The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	27282	70036	4105464	transposase,tRNA	Synechococcus_phage(50.0%)	41	NA	NA
WP_010930363.1|27282_28233_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023995007.1|28314_28650_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929578.1|28674_29109_-	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_019247164.1|29141_30359_-	thiolase family protein	NA	NA	NA	NA	NA
WP_010929580.1|30364_30862_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_019247165.1|31069_32005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929582.1|32214_33006_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929583.1|33048_34470_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_010929584.1|34625_35576_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814398.1|35572_36763_-	MFS transporter	NA	NA	NA	NA	NA
WP_010929585.1|37012_37924_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_010929586.1|37925_40064_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003814404.1|40060_40600_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003814405.1|40603_41332_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929587.1|41318_42212_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_019247766.1|42282_42678_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_003814412.1|42687_43218_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
WP_010929588.1|43663_44614_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929589.1|45200_45749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815265.1|45720_45957_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003815255.1|46084_46978_+	AEC family transporter	NA	NA	NA	NA	NA
WP_010929590.1|48147_49395_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003817748.1|49391_50006_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_010929591.1|50141_51092_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443813.1|51134_52391_+	muropeptide transporter	NA	NA	NA	NA	NA
WP_010929592.1|53622_54357_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_019247224.1|54362_54953_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
WP_003817737.1|54977_55667_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023852650.1|55663_56425_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010929594.1|56504_57404_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|57497_58448_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929595.1|59248_60475_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_047122776.1|60474_60888_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929597.1|61077_62019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248755.1|62442_63417_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929599.1|63473_64055_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010929600.1|64067_64370_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_029443770.1|64488_65547_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_019247832.1|65581_66853_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010929603.1|67482_68664_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929584.1|69085_70036_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	232645	291254	4105464	transposase	uncultured_Mediterranean_phage(20.0%)	43	NA	NA
WP_010929956.1|232645_233596_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929591.1|233715_234666_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931563.1|234662_235853_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_010931562.1|235974_236739_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_003807735.1|236825_237929_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010931561.1|238120_239137_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815102.1|239418_239907_+	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	34.1	1.6e-17
WP_003817656.1|241250_241931_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.8	3.5e-15
WP_010931560.1|241992_242844_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_010931559.1|242840_243638_-	thiazole synthase	NA	NA	NA	NA	NA
WP_010931558.1|243741_244635_-	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_010931557.1|244646_246536_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.8	7.6e-07
WP_010931556.1|246872_250646_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	50.8	8.6e-10
WP_010929591.1|250642_251593_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162268689.1|251610_251787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929826.1|251901_252594_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.6	6.3e-36
WP_003818232.1|252967_253468_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_023853391.1|253574_254495_+	bestrophin	NA	NA	NA	NA	NA
WP_010929823.1|254511_254988_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929822.1|255081_256932_+	biosynthetic-type acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	30.4	2.2e-59
WP_010929821.1|256987_257746_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929820.1|257773_259207_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003818225.1|259280_260060_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929819.1|260072_260906_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020699616.1|260914_261685_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	8.1e-24
WP_010929818.1|261684_262749_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929817.1|262900_265528_-	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	25.4	6.1e-23
WP_010929816.1|265591_268213_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_003815964.1|269140_269599_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_010929815.1|269877_272121_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_010929814.1|272317_274342_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_010929813.1|274465_275428_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929812.1|275639_276779_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010929811.1|276801_277767_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_004565905.1|277962_279153_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.4e-21
WP_003815955.1|279166_279412_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_010929810.1|279440_281462_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_003815953.1|281508_283116_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	57.3	5.4e-22
WP_010929808.1|283216_284386_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|287267_288218_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929807.1|288241_289300_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003818201.1|289374_289749_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|290303_291254_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	307108	347523	4105464	transposase,integrase	Acinetobacter_phage(10.0%)	38	295736:295760	342808:342832
295736:295760	attL	CGCTGCCCCGGTACGGCACGTGCAG	NA	NA	NA	NA
WP_005012067.1|307108_308059_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929840.1|308516_309440_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814626.1|309448_309847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929841.1|310088_312059_+	type III secretion system effector BopC	NA	NA	NA	NA	NA
WP_010929843.1|313545_314535_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
WP_010926403.1|314531_314732_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929845.1|314844_315186_-	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
WP_019247983.1|315196_316381_-	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
WP_010929847.1|316417_316945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929848.1|317002_317650_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
WP_010929849.1|317646_318633_-	recombinase RecT	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
WP_010926410.1|318636_318819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926411.1|318815_319193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929850.1|319426_319894_-	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	2.1e-43
WP_010929851.1|319929_320880_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010926414.1|320978_321221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929852.1|321387_322029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|322039_322990_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248860.1|323099_323495_-	RidA family protein	NA	NA	NA	NA	NA
WP_010929854.1|323664_324366_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_010929855.1|324629_325490_+	hypothetical protein	NA	A0A2C9D0H9	Yersinia_phage	53.6	1.7e-51
WP_003807743.1|325564_325900_-	YegP family protein	NA	NA	NA	NA	NA
WP_010929856.1|326040_327186_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010929857.1|327213_327873_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_010929858.1|328877_329084_+	DUF3596 domain-containing protein	NA	NA	NA	NA	NA
WP_003807750.1|329349_329481_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_094145972.1|329927_336830_+	autotransporter BatB	NA	NA	NA	NA	NA
WP_023853476.1|336881_337463_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_010929862.1|337735_338713_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929863.1|338747_340301_+	acyl--CoA ligase	NA	A0A2K9L3I8	Tupanvirus	22.6	1.5e-13
WP_010929864.1|340308_341049_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929865.1|341072_341837_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003807759.1|341881_342217_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_023853484.1|342270_343200_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
342808:342832	attR	CTGCACGTGCCGTACCGGGGCAGCG	NA	NA	NA	NA
WP_005012067.1|343159_344110_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929866.1|344228_345173_-	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	33.3	9.5e-27
