895_619606_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154698388.1|619572_619737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|619754_620705_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814152.1|621403_621787_+	membrane protein	NA	NA	NA	NA	NA
WP_010927005.1|621844_622447_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_003820995.1|622464_622866_-	DoxX family protein	NA	NA	NA	NA	NA
WP_003814158.1|622999_623893_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931481.1|623889_624471_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003814165.1|625265_626000_+	arginyltransferase	NA	NA	NA	NA	NA
WP_010931480.1|626040_627090_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003814172.1|627237_627816_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_010931479.1|628202_629180_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_010931478.1|629273_633668_-	dermonecrotic toxin	NA	NA	NA	NA	NA
WP_003814178.1|633868_634717_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931477.1|634875_635688_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015810.1|635743_636694_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931453.1|636792_637593_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_003814185.1|637654_638038_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_010931454.1|638049_639483_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	1.5e-52
WP_003814188.1|639689_640019_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_010931455.1|640021_640771_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010931456.1|640953_641874_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_003814195.1|641920_642133_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_010931457.1|642155_642578_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_010931458.1|642594_643695_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010931459.1|643791_645309_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003814203.1|645384_646224_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
WP_003814205.1|646245_647127_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003814206.1|647208_648303_-	porin	NA	NA	NA	NA	NA
WP_076879617.1|648596_649547_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_041166340.1|649621_650563_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	655887	702078	4106294	tRNA,terminase,tail,transposase	uncultured_Caudovirales_phage(18.18%)	51	NA	NA
WP_023995141.1|655887_656913_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003814221.1|656953_657193_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_010931464.1|657262_658852_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	8.7e-65
WP_010931465.1|658851_659400_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_003814226.1|659480_660053_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010927008.1|660071_660983_-	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_003814230.1|661056_662025_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_010931466.1|662147_663221_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.7	2.3e-08
WP_010931467.1|663225_665046_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	3.1e-74
WP_010930800.1|665122_666073_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446132.1|666161_666497_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003819076.1|666630_667281_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_010931468.1|667302_668721_-	amidase	NA	NA	NA	NA	NA
WP_019248554.1|668790_669546_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247734.1|669514_670273_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931471.1|670283_671165_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931472.1|671181_671889_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
WP_010931473.1|671891_672650_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
WP_010931474.1|672859_674602_+	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_010925795.1|674594_675119_+	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_010931475.1|675158_675953_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019248926.1|676120_677194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|677292_678243_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247378.1|678494_678701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931451.1|678772_679384_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_023853179.1|679938_680190_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161633094.1|680182_680872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023853183.1|680889_681111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|681128_682079_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247942.1|682718_683204_+|transposase	transposase	transposase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
WP_010931447.1|683190_684468_+|terminase	terminase large subunit	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
WP_010931446.1|684470_685889_+	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
WP_010931445.1|685917_686973_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.6	2.6e-97
WP_010931444.1|686978_687221_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
WP_010931443.1|687343_687946_+	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
WP_005012808.1|688374_689325_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931442.1|689999_690251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247789.1|690313_690796_+	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
WP_010931440.1|690797_690998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931439.1|690997_691393_+	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_010931438.1|691389_691788_+	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
WP_010931437.1|691784_692207_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_010931436.1|692214_692715_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
WP_010931435.1|692969_693488_+|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
WP_003813412.1|693497_693827_+|tail	phage tail assembly chaperone	tail	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
WP_010931434.1|693844_694135_+	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
WP_010931433.1|694160_696773_+|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
WP_010931432.1|696782_697142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931431.1|697209_697743_+	DUF1833 family protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
WP_010931430.1|697739_698129_+	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
WP_010931429.1|698121_702078_+	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
>prophage 8
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	708244	762174	4106294	tRNA,transposase	Planktothrix_phage(50.0%)	46	NA	NA
WP_003814636.1|708244_709975_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.4	4.6e-11
WP_010931419.1|710027_710456_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814641.1|710458_711139_+	protein TolQ	NA	NA	NA	NA	NA
WP_003814643.1|711138_711597_+	protein TolR	NA	NA	NA	NA	NA
WP_010931418.1|711633_712608_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_010931417.1|712624_713941_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_003814650.1|713972_714470_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_003814652.1|714556_715246_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_010931416.1|715245_716295_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003814657.1|716291_717086_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.4e-15
WP_019247923.1|717254_717605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247922.1|717580_718138_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012808.1|719267_720218_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929184.1|722355_723585_+	spore maturation protein	NA	NA	NA	NA	NA
WP_003814419.1|723587_725030_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_010931414.1|725134_726280_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.7e-41
WP_010931413.1|726311_727109_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010931412.1|727133_728693_-	chaperone SurA	NA	NA	NA	NA	NA
WP_010931411.1|728689_731062_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010931410.1|731171_732275_+	phosphotransferase	NA	NA	NA	NA	NA
WP_010931409.1|732274_732967_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003814436.1|733110_733812_+	membrane protein	NA	NA	NA	NA	NA
WP_003814437.1|733796_734174_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_005012067.1|734905_735856_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814441.1|736015_736888_-	oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_003814443.1|737228_737447_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_019247242.1|737486_738866_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010929976.1|738907_740305_-	amidase family protein	NA	NA	NA	NA	NA
WP_010927038.1|740344_741997_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	6.0e-16
WP_010929977.1|742000_742885_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929978.1|742884_743826_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929979.1|743904_745524_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929980.1|745690_746506_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814459.1|746573_747143_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|747143_748094_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814461.1|748748_749846_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_003814462.1|749879_751145_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929591.1|751302_752253_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929982.1|752496_753087_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_010929983.1|753102_755547_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003814467.1|755666_756638_-	FecR family protein	NA	NA	NA	NA	NA
WP_023852739.1|756769_757294_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005012067.1|757253_758204_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929984.1|758425_760621_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_010929985.1|760693_761122_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|761223_762174_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	853052	957544	4106294	holin,transposase	Bacillus_phage(20.0%)	88	NA	NA
WP_010929591.1|853052_854003_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247352.1|854020_854575_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813949.1|854576_855011_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003813951.1|855007_855442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003813952.1|855425_856229_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003813954.1|856245_857061_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_019248500.1|857057_857873_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_010930033.1|858019_858721_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813960.1|858748_860707_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	30.3	8.0e-28
WP_005013747.1|860789_861740_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930032.1|861960_862629_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_010930031.1|862752_863859_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010930030.1|863871_866985_+	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.5	4.5e-57
WP_010930029.1|866981_868475_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010926969.1|868489_869161_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003813974.1|869204_869699_-	azurin	NA	NA	NA	NA	NA
WP_010930027.1|869839_870487_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023853163.1|870590_872639_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930025.1|872635_874648_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930024.1|874673_876008_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003813981.1|876116_877109_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813982.1|877175_879260_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_010930023.1|879284_880256_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930022.1|880384_881416_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_010930021.1|881419_882571_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_076879542.1|882741_883665_+	transcriptional regulator LrhA	NA	NA	NA	NA	NA
WP_003813987.1|883742_884567_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023994644.1|884763_885780_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003813988.1|885976_886960_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930019.1|888558_889947_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003813991.1|889977_890967_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813992.1|891077_892310_-	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_003813993.1|892591_893392_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930018.1|893414_895646_-|holin	choline BCCT transporter BetT	holin	NA	NA	NA	NA
WP_010930017.1|896433_896880_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003813996.1|896901_897648_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003813997.1|897791_898769_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_010930016.1|899402_900014_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	32.5	3.3e-12
WP_003813999.1|900007_901225_-	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_005013747.1|901365_902316_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|902414_903365_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814000.1|903361_904081_-	lipoprotein	NA	NA	NA	NA	NA
WP_003821234.1|904201_906361_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003814002.1|906451_906721_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_003814003.1|907014_907542_+	lipoprotein	NA	NA	NA	NA	NA
WP_003814004.1|907560_908340_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_010930015.1|908507_909524_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814006.1|909596_910088_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|910098_911814_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012067.1|912977_913928_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930051.1|913924_915757_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.3e-27
WP_010930052.1|916155_916815_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_023852837.1|916908_917055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003809770.1|917163_917331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930054.1|917342_918023_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_010930055.1|918304_919021_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_010930056.1|919035_920337_-	phospholipase A	NA	NA	NA	NA	NA
WP_029444137.1|922481_925370_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_010930057.1|925593_926946_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_004568140.1|926974_927496_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003819989.1|927492_928947_+	carboxylase	NA	NA	NA	NA	NA