WP_003816336.1|345169_346411_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	4.0e-25
WP_005013747.1|346572_347523_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	490422	608317	4105464	transposase,tRNA	Acinetobacter_phage(22.22%)	102	NA	NA
WP_005012067.1|490422_491373_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929956.1|491471_492422_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929957.1|493144_494419_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003807618.1|494505_495588_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	3.3e-07
WP_010929958.1|495598_496411_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010929959.1|496447_496774_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_003807624.1|496778_497339_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_003819054.1|497579_498572_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929960.1|498590_499586_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023853194.1|499601_500978_+	FAD binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	37.3	2.4e-18
WP_010929962.1|500970_503352_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_019247263.1|503368_503758_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_020699695.1|503884_504115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|504219_505170_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929963.1|505268_506219_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	47.2	6.9e-17
WP_003815183.1|506215_507088_-	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	34.5	2.4e-08
WP_010929964.1|508018_509305_+	cytochrome c	NA	NA	NA	NA	NA
WP_010929965.1|509358_510285_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_010929966.1|510303_510759_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003815177.1|511610_512402_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.5e-20
WP_003815175.1|512433_513054_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010929967.1|513050_513680_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003815172.1|513692_514301_-	HAD-IIIA family hydrolase	NA	E3T535	Cafeteria_roenbergensis_virus	26.1	5.2e-10
WP_003815171.1|514297_515287_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.7	4.3e-38
WP_010929968.1|515392_516607_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_010929969.1|518558_519509_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929970.1|520942_522229_+	putative Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_010929971.1|522394_522703_+	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003807035.1|522703_523369_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	6.7e-11
WP_003807038.1|523409_525200_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.5	6.5e-08
WP_010929972.1|525312_526173_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_010929973.1|526169_527375_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_010929974.1|527371_528256_-	DMT family transporter	NA	NA	NA	NA	NA
WP_033446233.1|529772_530207_-	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
WP_014905478.1|530169_531168_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931408.1|531279_532425_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931407.1|532499_533828_+	amidase	NA	NA	NA	NA	NA
WP_003815296.1|533861_534452_-	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_010931406.1|534741_535536_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019249391.1|536705_537440_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931404.1|537446_538313_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_010931403.1|538320_540096_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_029443756.1|540138_540636_-	cupredoxin family protein	NA	NA	NA	NA	NA
WP_005013747.1|540932_541883_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486105.1|541981_542932_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931400.1|543272_544223_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931399.1|546546_547695_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003817794.1|547739_548402_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931397.1|548515_549508_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003815313.1|549504_550242_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003815315.1|550321_551143_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931396.1|551231_552095_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003815317.1|552221_552458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931395.1|554432_555467_+	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_003817805.1|555525_556503_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931394.1|556510_557431_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023852622.1|557427_559128_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.0e-15
WP_010931393.1|559130_560036_+	hydrolase	NA	NA	NA	NA	NA
WP_010931392.1|560079_561213_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_005012808.1|561341_562292_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931391.1|562390_564460_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.3	2.6e-101
WP_019247688.1|564502_566605_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_010931389.1|566911_567988_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_010931388.1|568063_568948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003815341.1|569130_569553_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_010931387.1|569562_570963_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003817813.1|571005_571911_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_010931386.1|572009_573551_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003815348.1|573585_574125_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_010931385.1|574137_574608_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003815363.1|574745_574988_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_003815364.1|575104_575986_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003815365.1|576058_576379_-	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_023852617.1|577230_578181_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003815367.1|579504_580281_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010931383.1|580315_582088_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931382.1|582089_582992_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
WP_003817821.1|583116_583476_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_010931381.1|583507_584470_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
WP_005012067.1|584568_585519_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931380.1|585531_586467_-	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
WP_010931379.1|586526_587366_-	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
WP_010931378.1|587362_588532_-	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_003815379.1|588528_589818_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_003815381.1|589860_590235_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003815384.1|590340_591078_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_010931377.1|591085_591790_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_010931376.1|592053_593574_+	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.1	9.0e-43
WP_003815390.1|593629_594193_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
WP_003817833.1|594211_595243_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
WP_010931375.1|595239_596028_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
WP_019247413.1|596048_596207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023997720.1|596203_597193_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|598949_599900_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931374.1|601122_602025_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814312.1|602026_602881_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_010931373.1|602927_604037_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931372.1|604047_604566_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003814302.1|604595_605228_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_003814300.1|605299_605959_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_003814298.1|605955_607176_-	MFS transporter	NA	NA	NA	NA	NA
WP_019247745.1|607444_608317_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	612731	676564	4105464	transposase,tRNA	Pandoravirus(12.5%)	47	NA	NA
WP_010931363.1|612731_613748_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814287.1|614019_614646_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_010931367.1|614701_615829_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	37.8	3.8e-38
WP_003814283.1|615834_621552_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
WP_003814277.1|622119_623064_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
WP_003814275.1|623252_624188_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010931365.1|624305_625877_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247692.1|625956_627165_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_019247693.1|627662_628580_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003814254.1|630940_631162_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_010929632.1|631492_632509_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814252.1|632593_632845_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_003814250.1|632848_633664_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_010931362.1|633776_634655_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003820957.1|634766_636530_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
WP_010931361.1|636645_637986_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010927010.1|639055_640480_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003814239.1|640479_641181_-	response regulator	NA	W8CYM9	Bacillus_phage	36.6	5.6e-32