WP_023852826.1|928981_929230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247557.1|929335_930211_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010930060.1|930236_931292_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930061.1|931304_932096_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930062.1|932128_933499_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005012067.1|934675_935626_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930064.1|935678_935900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003810832.1|936059_936272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003810835.1|936391_937510_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003810839.1|938015_938267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930066.1|938379_939330_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810840.1|939326_939710_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_023852913.1|939764_941579_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	27.9	5.7e-44
WP_010930068.1|941728_942556_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.4	1.7e-67
WP_010930069.1|942601_943582_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003810850.1|943578_943791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003810851.1|943787_944969_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_019248496.1|945132_945867_+	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.2	1.9e-62
WP_010930071.1|945868_948481_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_003810859.1|948616_950530_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_010930072.1|951145_951556_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003810865.1|951653_952739_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_005012067.1|952837_953788_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930088.1|953784_954759_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003821497.1|954883_955795_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.4e-05
WP_004566317.1|956071_956464_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	45.0	4.8e-25
WP_005012808.1|956593_957544_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	976966	1047233	4106294	transposase	Streptococcus_phage(14.29%)	57	NA	NA
WP_005012067.1|976966_977917_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486062.1|977997_978909_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	38.8	8.0e-47
WP_010930108.1|978969_980115_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_003821521.1|980134_981049_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.7	9.8e-45
WP_010930110.1|981120_981870_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_010930111.1|981869_982799_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_003821527.1|983042_984869_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003813333.1|984951_985593_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_170954292.1|985815_986817_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930112.1|988653_989718_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	3.8e-24
WP_010930113.1|990515_991424_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_023852693.1|992911_994186_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_023852686.1|994339_994720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014905652.1|994727_995600_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003813315.1|995905_996286_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003813314.1|996496_997222_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_005012067.1|997317_998268_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930118.1|998372_999422_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_010929632.1|999559_1000576_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010926548.1|1002084_1002657_-	chorismate lyase	NA	NA	NA	NA	NA
WP_010930119.1|1002716_1003448_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_029443805.1|1003499_1004417_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930121.1|1005224_1008404_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_014486063.1|1008400_1009783_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010930123.1|1009852_1010104_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_010930124.1|1010249_1010864_-	SCO family protein	NA	NA	NA	NA	NA
WP_019248379.1|1011050_1013165_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_003811948.1|1013240_1014092_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.1e-33
WP_010930126.1|1014088_1014715_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003817147.1|1014711_1016466_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_010930127.1|1016758_1019464_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_010930128.1|1019476_1021138_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_010930129.1|1021150_1022941_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	2.4e-39
WP_003817151.1|1023162_1024338_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_010929584.1|1024380_1025331_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930130.1|1025429_1026170_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_010930131.1|1026364_1028401_+	transketolase	NA	NA	NA	NA	NA
WP_010930132.1|1028418_1029429_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_010930133.1|1029546_1030740_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_010930134.1|1030769_1031543_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010930135.1|1031539_1032730_-	acetate kinase	NA	NA	NA	NA	NA
WP_003809454.1|1032755_1033694_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_010930136.1|1033690_1036039_-	DUF3141 domain-containing protein	NA	NA	NA	NA	NA
WP_010930137.1|1036193_1036835_-	glutathione transferase	NA	NA	NA	NA	NA
WP_023853531.1|1036938_1038072_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994624.1|1038164_1038317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930138.1|1038348_1038897_-	DinB family protein	NA	NA	NA	NA	NA
WP_003819814.1|1038915_1039401_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930139.1|1039578_1040517_+	DnaJ domain-containing protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
WP_003809467.1|1040519_1040837_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247197.1|1040882_1041827_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010930141.1|1043507_1044158_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_003809479.1|1044211_1044547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930142.1|1044543_1045404_+	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	36.1	2.6e-15
WP_003819817.1|1045420_1045702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003809486.1|1045775_1046039_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005012067.1|1046282_1047233_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	1059451	1117882	4106294	tRNA,protease,holin,transposase	uncultured_Mediterranean_phage(37.5%)	48	NA	NA
WP_010931363.1|1059451_1060468_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930148.1|1061256_1062306_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014486064.1|1062302_1063946_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_010930149.1|1063942_1064830_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003809396.1|1064970_1065444_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_010930151.1|1065433_1066456_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
WP_015041211.1|1066452_1067880_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_010931363.1|1068817_1069834_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003809411.1|1070166_1071102_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.5	3.0e-41
WP_010930154.1|1071151_1073032_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003809416.1|1073098_1073443_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.4	1.0e-10
WP_010930155.1|1073587_1074724_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
WP_023853534.1|1074720_1075794_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003809423.1|1075951_1077388_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_010930157.1|1077478_1078120_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023853536.1|1078455_1079472_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_005012808.1|1081514_1082465_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930160.1|1083667_1085089_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003809431.1|1085352_1086069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003809432.1|1086153_1086471_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003819794.1|1086511_1086925_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_010930161.1|1086926_1087286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023853525.1|1087328_1088873_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_010930163.1|1088956_1089787_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_010930164.1|1089821_1090976_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010930165.1|1091018_1091891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014486065.1|1092007_1094296_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003809441.1|1095502_1095967_+	barstar family protein	NA	NA	NA	NA	NA
WP_005013747.1|1095993_1096944_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_154698393.1|1096961_1097099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930167.1|1097311_1098088_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	28.7	4.3e-17
WP_003809638.1|1098132_1098990_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_010930169.1|1099011_1100028_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_014486066.1|1100162_1101203_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	40.2	2.1e-51
WP_010930171.1|1101397_1103479_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_010930172.1|1103714_1105208_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003809629.1|1105438_1106233_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003819875.1|1106453_1107812_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_010930173.1|1107808_1108651_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	3.2e-26
WP_010930174.1|1108669_1110556_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
WP_162096758.1|1110497_1110749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930175.1|1110793_1111426_-	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_003809618.1|1111444_1112047_+	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_010929591.1|1112198_1113149_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_161633091.1|1113729_1114437_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_003812707.1|1114795_1115782_-	homoserine kinase	NA	NA	NA	NA	NA
WP_010930178.1|1115921_1116935_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005012067.1|1116931_1117882_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	1157582	1219753	4106294	tRNA,transposase	Erysipelothrix_phage(33.33%)	50	NA	NA
WP_010930198.1|1157582_1158533_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248935.1|1158631_1159255_-	serotype 2 fimbrial subunit	NA	NA	NA	NA	NA
WP_010930200.1|1159428_1161711_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_010930201.1|1161865_1164562_-	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_010930202.1|1164687_1165176_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813631.1|1167586_1170457_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_010930204.1|1170502_1171717_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_003813626.1|1171946_1173374_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	2.1e-41
WP_023853245.1|1173471_1174563_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_010930206.1|1174575_1175334_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003813621.1|1175421_1176324_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|1176320_1177271_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930207.1|1177400_1178384_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813618.1|1178438_1179161_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930211.1|1180639_1181995_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010930212.1|1182075_1184451_-	RNA-binding transcriptional accessory protein Tex	NA	NA	NA	NA	NA
WP_010930213.1|1184615_1186691_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	30.0	2.4e-75
WP_003813594.1|1186752_1187553_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_010930214.1|1187654_1188617_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_019247742.1|1188604_1189360_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_010930216.1|1189467_1191105_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_003813586.1|1191172_1191910_+	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_003813585.1|1192012_1192588_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_010930217.1|1192760_1193297_+	iron transporter	NA	NA	NA	NA	NA
WP_003813580.1|1193299_1193644_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010930218.1|1193659_1194505_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_003821443.1|1194543_1195923_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003813574.1|1196000_1196882_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_010929956.1|1196980_1197931_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811632.1|1197927_1198338_-	VOC family protein	NA	NA	NA	NA	NA
WP_010930219.1|1198445_1199300_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003811636.1|1199292_1200255_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930220.1|1200300_1201425_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	28.3	1.5e-31
WP_019247966.1|1201530_1202409_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930222.1|1202533_1203313_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930223.1|1203466_1204888_+	MFS transporter	NA	NA	NA	NA	NA
WP_010930224.1|1205322_1207020_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_010930225.1|1207246_1208188_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_010930226.1|1208514_1209261_+	aldolase	NA	NA	NA	NA	NA
WP_033446252.1|1209268_1210195_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930228.1|1210316_1211234_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003811660.1|1211273_1212227_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811662.1|1212251_1212830_+	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_010930229.1|1214503_1215112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930230.1|1215189_1215543_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_010930231.1|1215626_1216616_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_023852977.1|1216612_1216801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076879566.1|1216818_1217769_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927663.1|1217855_1218806_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931070.1|1218802_1219753_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	1270681	1327891	4106294	transposase	Klosneuvirus(16.67%)	50	NA	NA
WP_010931070.1|1270681_1271632_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931041.1|1275378_1275990_-	DUF2239 family protein	NA	NA	NA	NA	NA
WP_003812368.1|1276212_1277673_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	1.6e-97