WP_010930179.1|642685_643636_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994844.1|643731_644703_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931357.1|644707_645388_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_003814742.1|645525_645918_+	OsmC family protein	NA	NA	NA	NA	NA
WP_010931561.1|646025_647042_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814739.1|647281_648067_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010931356.1|648161_649571_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_010927090.1|649581_650382_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010931355.1|650402_651173_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010931354.1|651215_651683_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
WP_005013747.1|651679_652630_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818344.1|654578_655457_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_019247959.1|656383_659362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931070.1|659715_660666_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931353.1|660662_661751_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_010931352.1|661786_662650_-	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010931351.1|663789_664179_-	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_014486103.1|664182_664965_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_047122778.1|664998_665784_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931349.1|666059_667199_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931348.1|667195_667987_+	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
WP_010931347.1|667983_668733_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
WP_010931346.1|668729_669602_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004566224.1|669601_670603_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003808195.1|670599_671763_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003808193.1|671788_672472_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247312.1|672425_673760_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_010931344.1|673752_674847_+	CoA transferase	NA	NA	NA	NA	NA
WP_005012067.1|675613_676564_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	695475	772784	4105464	transposase,tRNA,protease,integrase	Bacillus_phage(20.0%)	58	742612:742630	762500:762518
WP_023995489.1|695475_696426_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931335.1|696524_698000_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931334.1|699587_700475_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931333.1|700477_701419_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931332.1|701464_703030_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931331.1|704807_706133_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931330.1|706315_707773_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	21.1	7.6e-15
WP_003816386.1|707736_708234_-	dihydrofolate reductase	NA	A0A140HLG8	Bacillus_phage	38.9	3.0e-24
WP_010931328.1|708264_709236_-	thymidylate synthase	NA	J7KKN7	Erwinia_phage	33.3	4.8e-50
WP_003808444.1|709288_709726_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010931327.1|709849_710518_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003808448.1|711246_712350_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_171024626.1|712452_713730_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	NA	NA	NA	NA
WP_010930472.1|713741_714767_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L4U8	Tupanvirus	44.2	4.7e-72
WP_010931325.1|714768_716139_+	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010931324.1|716139_717276_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931323.1|717322_719248_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9R7N5	Dishui_lake_phycodnavirus	29.0	1.0e-27
WP_010931322.1|719244_720366_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931321.1|720362_721517_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_010931320.1|721513_722644_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003808462.1|722651_724217_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_010931319.1|724223_725606_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	6.2e-51
WP_003808465.1|725884_726496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931317.1|726587_728003_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003818936.1|728020_728731_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010931316.1|728727_730050_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_010931315.1|730129_732091_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_003818932.1|732216_733530_-	fumarylacetoacetase	NA	NA	NA	NA	NA
WP_003818930.1|733638_734937_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_010931314.1|735119_736028_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003808487.1|736037_736247_-	DUF2783 domain-containing protein	NA	NA	NA	NA	NA
WP_003808489.1|736258_737938_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931313.1|738039_738993_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010925978.1|739083_739911_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	NA	NA	NA	NA
WP_010931312.1|739909_741796_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003818921.1|741792_742392_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_010931311.1|742440_743340_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
742612:742630	attL	CTGCCTGGCGTGGCCGAGT	NA	NA	NA	NA
WP_010931310.1|743548_744499_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.5	7.3e-43
WP_029443719.1|744621_745236_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_010931308.1|745364_745961_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010931307.1|745957_746740_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010931306.1|746812_747904_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_010931305.1|748183_749311_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	33.6	1.4e-48
WP_010931304.1|749652_750699_+	Fic family protein	NA	NA	NA	NA	NA
WP_010931303.1|750846_753966_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_023994585.1|753967_756919_+	DNA methylase	NA	G8I4P9	Mycobacterium_phage	25.1	2.9e-21
WP_010931301.1|756934_758146_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010931070.1|758329_759280_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_077274087.1|759296_759791_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_019247740.1|759794_760052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248455.1|760595_761507_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_029443992.1|761588_761873_+	ATP-dependent helicase	NA	A0A1V0SIN4	Klosneuvirus	34.1	6.8e-05
WP_005012067.1|762656_763607_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
762500:762518	attR	ACTCGGCCACGCCAGGCAG	NA	NA	NA	NA
WP_019247178.1|764025_766590_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_019247179.1|766634_768488_-	autotransporter-associated beta strand repeat-containing protein	NA	NA	NA	NA	NA
WP_014905963.1|768820_770392_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162291319.1|771660_771816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|771833_772784_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	1028122	1121110	4105464	transposase	Bacillus_virus(30.0%)	86	NA	NA
WP_005012067.1|1028122_1029073_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486100.1|1029175_1029838_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019249309.1|1029932_1030103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247599.1|1030455_1031457_+	amidase	NA	NA	NA	NA	NA
WP_003818702.1|1031459_1032656_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486098.1|1032676_1033480_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_019247598.1|1033560_1033857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247597.1|1033887_1034451_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014486097.1|1034491_1035349_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003818698.1|1035356_1036106_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	6.2e-29
WP_014486096.1|1036127_1037000_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_014486095.1|1037028_1037808_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486094.1|1037841_1038639_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003808978.1|1041293_1041686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014486091.1|1041679_1042540_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003818691.1|1042543_1043506_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014486089.1|1044282_1044972_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	4.8e-12
WP_010930208.1|1045832_1046783_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931181.1|1047132_1048002_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010926062.1|1048072_1048768_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010931179.1|1048757_1049267_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010931178.1|1049263_1050484_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931177.1|1050431_1051334_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_023997744.1|1052220_1053507_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931176.1|1053545_1054919_+	amidase	NA	NA	NA	NA	NA
WP_010931175.1|1054957_1055659_-	riboflavin synthase	NA	NA	NA	NA	NA
WP_010931174.1|1055957_1056947_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003809010.1|1057047_1057509_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931173.1|1057524_1058073_-	cysteine dioxygenase family protein	NA	NA	NA	NA	NA
WP_010931172.1|1058214_1059690_-	acyl--CoA ligase	NA	Q75ZG1	Hepacivirus	25.6	3.0e-35
WP_010931171.1|1059795_1060887_+	DUF2817 domain-containing protein	NA	NA	NA	NA	NA
WP_010931170.1|1060890_1061673_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931169.1|1061682_1062471_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.0	1.1e-33
WP_010931168.1|1063596_1064031_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_010931167.1|1064027_1065038_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_003809025.1|1065081_1066008_-	VOC family protein	NA	NA	NA	NA	NA
WP_003809026.1|1066294_1066663_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_154698394.1|1066715_1066862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023853143.1|1066879_1067830_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931165.1|1067874_1070301_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	1.2e-86
WP_010931164.1|1070349_1071042_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	4.7e-07
WP_010931163.1|1071114_1072314_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_003819549.1|1072331_1073237_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931162.1|1073352_1074282_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010931161.1|1074307_1075654_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931160.1|1075681_1076431_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.4	1.2e-11
WP_010931159.1|1076444_1077227_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|1077419_1078370_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931158.1|1078431_1079541_-	porin	NA	NA	NA	NA	NA
WP_003815281.1|1080053_1080890_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
WP_023997028.1|1080959_1081925_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|1081921_1082872_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023998107.1|1082889_1083060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247492.1|1083257_1083800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1084835_1085786_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247402.1|1086027_1086396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248356.1|1086441_1087566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931156.1|1088700_1089453_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931155.1|1089544_1090165_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023852714.1|1090268_1091219_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931154.1|1091215_1093324_-	AsmA family protein	NA	NA	NA	NA	NA
WP_003820814.1|1093468_1094128_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003820813.1|1094159_1094624_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_019248355.1|1094899_1095085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931153.1|1095136_1095889_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_010931152.1|1095895_1097158_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_023852748.1|1097199_1098438_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003820806.1|1099515_1100643_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
WP_003814524.1|1100653_1101481_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_010931150.1|1101467_1102334_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_010931149.1|1103700_1104105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446288.1|1104467_1105379_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003820799.1|1105393_1106104_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931147.1|1106100_1107345_+	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_003820797.1|1107346_1107781_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_003814535.1|1107809_1108115_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005012067.1|1108213_1109164_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247277.1|1109220_1110375_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010930176.1|1110449_1111400_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931144.1|1111931_1112729_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247918.1|1112776_1113430_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003814544.1|1113386_1114475_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
WP_003814547.1|1114639_1116865_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_023852715.1|1119142_1120039_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_162268686.1|1119992_1120142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1120159_1121110_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	1151496	1222467	4105464	transposase,protease	uncultured_Mediterranean_phage(25.0%)	53	NA	NA
WP_005012808.1|1151496_1152447_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931130.1|1152503_1153616_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|1155999_1156950_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931129.1|1157540_1158317_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_003812908.1|1158434_1158698_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_010931128.1|1158798_1159803_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_010931127.1|1160003_1161605_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_010931126.1|1161630_1162389_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010931125.1|1162480_1163137_-	adenylate kinase	NA	NA	NA	NA	NA
WP_010931124.1|1163227_1163992_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003812895.1|1164001_1164190_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_010931123.1|1164245_1165289_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_010931122.1|1165285_1165699_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_003812889.1|1165695_1166316_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012067.1|1166596_1167547_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931120.1|1167714_1169106_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
WP_010931119.1|1169178_1169757_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_019247560.1|1169873_1171271_+	chloride channel protein	NA	NA	NA	NA	NA
WP_010931117.1|1171386_1172592_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_003820399.1|1172691_1173210_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.1e-14
WP_003812875.1|1173304_1173550_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
WP_003820400.1|1173777_1174092_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
WP_010931116.1|1174181_1179371_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_010931115.1|1179367_1181536_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_010931114.1|1181591_1183907_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
WP_003820402.1|1183911_1185231_+	PqiA/YebS family transporter subunit	NA	NA	NA	NA	NA
WP_014905522.1|1185249_1186923_+	MCE family protein	NA	NA	NA	NA	NA
WP_010931111.1|1186927_1187596_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_010931110.1|1187752_1191574_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_154698391.1|1191728_1191887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930800.1|1191904_1192855_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812857.1|1192876_1194022_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003820410.1|1194170_1195100_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812851.1|1195096_1196185_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_010931109.1|1196181_1196985_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
WP_003812846.1|1196981_1197713_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
WP_010931108.1|1197770_1199060_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931107.1|1199156_1199759_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003812839.1|1204312_1204651_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931105.1|1205358_1205625_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012067.1|1207331_1208282_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931103.1|1208278_1209610_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931102.1|1210870_1212871_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003819722.1|1212863_1213505_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_003809276.1|1213501_1213909_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_010931101.1|1213905_1214706_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_010931100.1|1214780_1215485_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931099.1|1215516_1216311_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_005013747.1|1216307_1217258_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023995489.1|1217356_1218307_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812014.1|1218405_1218840_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_010931098.1|1218922_1221259_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.8	3.2e-124
WP_010930525.1|1221450_1222467_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	1269861	1350736	4105464	transposase,tRNA	Bacillus_virus(25.0%)	59	NA	NA
WP_010927663.1|1269861_1270812_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931070.1|1270808_1271759_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931069.1|1272019_1273048_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010931068.1|1273127_1274426_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_003816847.1|1274422_1275004_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_010931067.1|1275316_1279363_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	67.4	6.3e-160
WP_010931066.1|1279603_1287265_+	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.9	7.3e-24
WP_005012067.1|1287261_1288212_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931065.1|1289351_1289825_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931064.1|1289964_1290585_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010931063.1|1290720_1291521_+	aldolase	NA	NA	NA	NA	NA