WP_010931040.1|1277769_1279362_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	1.0e-17
WP_019247974.1|1279715_1279973_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003816876.1|1279974_1281315_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_010931038.1|1281410_1282100_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247976.1|1282112_1283543_+	MFS transporter	NA	NA	NA	NA	NA
WP_014905903.1|1285267_1286089_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931036.1|1286099_1287671_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010931035.1|1287699_1288677_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931034.1|1288703_1289507_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	2.7e-30
WP_010931033.1|1289503_1290298_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003816890.1|1290305_1291541_+	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_010931032.1|1291533_1291968_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_005013747.1|1292717_1293668_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931031.1|1294289_1296017_-	sulfate permease	NA	NA	NA	NA	NA
WP_010931030.1|1296128_1297487_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_023853289.1|1297543_1297762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|1297779_1298730_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931029.1|1298770_1299841_+	FUSC family protein	NA	NA	NA	NA	NA
WP_010931028.1|1299863_1300742_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010931027.1|1300913_1301885_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010931026.1|1302047_1302890_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931025.1|1303051_1303732_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010931024.1|1303725_1304895_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931023.1|1304891_1305923_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	27.8	1.8e-26
WP_010931022.1|1305966_1307208_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931021.1|1307242_1308775_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931020.1|1308855_1309479_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_010931019.1|1309509_1310121_+	LysE family translocator	NA	NA	NA	NA	NA
WP_010931018.1|1310156_1310627_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_019248146.1|1310801_1311050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248147.1|1311057_1312062_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_010931017.1|1312098_1313613_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931016.1|1313616_1314576_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931015.1|1314604_1315408_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931014.1|1315409_1317044_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	2.9e-15
WP_010931013.1|1317127_1318189_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004567322.1|1318387_1318657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931012.1|1318660_1319185_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	32.9	6.5e-09
WP_010929591.1|1319600_1320551_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931011.1|1320547_1321582_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003816758.1|1321690_1322329_+	DedA family protein	NA	NA	NA	NA	NA
WP_019247724.1|1322623_1322851_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003820420.1|1322973_1323687_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005013747.1|1323931_1324882_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931009.1|1324985_1325267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931008.1|1325381_1326830_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005012808.1|1326940_1327891_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	1418124	1470277	4106294	tRNA,transposase	Salmonella_phage(25.0%)	46	NA	NA
WP_005013747.1|1418124_1419075_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023999730.1|1419092_1419245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814065.1|1419241_1419595_+	cytochrome c	NA	NA	NA	NA	NA
WP_003814063.1|1419607_1419970_+	cytochrome c	NA	NA	NA	NA	NA
WP_003814061.1|1420011_1420437_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_003814059.1|1420639_1421896_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
WP_003814057.1|1422094_1423075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015028.1|1423224_1424466_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_005013747.1|1424564_1425515_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814052.1|1425523_1426219_-	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_003814050.1|1429040_1429640_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_010930950.1|1429650_1431816_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-24
WP_010930949.1|1431839_1433624_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_017685545.1|1433623_1433713_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_003814042.1|1434407_1434680_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_003814040.1|1434679_1436746_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_010929577.1|1436742_1437693_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1437791_1438742_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015014.1|1438857_1439190_-	multidrug transporter	NA	NA	NA	NA	NA
WP_010929073.1|1439186_1439873_-	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_010930948.1|1439859_1440819_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	3.1e-57
WP_003814032.1|1440860_1443221_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.0	7.6e-81
WP_010930946.1|1443220_1443853_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_010930945.1|1443954_1445295_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.9	1.6e-75
WP_010930944.1|1445341_1446697_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	1.6e-83
WP_170954289.1|1446822_1447467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814024.1|1447411_1447729_-	virulence factor	NA	NA	NA	NA	NA
WP_003814023.1|1448001_1448517_-	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	5.1e-06
WP_003814022.1|1448610_1448772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814021.1|1448787_1449543_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_019247690.1|1449881_1450088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814020.1|1450095_1450755_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_010930941.1|1451049_1453254_-	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_010930940.1|1453364_1454588_-	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_003814017.1|1454710_1455685_-	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013753.1|1455752_1456946_-	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_003814016.1|1456960_1457761_-	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_010930939.1|1457757_1459614_-	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_003814014.1|1459610_1460216_-	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_003814013.1|1460234_1461620_-	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_003814012.1|1462345_1463572_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003814011.1|1463660_1464443_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_005012067.1|1464541_1465492_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814010.1|1465518_1466292_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003814009.1|1466303_1467545_+	MFS transporter	NA	NA	NA	NA	NA
WP_076879548.1|1469326_1470277_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	1514202	1582288	4106294	tRNA,transposase	Streptococcus_virus(11.11%)	59	NA	NA
WP_010930416.1|1514202_1514691_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_019248504.1|1514808_1515387_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010930418.1|1515492_1515861_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|1515959_1516910_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994932.1|1516916_1518029_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_010930419.1|1518715_1519918_+	MFS transporter	NA	NA	NA	NA	NA
WP_004568212.1|1519953_1520100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930420.1|1520121_1522782_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_010930421.1|1522794_1526199_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_023995689.1|1526866_1529092_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.5	1.2e-43
WP_010930423.1|1529138_1529465_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_010930424.1|1529515_1530124_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_005013747.1|1530222_1531173_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930425.1|1531242_1532007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930426.1|1532003_1532603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930427.1|1532706_1533558_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	35.3	7.0e-37
WP_010928449.1|1533617_1534244_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_005012067.1|1534240_1535191_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019249265.1|1535289_1536402_-	DUF1513 domain-containing protein	NA	NA	NA	NA	NA
WP_019248041.1|1536391_1537393_-	imelysin family protein	NA	NA	NA	NA	NA
WP_019247498.1|1537498_1539010_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_023853587.1|1539006_1540311_-	imelysin	NA	NA	NA	NA	NA
WP_010930431.1|1540422_1540983_-	membrane protein	NA	NA	NA	NA	NA
WP_010930432.1|1541250_1541805_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.0	1.7e-15
WP_010930433.1|1542260_1542476_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_033446228.1|1542730_1545328_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.6	1.5e-21
WP_010930435.1|1545324_1546512_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010930436.1|1547170_1547785_+	serotype 3 fimbrial subunit	NA	NA	NA	NA	NA
WP_010930437.1|1547873_1549001_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_033446216.1|1549012_1549918_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_005012067.1|1550810_1551761_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930439.1|1551942_1552695_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_003811112.1|1552763_1553423_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003811113.1|1553419_1554148_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	39.3	3.3e-35
WP_010930440.1|1554160_1556440_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.1	5.9e-06
WP_010930441.1|1556464_1556668_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_010930442.1|1556709_1557342_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	33.9	2.4e-13
WP_010930443.1|1557477_1558395_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_010930444.1|1558391_1559105_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_003811135.1|1559342_1560113_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003811137.1|1560117_1560717_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	41.6	1.4e-20
WP_003811138.1|1560961_1562452_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_010926696.1|1562510_1562795_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930445.1|1562932_1563088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811148.1|1563360_1564287_-	YicC family protein	NA	NA	NA	NA	NA
WP_003811149.1|1564423_1565164_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_010930446.1|1565330_1566707_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003811152.1|1566888_1567794_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930448.1|1569445_1571248_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010930449.1|1571374_1572016_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_005012808.1|1572114_1573065_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930450.1|1573086_1574307_+	oxygen-independent coproporphyrinogen III oxidase-like protein	NA	NA	NA	NA	NA
WP_003811164.1|1574492_1575905_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003811167.1|1575968_1577036_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.5	1.1e-05
WP_010930451.1|1577035_1578523_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_010930452.1|1578532_1579477_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811176.1|1579636_1580335_+	pirin family protein	NA	NA	NA	NA	NA
WP_010930453.1|1580412_1581318_+	pirin family protein	NA	NA	NA	NA	NA
WP_005012067.1|1581337_1582288_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	1618237	1673828	4106294	transposase	Brazilian_cedratvirus(25.0%)	47	NA	NA
WP_005013747.1|1618237_1619188_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930486.1|1619246_1620020_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486074.1|1620012_1621569_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_005013747.1|1621565_1622516_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810741.1|1623842_1624445_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003810743.1|1624684_1625386_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003816696.1|1625379_1626162_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
WP_005012808.1|1626346_1627297_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930483.1|1627395_1628133_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
WP_010926609.1|1628322_1629081_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930482.1|1629127_1630117_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930481.1|1630294_1631263_-	transporter	NA	NA	NA	NA	NA
WP_010930480.1|1632802_1633771_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010930479.1|1633779_1634721_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010930478.1|1635194_1636205_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930477.1|1636195_1637710_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930476.1|1637706_1639053_+	BatD family protein	NA	NA	NA	NA	NA
WP_010930475.1|1639055_1640090_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_023852967.1|1640139_1641765_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
WP_005012067.1|1642317_1643268_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930487.1|1643372_1644320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247865.1|1644373_1646188_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010930489.1|1646180_1646855_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023995112.1|1646984_1650059_+	autotransporter SphB2	NA	NA	NA	NA	NA
WP_019247905.1|1650072_1650372_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930492.1|1650686_1651310_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_010930493.1|1651553_1652423_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010930494.1|1652400_1653345_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247909.1|1653430_1654357_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247910.1|1654469_1655249_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930497.1|1655239_1656436_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010930498.1|1656466_1657417_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_010930499.1|1657638_1658328_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930500.1|1658392_1659148_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930501.1|1659199_1660192_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930502.1|1660201_1661155_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811538.1|1661270_1662233_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019249376.1|1663634_1664063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|1664059_1665010_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_170954298.1|1665303_1666041_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