WP_003810897.1|1291575_1292667_+	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_010931062.1|1292688_1293132_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_010931061.1|1293160_1293793_-	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_003810909.1|1293903_1294320_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010931060.1|1294312_1295005_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_010931059.1|1295111_1295486_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010931058.1|1295562_1296372_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931057.1|1296467_1297412_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_003816577.1|1297450_1298422_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003810921.1|1298512_1298950_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_029443733.1|1299008_1299890_-	NRDE family protein	NA	NA	NA	NA	NA
WP_010931054.1|1300893_1301754_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010931053.1|1301786_1303169_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	28.4	7.9e-30
WP_010931052.1|1303165_1304185_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247407.1|1304557_1305052_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931051.1|1305059_1305800_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931050.1|1305880_1307485_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_010931049.1|1307524_1308313_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.4	2.0e-22
WP_010931048.1|1309515_1310604_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	9.7e-15
WP_010931047.1|1311484_1312297_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004568502.1|1312309_1312618_+	DUF2160 domain-containing protein	NA	NA	NA	NA	NA
WP_010931046.1|1312735_1314466_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019249399.1|1314467_1315613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931044.1|1315742_1316411_-	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_003810957.1|1316532_1317000_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019247521.1|1317135_1318518_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_014486086.1|1318514_1319639_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_010931042.1|1319635_1322272_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010931070.1|1322687_1323638_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931041.1|1327384_1327996_-	DUF2239 family protein	NA	NA	NA	NA	NA
WP_003812368.1|1328218_1329679_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	1.6e-97
WP_010931040.1|1329775_1331368_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	1.0e-17
WP_019247974.1|1331721_1331979_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003816876.1|1331980_1333321_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_010931038.1|1333416_1334106_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247976.1|1334118_1335549_+	MFS transporter	NA	NA	NA	NA	NA
WP_014905903.1|1337273_1338095_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931036.1|1338105_1339677_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010931035.1|1339705_1340683_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931034.1|1340709_1341513_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	2.7e-30
WP_010931033.1|1341509_1342304_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003816890.1|1342311_1343547_+	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_010931032.1|1343539_1343974_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_005013747.1|1344723_1345674_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931031.1|1346295_1348023_-	sulfate permease	NA	NA	NA	NA	NA
WP_010931030.1|1348134_1349493_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_023853289.1|1349549_1349768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|1349785_1350736_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	1470139	1522292	4105464	transposase,tRNA	Salmonella_phage(25.0%)	46	NA	NA
WP_005013747.1|1470139_1471090_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023999730.1|1471107_1471260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814065.1|1471256_1471610_+	cytochrome c	NA	NA	NA	NA	NA
WP_003814063.1|1471622_1471985_+	cytochrome c	NA	NA	NA	NA	NA
WP_003814061.1|1472026_1472452_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_003814059.1|1472654_1473911_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
WP_003814057.1|1474109_1475090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015028.1|1475239_1476481_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_005013747.1|1476579_1477530_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814052.1|1477538_1478234_-	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_003814050.1|1481055_1481655_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_010930950.1|1481665_1483831_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-24
WP_010930949.1|1483854_1485639_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_017685545.1|1485638_1485728_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_003814042.1|1486422_1486695_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_003814040.1|1486694_1488761_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_010929577.1|1488757_1489708_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1489806_1490757_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015014.1|1490872_1491205_-	multidrug transporter	NA	NA	NA	NA	NA
WP_010929073.1|1491201_1491888_-	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_010930948.1|1491874_1492834_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	3.1e-57
WP_003814032.1|1492875_1495236_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.0	7.6e-81
WP_010930946.1|1495235_1495868_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_010930945.1|1495969_1497310_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.9	1.6e-75
WP_010930944.1|1497356_1498712_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	1.6e-83
WP_170954289.1|1498837_1499482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814024.1|1499426_1499744_-	virulence factor	NA	NA	NA	NA	NA
WP_003814023.1|1500016_1500532_-	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	5.1e-06
WP_003814022.1|1500625_1500787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814021.1|1500802_1501558_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_019247690.1|1501896_1502103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814020.1|1502110_1502770_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_010930941.1|1503064_1505269_-	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_010930940.1|1505379_1506603_-	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_003814017.1|1506725_1507700_-	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013753.1|1507767_1508961_-	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_003814016.1|1508975_1509776_-	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_010930939.1|1509772_1511629_-	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_003814014.1|1511625_1512231_-	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_003814013.1|1512249_1513635_-	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_003814012.1|1514360_1515587_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003814011.1|1515675_1516458_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_005012067.1|1516556_1517507_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814010.1|1517533_1518307_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003814009.1|1518318_1519560_+	MFS transporter	NA	NA	NA	NA	NA
WP_076879548.1|1521341_1522292_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	1566217	1634303	4105464	transposase,tRNA	Streptococcus_virus(11.11%)	59	NA	NA
WP_010930416.1|1566217_1566706_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_019248504.1|1566823_1567402_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010930418.1|1567507_1567876_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|1567974_1568925_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994932.1|1568931_1570044_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_010930419.1|1570730_1571933_+	MFS transporter	NA	NA	NA	NA	NA
WP_004568212.1|1571968_1572115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930420.1|1572136_1574797_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_010930421.1|1574809_1578214_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_023995689.1|1578881_1581107_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.5	1.2e-43
WP_010930423.1|1581153_1581480_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_010930424.1|1581530_1582139_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_010931070.1|1582237_1583188_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930425.1|1583257_1584022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930426.1|1584018_1584618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930427.1|1584721_1585573_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	35.3	7.0e-37
WP_010928449.1|1585632_1586259_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_005012067.1|1586255_1587206_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019249265.1|1587304_1588417_-	DUF1513 domain-containing protein	NA	NA	NA	NA	NA
WP_019248041.1|1588406_1589408_-	imelysin family protein	NA	NA	NA	NA	NA
WP_019247498.1|1589513_1591025_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_023853587.1|1591021_1592326_-	imelysin	NA	NA	NA	NA	NA
WP_010930431.1|1592437_1592998_-	membrane protein	NA	NA	NA	NA	NA
WP_010930432.1|1593265_1593820_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.0	1.7e-15
WP_010930433.1|1594275_1594491_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_033446228.1|1594745_1597343_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.6	1.5e-21
WP_010930435.1|1597339_1598527_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010930436.1|1599185_1599800_+	serotype 3 fimbrial subunit	NA	NA	NA	NA	NA