WP_010930504.1|1666464_1667652_-	MFS transporter	NA	NA	NA	NA	NA
WP_019249653.1|1667655_1668036_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930506.1|1669755_1670727_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930507.1|1670740_1671454_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930508.1|1671458_1672376_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811452.1|1672482_1672779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929588.1|1672877_1673828_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	1831595	1890865	4106294	tRNA,protease,transposase	Klosneuvirus(40.0%)	51	NA	NA
WP_005013747.1|1831595_1832546_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930573.1|1832670_1833480_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929577.1|1833680_1834631_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930574.1|1835904_1837122_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_003818670.1|1838178_1839081_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930576.1|1839157_1840030_+	MOSC N-terminal beta barrel domain-containing protein	NA	NA	NA	NA	NA
WP_003818672.1|1840160_1840529_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_010930577.1|1840586_1841633_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_010930578.1|1841828_1843085_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_003810623.1|1843089_1844427_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003818676.1|1844576_1845533_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247555.1|1845635_1846568_-	acyclic terpene utilization AtuA family protein	NA	NA	NA	NA	NA
WP_019247554.1|1846683_1847004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247553.1|1846996_1847356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930581.1|1847403_1848978_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003810637.1|1849030_1849975_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930582.1|1849992_1850823_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930583.1|1850815_1852450_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	8.2e-18
WP_010930584.1|1852446_1853802_+	amidase	NA	NA	NA	NA	NA
WP_010930585.1|1854708_1856286_+	lipoprotein	NA	NA	NA	NA	NA
WP_010930586.1|1856289_1857564_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_010930587.1|1857661_1858036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930588.1|1859751_1860885_+	general secretion pathway protein	NA	NA	NA	NA	NA
WP_003810661.1|1860922_1861528_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_010930589.1|1861524_1862343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930590.1|1862414_1865039_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.7e-81
WP_004568544.1|1865025_1865280_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_010930591.1|1865346_1865928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926757.1|1866231_1866492_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_014905757.1|1866657_1867281_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003816734.1|1867280_1868054_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_010930593.1|1868050_1869259_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010930594.1|1869284_1869758_-	RidA family protein	NA	NA	NA	NA	NA
WP_010930048.1|1869831_1870782_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879566.1|1870880_1871831_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930796.1|1871929_1873279_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_023852900.1|1874044_1874800_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_010930794.1|1874892_1877775_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
WP_003810689.1|1878097_1878523_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
WP_004568542.1|1878550_1879699_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_003810693.1|1879695_1880202_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930793.1|1880208_1881504_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_023995843.1|1881562_1882849_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010930791.1|1882850_1883489_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003810701.1|1883491_1884652_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_003810703.1|1884678_1886034_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_010930790.1|1886037_1887108_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
WP_003810707.1|1887246_1887483_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_010930789.1|1887570_1888677_+	GTPase HflX	NA	NA	NA	NA	NA
WP_010930788.1|1888642_1889947_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_010930787.1|1889965_1890865_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 18
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	1901105	1945428	4106294	transposase	Staphylococcus_phage(25.0%)	45	NA	NA
WP_005013747.1|1901105_1902056_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|1902154_1903105_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930782.1|1903304_1904390_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003810400.1|1904405_1905167_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_170954295.1|1905163_1906123_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.6	1.7e-23
WP_010930780.1|1906185_1906686_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930779.1|1906718_1907462_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010930778.1|1907557_1907797_-	membrane protein	NA	NA	NA	NA	NA
WP_010930777.1|1907810_1907963_-	lipoprotein	NA	NA	NA	NA	NA
WP_010930776.1|1908048_1909539_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_010930775.1|1909630_1910569_-	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_003818560.1|1910565_1910742_-	cytochrome oxidase	NA	NA	NA	NA	NA
WP_003810383.1|1910744_1911407_-	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_003810379.1|1913028_1913172_-	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_010930774.1|1913168_1914143_-	membrane protein	NA	NA	NA	NA	NA
WP_162268682.1|1914037_1914292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1914309_1915260_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930773.1|1915256_1916531_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	9.6e-14
WP_010930772.1|1916634_1917828_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_010930771.1|1917824_1918478_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930770.1|1918474_1919911_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_010930769.1|1919898_1920258_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_162268681.1|1921072_1921213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1921230_1922181_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930768.1|1923226_1925092_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930767.1|1925349_1926870_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003816959.1|1926957_1927608_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010930766.1|1928556_1929852_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_010930765.1|1929873_1930758_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930764.1|1930856_1931732_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003816964.1|1931721_1932078_-	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_010930763.1|1932208_1933183_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003812228.1|1933312_1933492_-	DUF3008 family protein	NA	NA	NA	NA	NA
WP_029443822.1|1933589_1934114_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_010930761.1|1934124_1934961_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003816971.1|1935073_1935445_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930760.1|1935441_1935993_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_003816975.1|1936008_1937700_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.3	5.0e-42
WP_003816977.1|1937748_1938429_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014905663.1|1938676_1939141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930758.1|1939310_1940240_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_019247659.1|1940252_1940900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023997035.1|1940973_1942791_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.3e-37
WP_005012067.1|1942874_1943825_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|1944477_1945428_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	1975201	2039570	4106294	transposase	Vibrio_phage(20.0%)	51	NA	NA
WP_005013747.1|1975201_1976152_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015810.1|1976373_1977324_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852887.1|1977422_1978388_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930740.1|1978525_1979425_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930739.1|1982019_1983507_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_014486081.1|1983517_1984714_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_003816680.1|1984786_1986106_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_010930737.1|1986102_1986978_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930736.1|1987008_1988157_-	CoA transferase	NA	NA	NA	NA	NA
WP_010930735.1|1988174_1988489_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_062810228.1|1988510_1989233_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003816690.1|1989232_1990051_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003816691.1|1990055_1990583_-	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_010930733.1|1990588_1991845_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_010930732.1|1992203_1993343_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930731.1|1993420_1994293_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930730.1|1995163_1996114_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930729.1|1996073_1996709_-	membrane protein	NA	NA	NA	NA	NA
WP_010930728.1|1997068_1998391_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_010930727.1|1998709_1999531_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.6	4.1e-42
WP_003810356.1|2000955_2001528_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_010930726.1|2001567_2003397_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_010930725.1|2003359_2004418_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_010930724.1|2004455_2004917_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003810344.1|2005001_2005748_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019247651.1|2007238_2010469_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_019248531.1|2010535_2011867_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010930721.1|2012119_2012494_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930720.1|2012596_2013775_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_003810329.1|2013785_2014376_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003818535.1|2014486_2015293_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_010930719.1|2015318_2016113_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.7	5.1e-05
WP_010930718.1|2017113_2018088_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003818533.1|2018246_2018759_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	52.3	1.8e-43
WP_003818532.1|2018915_2019887_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930717.1|2021631_2022438_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010930716.1|2022434_2023736_-	malonyl-CoA decarboxylase family protein	NA	NA	NA	NA	NA
WP_010930715.1|2023686_2024451_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930714.1|2024564_2025335_-	spermidine synthase	NA	NA	NA	NA	NA
WP_010930713.1|2025419_2026607_-	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_003818524.1|2026679_2027054_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_003810308.1|2027154_2028417_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	6.8e-28
WP_003810306.1|2028413_2029271_-	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_003818523.1|2029443_2030445_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929591.1|2030896_2031847_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930712.1|2033362_2034562_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003810297.1|2034930_2035167_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_010930711.1|2035230_2035398_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_010930710.1|2035511_2037317_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.5	2.2e-19
WP_062826579.1|2037570_2038521_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931070.1|2038619_2039570_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	2171099	2220751	4106294	tRNA,transposase	Synechococcus_phage(15.38%)	43	NA	NA
WP_005012067.1|2171099_2172050_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879626.1|2172148_2174143_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.3	4.4e-21
WP_010930543.1|2174202_2175168_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_010930542.1|2175157_2178019_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
WP_010930541.1|2178021_2178528_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_010930540.1|2178632_2179841_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
WP_033446178.1|2179842_2180781_-	membrane protein	NA	NA	NA	NA	NA
WP_010930538.1|2180942_2181416_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|2181412_2182363_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566334.1|2182473_2182914_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_010930537.1|2183042_2184272_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_004566336.1|2184310_2185132_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_029443743.1|2185185_2186337_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930535.1|2186428_2186917_-	DUF1854 domain-containing protein	NA	NA	NA	NA	NA
WP_019247811.1|2189467_2192017_+	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_010930533.1|2192087_2194661_+	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_003813568.1|2194926_2195127_+	CsbD family protein	NA	NA	NA	NA	NA
WP_003813570.1|2195158_2195320_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_003813572.1|2195377_2195716_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|2195864_2196815_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247882.1|2197588_2198257_+	arylesterase	NA	NA	NA	NA	NA
WP_019247881.1|2198238_2200254_-	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004568486.1|2200436_2201186_+	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	27.8	1.5e-14
WP_003816518.1|2201198_2202062_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_003816520.1|2202065_2203481_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_010930530.1|2203614_2204343_-	redoxin family protein	NA	A0A1D8KSL1	Synechococcus_phage	56.8	9.6e-43
WP_003811035.1|2204481_2204682_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003816523.1|2204857_2205256_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003816525.1|2205279_2206680_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.5	7.3e-31
WP_010930529.1|2206798_2207551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930528.1|2207839_2208439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248494.1|2208543_2209323_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_003811022.1|2209319_2210204_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
WP_019247478.1|2210221_2211001_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
WP_010930526.1|2210985_2211744_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.4e-68
WP_003811015.1|2211869_2212517_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_010929632.1|2212784_2213801_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930524.1|2213898_2214939_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.3	6.1e-91
WP_003811011.1|2215073_2216366_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	1.7e-66
WP_003811007.1|2217725_2218109_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
WP_010930523.1|2218126_2218714_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.8	4.7e-16
WP_005012067.1|2218751_2219702_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930048.1|2219800_2220751_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	2476009	2534253	4106294	tRNA,transposase	Planktothrix_phage(28.57%)	54	NA	NA
WP_005012067.1|2476009_2476960_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930388.1|2477439_2478096_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_010930387.1|2478110_2479778_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_010930386.1|2479780_2480410_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_014486072.1|2480621_2481716_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930384.1|2481860_2482673_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_023853502.1|2482676_2484380_-	FimV N-terminal domain protein	NA	NA	NA	NA	NA
WP_010930382.1|2484430_2485561_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010930381.1|2485747_2486824_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_010930380.1|2486905_2487556_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_010930379.1|2487570_2488974_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_004567445.1|2489257_2490076_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010930378.1|2490072_2490777_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	2.6e-13
WP_010930377.1|2491676_2492792_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004567447.1|2492825_2493200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930376.1|2493222_2494380_-	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_003812666.1|2494392_2494626_-	lipoprotein	NA	NA	NA	NA	NA
WP_019247523.1|2495260_2498230_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_023853518.1|2498244_2498454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248667.1|2498605_2499235_-	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_010930373.1|2499231_2501322_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_010930372.1|2501345_2502026_-	DUF3306 domain-containing protein	NA	NA	NA	NA	NA
WP_003820494.1|2502022_2502583_-	DUF3305 domain-containing protein	NA	NA	NA	NA	NA
WP_004567450.1|2502589_2503687_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010930371.1|2503839_2504433_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_010930370.1|2504429_2505722_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_003812685.1|2505735_2506278_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_010930369.1|2506287_2507124_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003820487.1|2507157_2508219_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.8	2.9e-80
WP_019247210.1|2508260_2509313_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_019247209.1|2509328_2509631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012808.1|2509772_2510723_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162268680.1|2510740_2510905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930368.1|2510901_2512596_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003809599.1|2512592_2513678_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	6.4e-27
WP_010930367.1|2513725_2514625_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003809593.1|2514635_2515280_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010930366.1|2516301_2519544_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_023852833.1|2519554_2520709_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	3.3e-53
WP_010930364.1|2520935_2521898_+	transaldolase	NA	H6WFR1	Cyanophage	29.2	7.5e-11
WP_076879624.1|2521996_2522947_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930363.1|2523045_2523996_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930362.1|2524005_2524695_-	VIT family protein	NA	NA	NA	NA	NA
WP_003811741.1|2524754_2525192_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003811743.1|2525237_2526131_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003811746.1|2526178_2527351_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003811748.1|2527347_2528502_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003811750.1|2528698_2529049_-	RnfH family protein	NA	NA	NA	NA	NA
WP_003811752.1|2529038_2529473_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_010930800.1|2529489_2530440_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811754.1|2530587_2531055_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.1	6.2e-27
WP_010930360.1|2531035_2532193_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.2	2.3e-14
WP_003811759.1|2532258_2533185_-	paraslipin	NA	NA	NA	NA	NA
WP_005012067.1|2533302_2534253_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	2576531	2643031	4106294	transposase	uncultured_Caudovirales_phage(40.0%)	56	NA	NA
WP_005012067.1|2576531_2577482_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811850.1|2577851_2578424_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_003811852.1|2578426_2579437_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_010930335.1|2579429_2579930_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_003811855.1|2579940_2580282_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_015041547.1|2580293_2581085_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_003811859.1|2581101_2581371_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_010930333.1|2581393_2582182_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_010929632.1|2582228_2583245_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_014486070.1|2583461_2584904_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	41.8	1.0e-35
WP_010930332.1|2585082_2586702_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	1.5e-08
WP_010930331.1|2586822_2588643_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	6.4e-11
WP_010930330.1|2588721_2590254_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_010930329.1|2590287_2591934_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_010930328.1|2592003_2593026_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.4	1.9e-12
WP_010930327.1|2593043_2594177_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_010930326.1|2594179_2594869_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_010930325.1|2594868_2595654_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_003817181.1|2595697_2596462_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_003817180.1|2596500_2597922_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_010930324.1|2597987_2598692_-	flagellar basal body rod modification protein FlgD	NA	NA	NA	NA	NA
WP_003817176.1|2598739_2599159_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_010930323.1|2599171_2599579_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_010930322.1|2599762_2600473_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_003817172.1|2600599_2600890_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_003817170.1|2600907_2601390_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_010930321.1|2605895_2607050_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_010931363.1|2607355_2608372_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930319.1|2608618_2609407_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003812020.1|2609473_2610154_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812022.1|2610150_2610921_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
WP_010930208.1|2611019_2611970_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811401.1|2612025_2612943_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_003811400.1|2612953_2614132_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_010930318.1|2614151_2615147_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811396.1|2616735_2617344_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003811393.1|2617331_2618372_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003811391.1|2618389_2619352_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811389.1|2619348_2620542_-	CoA transferase	NA	NA	NA	NA	NA
WP_010930317.1|2620538_2621336_-	citryl-CoA lyase	NA	NA	NA	NA	NA
WP_014486069.1|2621361_2622348_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930316.1|2622366_2624406_-	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_010930315.1|2624607_2625288_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930314.1|2625301_2626213_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_003811381.1|2626209_2626788_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010930313.1|2626926_2627832_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930312.1|2627839_2631259_+	TM0106 family RecB-like putative nuclease	NA	NA	NA	NA	NA
WP_010930311.1|2631246_2633847_-	BP1344/BB2830 family autotransporter	NA	NA	NA	NA	NA
WP_003811375.1|2634802_2635435_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003811372.1|2635828_2636587_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_003811370.1|2636583_2637786_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_010930208.1|2637973_2638924_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930310.1|2639831_2640977_+	DUF3182 family protein	NA	NA	NA	NA	NA
WP_019247449.1|2640963_2641719_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003811361.1|2641835_2642015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930208.1|2642080_2643031_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	2671146	2708558	4106294	transposase	Planktothrix_phage(33.33%)	39	NA	NA
WP_005012067.1|2671146_2672097_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2672195_2673146_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811316.1|2673238_2673778_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_023852799.1|2673884_2674229_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.4	3.0e-31
WP_010930298.1|2674286_2675735_-	CoA transferase	NA	NA	NA	NA	NA
WP_003811313.1|2675922_2676258_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010930297.1|2677885_2679064_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_003811310.1|2679146_2679647_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.4	4.7e-25
WP_010930296.1|2679756_2680458_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010930295.1|2680469_2680934_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023852802.1|2680948_2681224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003811306.1|2681220_2681997_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_010930294.1|2682025_2682853_+	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_010930293.1|2682978_2683449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003811301.1|2683575_2684469_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_010930292.1|2684516_2685698_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003811298.1|2685710_2686526_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930291.1|2686659_2687187_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_003811295.1|2687183_2687681_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_003811293.1|2687828_2688206_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_010929584.1|2688427_2689378_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811244.1|2689476_2690088_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930290.1|2690322_2691450_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930289.1|2691560_2692649_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.2	2.2e-19
WP_003811259.1|2692701_2693553_-	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
WP_003811262.1|2693572_2694454_-	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
WP_010930288.1|2694630_2695944_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_003811267.1|2696154_2696988_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_010930287.1|2696984_2697566_+	queuosine precursor transporter	NA	A0A2I7SAW6	Vibrio_phage	37.3	9.4e-17
WP_005015810.1|2697919_2698870_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930286.1|2698885_2700001_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003811272.1|2700103_2701030_+	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_010930285.1|2701029_2702268_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_003811277.1|2702264_2703032_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	1.2e-14
WP_010930284.1|2703032_2703734_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	1.3e-17
WP_019247793.1|2703815_2704262_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_010930283.1|2705151_2705790_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012808.1|2706558_2707509_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012808.1|2707607_2708558_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	2807685	2862202	4106294	transposase	Diachasmimorpha_longicaudata_entomopoxvirus(20.0%)	48	NA	NA
WP_076879566.1|2807685_2808636_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931071.1|2808964_2809570_+	fimbrial major subunit FimX	NA	NA	NA	NA	NA
WP_010931072.1|2809623_2810937_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_003813284.1|2811011_2811482_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_010931073.1|2811481_2812270_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_010931074.1|2812280_2813933_-	phenylacetic acid degradation protein PaaN	NA	NA	NA	NA	NA
WP_010929591.1|2814020_2814971_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931075.1|2816132_2816639_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_003813293.1|2816635_2817400_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_010931076.1|2817415_2817700_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_003813298.1|2817764_2818754_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_010931077.1|2818925_2819855_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_003813302.1|2819826_2820513_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_003813303.1|2820546_2821092_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.7	2.1e-26