WP_010930437.1|1599888_1601016_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_033446216.1|1601027_1601933_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_005012067.1|1602825_1603776_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930439.1|1603957_1604710_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_003811112.1|1604778_1605438_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003811113.1|1605434_1606163_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	39.3	3.3e-35
WP_010930440.1|1606175_1608455_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.1	5.9e-06
WP_010930441.1|1608479_1608683_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_010930442.1|1608724_1609357_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	33.9	2.4e-13
WP_010930443.1|1609492_1610410_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_010930444.1|1610406_1611120_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_003811135.1|1611357_1612128_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003811137.1|1612132_1612732_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	41.6	1.4e-20
WP_003811138.1|1612976_1614467_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_010926696.1|1614525_1614810_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930445.1|1614947_1615103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811148.1|1615375_1616302_-	YicC family protein	NA	NA	NA	NA	NA
WP_003811149.1|1616438_1617179_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_010930446.1|1617345_1618722_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003811152.1|1618903_1619809_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930448.1|1621460_1623263_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010930449.1|1623389_1624031_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_005012808.1|1624129_1625080_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930450.1|1625101_1626322_+	oxygen-independent coproporphyrinogen III oxidase-like protein	NA	NA	NA	NA	NA
WP_003811164.1|1626507_1627920_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003811167.1|1627983_1629051_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.5	1.1e-05
WP_010930451.1|1629050_1630538_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_010930452.1|1630547_1631492_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811176.1|1631651_1632350_+	pirin family protein	NA	NA	NA	NA	NA
WP_010930453.1|1632427_1633333_+	pirin family protein	NA	NA	NA	NA	NA
WP_005012067.1|1633352_1634303_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	1670252	1725843	4105464	transposase	Brazilian_cedratvirus(25.0%)	47	NA	NA
WP_005013747.1|1670252_1671203_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930486.1|1671261_1672035_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486074.1|1672027_1673584_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_005013747.1|1673580_1674531_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810741.1|1675857_1676460_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003810743.1|1676699_1677401_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003816696.1|1677394_1678177_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
WP_005012808.1|1678361_1679312_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930483.1|1679410_1680148_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
WP_010926609.1|1680337_1681096_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930482.1|1681142_1682132_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930481.1|1682309_1683278_-	transporter	NA	NA	NA	NA	NA
WP_010930480.1|1684817_1685786_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010930479.1|1685794_1686736_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010930478.1|1687209_1688220_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930477.1|1688210_1689725_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930476.1|1689721_1691068_+	BatD family protein	NA	NA	NA	NA	NA
WP_010930475.1|1691070_1692105_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_023852967.1|1692154_1693780_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
WP_005012067.1|1694332_1695283_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930487.1|1695387_1696335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247865.1|1696388_1698203_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010930489.1|1698195_1698870_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023995112.1|1698999_1702074_+	autotransporter SphB2	NA	NA	NA	NA	NA
WP_019247905.1|1702087_1702387_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930492.1|1702701_1703325_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_010930493.1|1703568_1704438_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010930494.1|1704415_1705360_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247909.1|1705445_1706372_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247910.1|1706484_1707264_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930497.1|1707254_1708451_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010930498.1|1708481_1709432_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_010930499.1|1709653_1710343_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930500.1|1710407_1711163_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930501.1|1711214_1712207_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930502.1|1712216_1713170_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811538.1|1713285_1714248_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019249376.1|1715649_1716078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|1716074_1717025_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_170954298.1|1717318_1718056_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
WP_010930504.1|1718479_1719667_-	MFS transporter	NA	NA	NA	NA	NA
WP_019249653.1|1719670_1720051_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930506.1|1721770_1722742_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930507.1|1722755_1723469_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930508.1|1723473_1724391_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811452.1|1724497_1724794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929588.1|1724892_1725843_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	1958608	2028261	4105464	transposase,tRNA	Staphylococcus_phage(16.67%)	54	NA	NA
WP_003818515.1|1958608_1961266_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.0	3.3e-173
WP_010930709.1|1961343_1962546_-	MFS transporter	NA	NA	NA	NA	NA
WP_003810260.1|1962542_1963055_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247822.1|1963177_1963615_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_010931070.1|1963891_1964842_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_077069014.1|1964940_1965891_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930710.1|1966144_1967950_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.5	2.2e-19
WP_010930711.1|1968063_1968231_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003810297.1|1968294_1968531_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_010930712.1|1968899_1970099_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_010929591.1|1971614_1972565_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818523.1|1973016_1974018_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003810306.1|1974190_1975048_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_003810308.1|1975044_1976307_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	6.8e-28
WP_003818524.1|1976407_1976782_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_010930713.1|1976854_1978042_+	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_010930714.1|1978126_1978897_+	spermidine synthase	NA	NA	NA	NA	NA
WP_010930715.1|1979010_1979775_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930716.1|1979725_1981027_+	malonyl-CoA decarboxylase family protein	NA	NA	NA	NA	NA
WP_010930717.1|1981023_1981830_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003818532.1|1983574_1984546_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003818533.1|1984702_1985215_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	52.3	1.8e-43
WP_010930718.1|1985373_1986348_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930719.1|1987348_1988143_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.7	5.1e-05
WP_003818535.1|1988168_1988975_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_003810329.1|1989085_1989676_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_010930720.1|1989686_1990865_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_010930721.1|1990967_1991342_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019248531.1|1991594_1992926_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_019247651.1|1992992_1996223_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003810344.1|1997713_1998460_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_010930724.1|1998544_1999006_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_010930725.1|1999043_2000102_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_010930726.1|2000064_2001894_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003810356.1|2001933_2002506_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_010930727.1|2003930_2004752_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.6	4.1e-42
WP_010930728.1|2005070_2006393_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_010930729.1|2006752_2007388_+	membrane protein	NA	NA	NA	NA	NA
WP_010930730.1|2007347_2008298_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930731.1|2009168_2010041_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930732.1|2010118_2011258_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930733.1|2011616_2012873_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_003816691.1|2012878_2013406_+	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_003816690.1|2013410_2014229_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003816687.1|2014228_2014951_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930735.1|2014972_2015287_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_010930736.1|2015304_2016453_+	CoA transferase	NA	NA	NA	NA	NA