WP_003813306.1|2821136_2822402_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003813309.1|2822398_2823301_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_019247679.1|2824482_2825427_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931079.1|2825521_2827039_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931080.1|2827080_2828709_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_003811986.1|2828816_2829698_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931081.1|2832810_2833185_+	endonuclease	NA	F4YXR7	Roseobacter_phage	54.4	2.1e-25
WP_003812004.1|2833209_2833548_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931082.1|2833591_2835226_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.6	8.3e-87
WP_010931083.1|2835264_2836611_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_003812010.1|2836718_2838140_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_010931084.1|2838209_2838794_-	nitroreductase	NA	NA	NA	NA	NA
WP_005012067.1|2838896_2839847_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931085.1|2839981_2841088_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010931086.1|2841098_2842196_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_010931087.1|2842340_2843546_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_010931088.1|2843552_2844074_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_010931089.1|2844070_2844562_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_003819740.1|2844558_2844810_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_003819741.1|2844790_2845276_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_010931090.1|2845411_2848873_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_010931091.1|2848890_2849775_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_010931092.1|2849784_2850216_-	lipoprotein	NA	NA	NA	NA	NA
WP_003809348.1|2850462_2850966_+	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.1	1.8e-24
WP_010931094.1|2851043_2852444_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931095.1|2852518_2853394_-	membrane protein	NA	NA	NA	NA	NA
WP_023853546.1|2853390_2854398_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_010931097.1|2854865_2855171_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_003819753.1|2855261_2855852_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930525.1|2856042_2857059_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010931098.1|2857250_2859587_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.8	3.2e-124
WP_003812014.1|2859669_2860104_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_023995489.1|2860202_2861153_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|2861251_2862202_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	2870227	2927012	4106294	protease,transposase	uncultured_Mediterranean_phage(28.57%)	41	NA	NA
WP_005012067.1|2870227_2871178_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931105.1|2872884_2873151_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_003812839.1|2873858_2874197_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931107.1|2878749_2879352_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931108.1|2879448_2880738_+	MFS transporter	NA	NA	NA	NA	NA
WP_003812846.1|2880795_2881527_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
WP_010931109.1|2881523_2882327_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
WP_003812851.1|2882323_2883412_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003820410.1|2883408_2884338_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812857.1|2884486_2885632_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930800.1|2885653_2886604_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_154698391.1|2886621_2886780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931110.1|2886934_2890756_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010931111.1|2890912_2891581_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_014905522.1|2891585_2893259_-	MCE family protein	NA	NA	NA	NA	NA
WP_003820402.1|2893277_2894597_-	PqiA/YebS family transporter subunit	NA	NA	NA	NA	NA
WP_010931114.1|2894601_2896917_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
WP_010931115.1|2896972_2899141_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_010931116.1|2899137_2904327_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_003820400.1|2904416_2904731_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
WP_003812875.1|2904958_2905204_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
WP_003820399.1|2905298_2905817_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.1e-14
WP_010931117.1|2905916_2907122_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_019247560.1|2907237_2908635_-	chloride channel protein	NA	NA	NA	NA	NA
WP_010931119.1|2908751_2909330_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_010931120.1|2909402_2910794_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
WP_005012067.1|2910961_2911912_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812889.1|2912192_2912813_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010931122.1|2912809_2913223_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_010931123.1|2913219_2914263_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_003812895.1|2914318_2914507_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_010931124.1|2914516_2915281_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010931125.1|2915371_2916028_+	adenylate kinase	NA	NA	NA	NA	NA
WP_010931126.1|2916119_2916878_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010931127.1|2916903_2918505_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_010931128.1|2918705_2919710_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_003812908.1|2919810_2920074_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_010931129.1|2920191_2920968_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_005012067.1|2921558_2922509_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931130.1|2924892_2926005_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_005012808.1|2926061_2927012_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	2957398	3001089	4106294	transposase	Planktothrix_phage(33.33%)	41	NA	NA
WP_005012067.1|2957398_2958349_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162268686.1|2958366_2958516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023852715.1|2958469_2959366_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_003814547.1|2961643_2963869_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_003814544.1|2964033_2965122_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
WP_019247918.1|2965078_2965732_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931144.1|2965779_2966577_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930176.1|2967108_2968059_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247277.1|2968133_2969288_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_005012067.1|2969344_2970295_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814535.1|2970393_2970699_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003820797.1|2970727_2971162_-	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_010931147.1|2971163_2972408_-	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_003820799.1|2972404_2973115_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033446288.1|2973129_2974041_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931149.1|2974403_2974808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247890.1|2974804_2975263_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_019247891.1|2975269_2976178_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_010931150.1|2976174_2977041_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003814524.1|2977027_2977855_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003820806.1|2977865_2978993_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
WP_023852748.1|2980070_2981309_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931152.1|2981350_2982613_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010931153.1|2982619_2983372_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_019248355.1|2983423_2983609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003820813.1|2983884_2984349_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_003820814.1|2984380_2985040_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_010931154.1|2985184_2987293_+	AsmA family protein	NA	NA	NA	NA	NA
WP_023852714.1|2987289_2988240_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931155.1|2988343_2988964_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931156.1|2989055_2989808_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019248356.1|2990942_2992067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247402.1|2992112_2992481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2992722_2993673_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247492.1|2994708_2995251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023998107.1|2995448_2995619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2995636_2996587_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023997028.1|2996583_2997549_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003815281.1|2997618_2998455_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
WP_010931158.1|2998967_3000077_+	porin	NA	NA	NA	NA	NA
WP_005012067.1|3000138_3001089_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	3123673	3187507	4106294	tRNA,protease,transposase	Pseudomonas_phage(30.0%)	57	NA	NA
WP_005015810.1|3123673_3124624_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_047122802.1|3124769_3125894_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.3	3.8e-38
WP_023853315.1|3126099_3126663_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_003814871.1|3127657_3128140_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003814873.1|3128297_3129545_-	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.7	1.1e-99
WP_003820605.1|3129764_3130421_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003814877.1|3130456_3131686_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_158516320.1|3131780_3131936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929591.1|3131953_3132904_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931221.1|3132995_3134411_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	46.9	1.9e-18
WP_010931222.1|3134416_3135553_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_003814883.1|3135622_3135994_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	56.9	4.7e-30
WP_010931223.1|3136081_3136828_-	membrane protein	NA	NA	NA	NA	NA
WP_003820599.1|3136864_3137929_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_010931224.1|3138117_3138510_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_010927106.1|3138519_3138948_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004567739.1|3139243_3140341_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004567741.1|3140682_3142047_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_023853313.1|3142105_3142657_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_010931226.1|3142670_3143345_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010931227.1|3144601_3145411_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	2.6e-33
WP_010931228.1|3145413_3146250_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003820594.1|3146264_3146957_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_003820593.1|3146968_3147358_-	VOC family protein	NA	NA	NA	NA	NA
WP_003820592.1|3147463_3148852_-	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	33.5	4.6e-54
WP_010931229.1|3148968_3150465_-	membrane protein	NA	NA	NA	NA	NA
WP_010931230.1|3150761_3151436_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|3151534_3152485_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3152583_3153534_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931231.1|3153530_3155990_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003814917.1|3156086_3157532_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010931233.1|3157535_3158723_-	MFS transporter	NA	NA	NA	NA	NA
WP_023998238.1|3158791_3159301_-	lipoprotein	NA	NA	NA	NA	NA
WP_003814925.1|3159502_3159955_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_192855352.1|3159927_3160494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247415.1|3160516_3163579_+	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_010931235.1|3163884_3166812_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	43.9	3.4e-171
WP_003814929.1|3166833_3168030_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	28.9	1.0e-33
WP_010931236.1|3168347_3168875_+	histone H1-like DNA-binding protein	NA	NA	NA	NA	NA
WP_010931237.1|3169013_3169589_+	YggT family protein	NA	NA	NA	NA	NA
WP_010931238.1|3169596_3171060_-	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9L3I8	Tupanvirus	25.1	7.3e-26
WP_010931239.1|3171070_3172198_-	membrane-bound O-acyltransferase	NA	A0A125RNP0	Pseudomonas_phage	30.8	3.7e-25
WP_003814941.1|3172327_3173455_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003814943.1|3173480_3173720_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_010931240.1|3174000_3174504_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_010931241.1|3174676_3175618_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_010931242.1|3175629_3176727_-	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_003814951.1|3177692_3179039_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003814952.1|3179048_3179498_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003814953.1|3179587_3180022_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_023853327.1|3180100_3180649_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_003814955.1|3180731_3182102_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_010931244.1|3182112_3182706_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_014486102.1|3182777_3184661_+	RNB domain-containing ribonuclease	NA	NA	NA	NA	NA
WP_010931246.1|3184698_3185598_+	TonB family protein	NA	NA	NA	NA	NA
WP_010931247.1|3185594_3186458_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_005012067.1|3186556_3187507_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	3235650	3249838	4106294	protease,transposase	Erwinia_phage(100.0%)	15	NA	NA
WP_005012808.1|3235650_3236601_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814611.1|3237045_3237357_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003820745.1|3237356_3237887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127013038.1|3237843_3238032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3238049_3239000_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003820744.1|3239289_3239754_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_010931270.1|3239768_3241274_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_023853019.1|3241530_3243135_+	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_003814620.1|3243190_3244096_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005013747.1|3244536_3245487_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|3245585_3246536_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023853416.1|3246617_3247199_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003807161.1|3247623_3247929_+	copper-binding protein	NA	NA	NA	NA	NA
WP_003807162.1|3247942_3249277_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.6	3.5e-43