WP_010930737.1|2016483_2017359_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003816680.1|2017355_2018675_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_010930739.1|2019955_2021443_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_010930740.1|2024037_2024937_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023852887.1|2025074_2026040_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015810.1|2026138_2027089_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|2027310_2028261_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	2039757	2089153	4105464	transposase	Erysipelothrix_phage(16.67%)	45	NA	NA
WP_005013747.1|2039757_2040708_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812172.1|2041845_2042142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247707.1|2042316_2043669_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	2.9e-45
WP_010930153.1|2043811_2044828_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930748.1|2046807_2047821_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_010930749.1|2047907_2048813_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003812179.1|2048969_2049314_+	exported protein	NA	NA	NA	NA	NA
WP_010930750.1|2049471_2049930_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010930751.1|2049943_2052160_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003812183.1|2052156_2053218_+	XdhC family protein	NA	NA	NA	NA	NA
WP_010930752.1|2053246_2054221_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930753.1|2054172_2054991_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.8	2.3e-16
WP_003812191.1|2055003_2055612_-	LON peptidase substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010930754.1|2055786_2056182_+	VOC family protein	NA	NA	NA	NA	NA
WP_010930755.1|2056200_2057640_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	37.4	7.4e-55
WP_003812199.1|2057668_2058016_+	GFA family protein	NA	NA	NA	NA	NA
WP_010929577.1|2058034_2058985_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2059637_2060588_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023997035.1|2060671_2062489_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.3e-37
WP_019247659.1|2062562_2063210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930758.1|2063222_2064152_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_014905663.1|2064321_2064786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003816977.1|2065033_2065714_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003816975.1|2065762_2067454_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.3	5.0e-42
WP_010930760.1|2067469_2068021_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_003816971.1|2068017_2068389_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930761.1|2068501_2069338_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_029443822.1|2069348_2069873_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_003812228.1|2069970_2070150_+	DUF3008 family protein	NA	NA	NA	NA	NA
WP_010930763.1|2070279_2071254_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003816964.1|2071384_2071741_+	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_010930764.1|2071730_2072606_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_010930765.1|2072704_2073589_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930766.1|2073610_2074906_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_003816959.1|2075854_2076505_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010930767.1|2076592_2078113_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010930768.1|2078370_2080236_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|2081281_2082232_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162268681.1|2082249_2082390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930769.1|2083204_2083564_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_010930770.1|2083551_2084988_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_010930771.1|2084984_2085638_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930772.1|2085634_2086828_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_010930773.1|2086931_2088206_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	9.6e-14
WP_005012067.1|2088202_2089153_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	2100357	2141048	4105464	transposase,tRNA,protease	Klosneuvirus(25.0%)	36	NA	NA
WP_005013747.1|2100357_2101308_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|2101406_2102357_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_047122784.1|2102316_2102730_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	59.0	3.8e-36
WP_003816708.1|2103014_2103314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930783.1|2103723_2106006_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.1	3.2e-36
WP_010930784.1|2106691_2108722_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.9	1.0e-65
WP_006218592.1|2108741_2108954_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003810720.1|2109231_2109771_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023852902.1|2109884_2111180_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	33.5	3.0e-63
WP_010930786.1|2111256_2112414_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_010930787.1|2112597_2113497_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_010930788.1|2113515_2114820_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_010930789.1|2114785_2115892_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003810707.1|2115979_2116216_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_010930790.1|2116354_2117425_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
WP_003810703.1|2117428_2118784_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_003810701.1|2118810_2119971_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_010930791.1|2119973_2120612_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_023995843.1|2120613_2121900_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010930793.1|2121958_2123254_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_003810693.1|2123260_2123767_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004568542.1|2123763_2124912_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_003810689.1|2124939_2125365_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
WP_010930794.1|2125687_2128570_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
WP_023852900.1|2128662_2129418_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_010930796.1|2130183_2131533_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_076879566.1|2131631_2132582_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930048.1|2132680_2133631_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930594.1|2133704_2134178_+	RidA family protein	NA	NA	NA	NA	NA
WP_010930593.1|2134203_2135412_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_003816734.1|2135408_2136182_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_014905757.1|2136181_2136805_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_010926757.1|2136970_2137231_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_010930591.1|2137534_2138116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004568544.1|2138182_2138437_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_010930590.1|2138423_2141048_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.7e-81
>prophage 17
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	2168831	2234380	4105464	transposase,tRNA,protease	Lake_Baikal_phage(20.0%)	58	NA	NA
WP_010929577.1|2168831_2169782_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930573.1|2169982_2170792_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_005013747.1|2170916_2171867_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930572.1|2171863_2172757_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_003812452.1|2172881_2173076_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003812453.1|2173075_2173417_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_010930571.1|2173426_2175289_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.4	3.0e-101
WP_003812456.1|2175418_2175931_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_003812458.1|2175933_2176257_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.8	6.8e-25
WP_003812460.1|2176258_2176669_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	7.5e-53
WP_010930570.1|2176706_2177918_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_003812463.1|2177935_2178448_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_010930569.1|2178663_2179155_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_010930568.1|2179407_2181444_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_019247244.1|2181521_2182724_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_010930566.1|2182852_2183503_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	3.3e-10
WP_005012067.1|2185060_2186011_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247934.1|2186581_2186794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247935.1|2186811_2187543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003812478.1|2187577_2188219_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_010930565.1|2188211_2188880_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_010930564.1|2191092_2191869_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930563.1|2191890_2193048_-	thiolase	NA	NA	NA	NA	NA
WP_003812491.1|2193044_2193476_-	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_015063637.1|2193472_2194276_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010930561.1|2194289_2194691_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_010930560.1|2194757_2195729_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930559.1|2195794_2197018_-	CoA transferase	NA	NA	NA	NA	NA