WP_010931291.1|3249298_3249838_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 29
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	3268261	3332552	4106294	protease,tRNA,holin,integrase,transposase	Tupanvirus(12.5%)	49	3261655:3261673	3334413:3334431
3261655:3261673	attL	GGCCAGCGCGCGGGCGCGC	NA	NA	NA	NA
WP_010931277.1|3268261_3268597_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003807199.1|3268596_3269439_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_005013747.1|3269537_3270488_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818443.1|3270552_3271524_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003818444.1|3271587_3272607_-	histone deacetylase family protein	NA	A0A2K9L473	Tupanvirus	31.7	3.4e-22
WP_003807204.1|3272608_3273982_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_010931276.1|3274259_3274940_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_023995440.1|3274952_3277079_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	36.6	5.5e-14
WP_010931274.1|3277075_3278170_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.5	2.4e-50
WP_004566001.1|3278184_3279444_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010931273.1|3279463_3281188_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	9.5e-49
WP_003818450.1|3281426_3282179_-	uracil-DNA glycosylase	NA	A0A1Y0B680	Bovine_alphaherpesvirus	47.5	2.5e-46
WP_005012808.1|3282317_3283268_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443788.1|3283580_3285059_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_010931293.1|3285065_3286175_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	7.5e-23
WP_003808339.1|3286186_3286867_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003808340.1|3286888_3287644_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010925959.1|3287779_3288664_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010931294.1|3288751_3289333_+	CGNR zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_004566249.1|3289593_3289893_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_010931296.1|3290044_3290524_-	membrane protein	NA	NA	NA	NA	NA
WP_023853362.1|3291243_3292680_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003808356.1|3292676_3293180_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3293195_3294146_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814148.1|3294673_3295447_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814146.1|3295579_3296590_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931298.1|3296741_3298397_-	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_003814142.1|3298451_3298793_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010931299.1|3298806_3300246_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003814139.1|3300378_3301194_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023994811.1|3301157_3301370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929591.1|3301387_3302338_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443749.1|3303725_3304673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014905961.1|3304899_3305640_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3305725_3306676_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162291319.1|3306693_3306849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014905963.1|3308117_3309689_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019247179.1|3310021_3311875_+	autotransporter-associated beta strand repeat-containing protein	NA	NA	NA	NA	NA
WP_019247178.1|3311919_3314484_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|3314902_3315853_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_077274087.1|3318718_3319213_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_010931070.1|3319229_3320180_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931301.1|3320363_3321575_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010931302.1|3321590_3324542_-	restriction endonuclease subunit M	NA	G8I4P9	Mycobacterium_phage	25.1	2.9e-21
WP_010931303.1|3324543_3327663_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_010931304.1|3327810_3328857_-	Fic family protein	NA	NA	NA	NA	NA
WP_010931305.1|3329198_3330326_-|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	33.6	1.4e-48
WP_010931306.1|3330605_3331697_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_010931307.1|3331769_3332552_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
3334413:3334431	attR	GGCCAGCGCGCGGGCGCGC	NA	NA	NA	NA
>prophage 30
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	3382083	3435824	4106294	transposase	Staphylococcus_phage(33.33%)	48	NA	NA
WP_023995489.1|3382083_3383034_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931336.1|3383438_3384083_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_019247677.1|3384107_3384692_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_014905506.1|3384792_3385410_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_010931337.1|3385412_3387128_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_010931338.1|3387124_3387433_-	urease subunit beta	NA	NA	NA	NA	NA
WP_003814828.1|3387449_3388067_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_010931340.1|3388111_3388414_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_003814832.1|3388514_3389369_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_124740609.1|3389556_3389781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929281.1|3389950_3390223_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010929282.1|3390640_3391048_-	GFA family protein	NA	NA	NA	NA	NA
WP_010931341.1|3391417_3392212_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010927102.1|3392312_3393548_+	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_003814852.1|3393616_3394633_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931342.1|3394644_3396021_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003814856.1|3396017_3397214_+	MFS transporter	NA	NA	NA	NA	NA
WP_003814858.1|3397210_3398749_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_010931343.1|3398745_3400005_-	YeaH/YhbH family protein	NA	NA	NA	NA	NA
WP_005012067.1|3401945_3402896_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931344.1|3403662_3404757_-	CoA transferase	NA	NA	NA	NA	NA
WP_019247312.1|3404749_3406084_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_003808193.1|3406037_3406721_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024000003.1|3406746_3407910_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004566224.1|3407906_3408908_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931346.1|3408907_3409780_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931347.1|3409776_3410526_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
WP_010931348.1|3410522_3411314_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
WP_010931349.1|3411310_3412450_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047122778.1|3412725_3413511_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486103.1|3413544_3414327_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_010931351.1|3414330_3414720_+	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_010931352.1|3415859_3416723_+	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010931353.1|3416758_3417847_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_010931070.1|3417843_3418794_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247959.1|3419147_3422126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003818344.1|3423052_3423931_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_005013747.1|3425879_3426830_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931354.1|3426826_3427294_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
WP_010931355.1|3427336_3428107_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010927090.1|3428127_3428928_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010931356.1|3428938_3430348_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_003814739.1|3430442_3431228_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010931561.1|3431467_3432484_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814742.1|3432591_3432984_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010931357.1|3433121_3433802_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_023994844.1|3433806_3434778_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930179.1|3434873_3435824_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	3441979	3501277	4106294	tRNA,transposase	Acinetobacter_phage(27.27%)	48	NA	NA
WP_003820957.1|3441979_3443743_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
WP_010931362.1|3443854_3444733_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003814250.1|3444845_3445661_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003814252.1|3445664_3445916_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_010929632.1|3446000_3447017_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814254.1|3447347_3447569_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_019247693.1|3449929_3450847_-	DMT family transporter	NA	NA	NA	NA	NA
WP_019247692.1|3451344_3452553_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931365.1|3452632_3454204_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814275.1|3454321_3455257_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003814277.1|3455445_3456390_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
WP_003814283.1|3456957_3462675_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
WP_010931367.1|3462680_3463808_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	37.8	3.8e-38
WP_003814287.1|3463863_3464490_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_010931363.1|3464761_3465778_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010927020.1|3465873_3466584_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931368.1|3466580_3467570_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931369.1|3467665_3469297_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_010931370.1|3469299_3470037_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247745.1|3470192_3471065_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_003814298.1|3471333_3472554_+	MFS transporter	NA	NA	NA	NA	NA
WP_003814300.1|3472550_3473210_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_003814302.1|3473281_3473914_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_010931372.1|3473943_3474462_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_010931373.1|3474472_3475582_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003814312.1|3475628_3476483_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_010931374.1|3476484_3477387_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3478609_3479560_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023997720.1|3481314_3482304_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247413.1|3482300_3482459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931375.1|3482479_3483268_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
WP_003817833.1|3483264_3484296_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
WP_003815390.1|3484314_3484878_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
WP_010931376.1|3484933_3486454_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.1	9.0e-43
WP_010931377.1|3486717_3487422_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003815384.1|3487429_3488167_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003815381.1|3488272_3488647_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003815379.1|3488689_3489979_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_010931378.1|3489975_3491145_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_010931379.1|3491141_3491981_+	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
WP_010931380.1|3492040_3492976_+	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
WP_010929591.1|3492988_3493939_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931381.1|3494037_3495000_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
WP_003817821.1|3495031_3495391_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_010931382.1|3495515_3496418_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
WP_010931383.1|3496419_3498192_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_003815367.1|3498226_3499003_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_023852617.1|3500326_3501277_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	3516215	3574288	4106294	tRNA,transposase	Planktothrix_phage(12.5%)	47	NA	NA
WP_005012808.1|3516215_3517166_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931392.1|3517294_3518428_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931393.1|3518471_3519377_-	hydrolase	NA	NA	NA	NA	NA
WP_023852622.1|3519379_3521080_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.0e-15
WP_010931394.1|3521076_3521997_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003817805.1|3522004_3522982_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931395.1|3523040_3524075_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_003815317.1|3526049_3526286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023995266.1|3526412_3527276_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003815315.1|3527364_3528186_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003815313.1|3528265_3529003_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931397.1|3528999_3529992_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003817794.1|3530105_3530768_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931399.1|3530812_3531961_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010931400.1|3534284_3535235_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486105.1|3535575_3536526_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|3536624_3537575_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443756.1|3537871_3538369_+	cupredoxin family protein	NA	NA	NA	NA	NA
WP_010931403.1|3538411_3540187_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_010931404.1|3540194_3541061_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_019249391.1|3541067_3541802_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931406.1|3542971_3543766_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003815296.1|3544055_3544646_+	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_010931407.1|3544679_3546008_-	amidase	NA	NA	NA	NA	NA
WP_010931408.1|3546082_3547228_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014905478.1|3547339_3548338_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446233.1|3548300_3548735_+	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
WP_010929974.1|3550251_3551136_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010929973.1|3551132_3552338_-	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_010929972.1|3552334_3553195_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_003807038.1|3553307_3555098_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.5	6.5e-08
WP_003807035.1|3555138_3555804_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	6.7e-11
WP_010929971.1|3555804_3556113_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929970.1|3556278_3557565_-	putative Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_010929969.1|3558998_3559949_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929968.1|3561900_3563115_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_003815171.1|3563220_3564210_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.7	4.3e-38
WP_003815172.1|3564206_3564815_+	HAD-IIIA family hydrolase	NA	E3T535	Cafeteria_roenbergensis_virus	26.1	5.2e-10
WP_010929967.1|3564827_3565457_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003815175.1|3565453_3566074_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_003815177.1|3566105_3566897_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.5e-20
WP_010929966.1|3567748_3568204_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_010929965.1|3568222_3569149_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_010929964.1|3569202_3570489_-	cytochrome c	NA	NA	NA	NA	NA
WP_003815183.1|3571419_3572292_+	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	34.5	2.4e-08
WP_010929963.1|3572288_3573239_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	47.2	6.9e-17
WP_005012067.1|3573337_3574288_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	3706411	3839250	4106294	tRNA,integrase,transposase	uncultured_Mediterranean_phage(10.34%)	113	3754706:3754765	3786442:3787067
WP_010929577.1|3706411_3707362_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|3707461_3708412_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929878.1|3708408_3709044_-	LysE family transporter	NA	NA	NA	NA	NA
WP_003818466.1|3709173_3710073_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_003807278.1|3710168_3710660_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_010929877.1|3710706_3711672_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929876.1|3712805_3714047_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.9	1.9e-14
WP_003807287.1|3714160_3715177_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	43.8	3.5e-75
WP_010929875.1|3715211_3715688_-	membrane protein	NA	NA	NA	NA	NA
WP_003807291.1|3715830_3716739_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_010929874.1|3716852_3717965_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	35.0	1.9e-21
WP_023853429.1|3718065_3718551_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003818477.1|3718687_3719938_+	kynureninase	NA	NA	NA	NA	NA
WP_003807300.1|3720039_3720552_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.3	8.5e-22
WP_005013747.1|3720650_3721601_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929873.1|3721666_3722605_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-09
WP_010929872.1|3722627_3723254_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003818481.1|3723250_3723907_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_010929871.1|3723903_3724506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929870.1|3724512_3725100_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	23.3	1.1e-07
WP_010929869.1|3725280_3725850_+	bacterioferritin	NA	NA	NA	NA	NA
WP_003807313.1|3725920_3727240_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_003807315.1|3727346_3727538_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_010929868.1|3727789_3729079_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010929867.1|3729233_3730229_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807322.1|3730313_3730988_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|3730984_3731935_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003816336.1|3732096_3733338_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	4.0e-25
WP_010929866.1|3733334_3734279_+	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	33.3	9.5e-27
WP_005012067.1|3734397_3735348_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023853484.1|3735307_3736237_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807759.1|3736290_3736626_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010929865.1|3736670_3737435_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929864.1|3737458_3738199_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929863.1|3738206_3739760_-	acyl--CoA ligase	NA	A0A2K9L3I8	Tupanvirus	22.6	1.5e-13
WP_010929862.1|3739794_3740772_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_023853476.1|3741044_3741626_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_094145972.1|3741677_3748580_-	autotransporter BatB	NA	NA	NA	NA	NA
WP_003807750.1|3749026_3749158_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_010929858.1|3749423_3749630_-	DUF3596 domain-containing protein	NA	NA	NA	NA	NA
WP_010929857.1|3750634_3751294_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_010929856.1|3751321_3752467_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_003807743.1|3752607_3752943_+	YegP family protein	NA	NA	NA	NA	NA
WP_010929855.1|3753017_3753878_-	hypothetical protein	NA	A0A2C9D0H9	Yersinia_phage	53.6	1.7e-51
3754706:3754765	attL	GCGCCGGTCTGTCGCACCTGGCCGACCTGGAGCCGGCCGAGCCGGTGGTGCGCTACGAGC	NA	NA	NA	NA
WP_010929852.1|3755341_3755983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926414.1|3756149_3756392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929851.1|3756490_3757441_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929850.1|3757476_3757944_+	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	2.1e-43
WP_010926411.1|3758177_3758555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926410.1|3758551_3758734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929849.1|3758737_3759724_+	recombinase RecT	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
WP_010929848.1|3759720_3760368_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
WP_010929847.1|3760425_3760953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247983.1|3760989_3762174_+	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
WP_010929845.1|3762184_3762526_+	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
WP_010926403.1|3762638_3762839_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929843.1|3762835_3763825_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
WP_010929841.1|3765311_3767282_-	type III secretion system effector BopC	NA	NA	NA	NA	NA
WP_003814626.1|3767523_3767922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929840.1|3767930_3768854_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3769311_3770262_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927254.1|3770492_3772184_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_003816027.1|3772232_3772505_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	52.2	7.0e-15
WP_003816026.1|3772501_3772873_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003816025.1|3772968_3773103_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_010929554.1|3773508_3774918_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_010929839.1|3774920_3776030_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.2e-41
WP_010929838.1|3776124_3778578_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.3e-112
WP_023853625.1|3778696_3779488_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929836.1|3779607_3781035_+	amidase	NA	NA	NA	NA	NA
WP_010929835.1|3781073_3782045_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929834.1|3782463_3783627_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010929833.1|3783714_3784560_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3786116_3787067_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
3786442:3787067	attR	GCGCCGGTCTGTCGCACCTGGCCGACCTGGAGCCGGCCGAGCCGGTGGTGCGCTACGAGCATCAGGCCCCCGGCGATCTGCTGCACATCGACATCAAGAAGCTGGGACGTATCCAGCGCCCTGGCCACCGGGTCACGGGCAACCGACGCGATACCGTTGAGGGGGCCGGCTGGGACTTCGTCTTCGTGGCCATCGATGACCACGCCCGCGTGGCCTTCACCGACATCCACCCCGACGAGCGCTTCCCCAGCGCCGTCCAGTTCCTCAAGGACGCAGTGGCCTACTACCAGCGCCTGGGCGTGACCATCCAGCGCTTGCTCACCGACAATGGCTCGGCCTTTCGCAGCCGCGCCTTCGCCGCGCTGTGCCATGAGCTGGGCATCAAGCACCGCTTTACCCGACCTTACCGCCCACAGACCAATGGCAAGGCCGAACGCTTCATCCAGTCGGCCTTGCGTGAGTGGGCTTACGCTCACACCTACCAGAACTCCCAACACCGAGCCGATGCCATGAAATCCTGGCTACACCACTACAACTGGCATCGACCCCACCAAGGCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGACGAATACAACCTATTGACAGTTCACAGCTAG	NA	NA	NA	NA
WP_003818201.1|3787621_3787996_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010929807.1|3788070_3789129_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005012067.1|3789152_3790103_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929808.1|3792984_3794154_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_003815953.1|3794254_3795862_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	57.3	5.4e-22
WP_010929810.1|3795908_3797930_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_003815955.1|3797958_3798204_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_004565905.1|3798217_3799408_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.4e-21
WP_010929811.1|3799603_3800569_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929812.1|3800591_3801731_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010929813.1|3801942_3802905_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929814.1|3803028_3805053_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_010929815.1|3805249_3807493_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_003815964.1|3807771_3808230_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_010929816.1|3809157_3811779_-	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_010929817.1|3811842_3814470_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	25.4	6.1e-23
WP_010929818.1|3814621_3815686_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020699616.1|3815685_3816456_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	8.1e-24
WP_010929819.1|3816464_3817298_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003818225.1|3817310_3818090_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929820.1|3818163_3819597_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929821.1|3819624_3820383_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929822.1|3820438_3822289_-	biosynthetic-type acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	30.4	2.2e-59
WP_010929823.1|3822382_3822859_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023853391.1|3822875_3823796_-	bestrophin	NA	NA	NA	NA	NA
WP_003818232.1|3823902_3824403_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_010929826.1|3824776_3825469_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.6	6.3e-36
WP_162268689.1|3825583_3825760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929591.1|3825777_3826728_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931556.1|3826724_3830498_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	50.8	8.6e-10
WP_010931557.1|3830834_3832724_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.8	7.6e-07
WP_010931558.1|3832735_3833629_+	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_010931559.1|3833732_3834530_+	thiazole synthase	NA	NA	NA	NA	NA
WP_010931560.1|3834526_3835378_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003817656.1|3835439_3836120_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.8	3.5e-15
WP_019248789.1|3836156_3836483_+	TolC family protein	NA	NA	NA	NA	NA
WP_019247190.1|3836483_3837443_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_003815102.1|3837463_3837952_-	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	34.1	1.6e-17
WP_010931561.1|3838233_3839250_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP013096	Bordetella pertussis strain J225 chromosome, complete genome	4106294	4028465	4081897	4106294	transposase	Planktothrix_phage(40.0%)	46	NA	NA
WP_010931661.1|4028465_4029416_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931662.1|4029585_4030812_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_010931663.1|4031011_4031878_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003815027.1|4031870_4032833_+	Nudix family hydrolase	NA	A0A221LFJ1	Barns_Ness_breadcrumb_sponge_sobemo-like_virus	53.4	1.9e-06
WP_010927663.1|4032933_4033884_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|4033982_4034933_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|4035031_4035982_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994937.1|4035978_4037472_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003815032.1|4037468_4040576_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010931665.1|4040572_4043641_-	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010931666.1|4043637_4044888_-	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003815038.1|4045068_4045830_-	cell division protein ZapD	NA	NA	NA	NA	NA
WP_019247320.1|4045862_4046513_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003820519.1|4046515_4047355_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003815047.1|4047595_4048339_+	copper resistance protein NlpE N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003815049.1|4048421_4048769_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003815051.1|4048866_4049709_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_003815053.1|4049753_4050641_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003815055.1|4050667_4050856_-	DUF3460 family protein	NA	NA	NA	NA	NA
WP_010931669.1|4050953_4052411_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_010931670.1|4052397_4053924_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003815061.1|4053942_4054410_-	CopD family protein	NA	NA	NA	NA	NA
WP_010931671.1|4054409_4055432_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_169507388.1|4055552_4056272_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	4.7e-34
WP_003815066.1|4056347_4057448_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815068.1|4057449_4058640_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815070.1|4058759_4059776_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	42.1	1.0e-71
WP_003815073.1|4060094_4060766_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.2	9.5e-29
WP_010927126.1|4060762_4061671_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_010931672.1|4061882_4062530_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_010931673.1|4066381_4067458_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003815084.1|4067468_4068278_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023999981.1|4068367_4069141_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023853189.1|4069141_4069306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930363.1|4069323_4070274_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_077274100.1|4070162_4071185_+	CoA transferase	NA	NA	NA	NA	NA
WP_010931674.1|4071174_4072329_+	CoA transferase	NA	NA	NA	NA	NA
WP_010931675.1|4072368_4073781_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_019247370.1|4073905_4074772_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931677.1|4074773_4075598_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_023853488.1|4075594_4076356_+	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	31.0	2.0e-19
WP_003808010.1|4076436_4077123_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931679.1|4077296_4078304_+	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_003819309.1|4078300_4079080_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931680.1|4079137_4080400_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929591.1|4080946_4081897_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