WP_019247936.1|2197245_2198196_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930557.1|2198319_2200773_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	1.5e-220
WP_010930556.1|2200961_2202266_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.2e-129
WP_003812508.1|2202370_2203024_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.5	6.8e-56
WP_010930555.1|2203026_2204337_-	trigger factor	NA	NA	NA	NA	NA
WP_010930554.1|2204533_2205094_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.7	1.0e-23
WP_010930553.1|2205205_2205406_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.4	7.4e-14
WP_003812519.1|2205751_2206318_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_010930551.1|2206401_2206605_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	1.6e-16
WP_003812524.1|2206911_2207232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003812526.1|2207273_2207555_-	membrane protein	NA	NA	NA	NA	NA
WP_010930550.1|2207629_2208886_-	autotransporter Phg	NA	NA	NA	NA	NA
WP_010930549.1|2209268_2209598_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_003812536.1|2211168_2211990_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_010930548.1|2211989_2213129_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_019247938.1|2213135_2214032_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010930546.1|2214028_2215954_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.8	1.1e-66
WP_010926400.1|2216313_2218926_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003812546.1|2218978_2221279_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.9	9.9e-110
WP_003812548.1|2221275_2222484_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_010930545.1|2222745_2223120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2223116_2224067_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879626.1|2224165_2226160_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.3	4.4e-21
WP_010930543.1|2226219_2227185_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_010930542.1|2227174_2230036_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
WP_010930541.1|2230038_2230545_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_010930540.1|2230649_2231858_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
WP_033446178.1|2231859_2232798_-	membrane protein	NA	NA	NA	NA	NA
WP_010930538.1|2232959_2233433_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|2233429_2234380_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	2319508	2383086	4105464	transposase,protease	uncultured_Caudovirales_phage(11.11%)	49	NA	NA
WP_010931070.1|2319508_2320459_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809615.1|2320760_2321237_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_019247142.1|2321860_2323498_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	8.8e-12
WP_003809610.1|2323528_2324842_-	pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	67.1	2.1e-149
WP_004568205.1|2324975_2325293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023852827.1|2325393_2326716_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010929591.1|2326712_2327663_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2327761_2328712_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930836.1|2329241_2330264_-	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003820286.1|2330292_2331123_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_029443740.1|2331139_2332837_-	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010930838.1|2332901_2333978_-	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	1.2e-28
WP_010930839.1|2334137_2335001_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930840.1|2335031_2335601_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_010930841.1|2335617_2336469_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003813142.1|2337526_2338408_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_010930842.1|2338482_2339472_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_010930843.1|2339534_2340485_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003813147.1|2340547_2341405_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003813149.1|2341464_2341953_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930844.1|2343525_2344716_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010930845.1|2344712_2346299_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_010930846.1|2346317_2347385_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_010930847.1|2347489_2349034_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.4	3.1e-14
WP_010930848.1|2349453_2351028_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930849.1|2351135_2352152_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003813165.1|2352148_2352988_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930850.1|2352992_2354630_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	3.6e-21
WP_005013747.1|2354626_2355577_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162268683.1|2355594_2355738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930851.1|2355719_2356994_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.6e-24
WP_010930852.1|2357023_2357314_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_047122810.1|2357386_2358400_+	histone deacetylase family protein	NA	A0A2K9L4C2	Tupanvirus	35.2	1.7e-42
WP_010930854.1|2358419_2359682_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_010930855.1|2359684_2360608_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010930856.1|2360604_2362098_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010930857.1|2362108_2363041_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_076879554.1|2363222_2364548_+	aspartate aminotransferase family protein	NA	A0A1C9EHH3	Mycobacterium_phage	22.5	1.8e-07
WP_023853659.1|2364582_2365926_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_023853666.1|2365998_2367519_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.9	1.7e-78
WP_010930861.1|2367673_2368405_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010930862.1|2368472_2369813_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_010930863.1|2369828_2370740_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_010930864.1|2370730_2371324_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003813196.1|2371385_2371772_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_003813199.1|2371783_2372254_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_010930865.1|2372265_2372889_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_010930866.1|2372909_2375657_-	autotransporter Vag8	NA	NA	NA	NA	NA
WP_005012808.1|2382135_2383086_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	2528027	2586271	4105464	transposase,tRNA	Planktothrix_phage(28.57%)	54	NA	NA
WP_005012067.1|2528027_2528978_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930388.1|2529457_2530114_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_010930387.1|2530128_2531796_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_010930386.1|2531798_2532428_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_014486072.1|2532639_2533734_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930384.1|2533878_2534691_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_023853502.1|2534694_2536398_-	FimV N-terminal domain protein	NA	NA	NA	NA	NA
WP_010930382.1|2536448_2537579_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010930381.1|2537765_2538842_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_010930380.1|2538923_2539574_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_010930379.1|2539588_2540992_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_004567445.1|2541275_2542094_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010930378.1|2542090_2542795_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	2.6e-13
WP_010930377.1|2543694_2544810_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004567447.1|2544843_2545218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930376.1|2545240_2546398_-	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_003812666.1|2546410_2546644_-	lipoprotein	NA	NA	NA	NA	NA
WP_019247523.1|2547278_2550248_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_023853518.1|2550262_2550472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248667.1|2550623_2551253_-	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_010930373.1|2551249_2553340_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_010930372.1|2553363_2554044_-	DUF3306 domain-containing protein	NA	NA	NA	NA	NA
WP_003820494.1|2554040_2554601_-	DUF3305 domain-containing protein	NA	NA	NA	NA	NA
WP_004567450.1|2554607_2555705_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010930371.1|2555857_2556451_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_010930370.1|2556447_2557740_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_003812685.1|2557753_2558296_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_010930369.1|2558305_2559142_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003820487.1|2559175_2560237_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.8	2.9e-80
WP_019247210.1|2560278_2561331_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_019247209.1|2561346_2561649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012808.1|2561790_2562741_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162268680.1|2562758_2562923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930368.1|2562919_2564614_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003809599.1|2564610_2565696_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	6.4e-27
WP_010930367.1|2565743_2566643_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003809593.1|2566653_2567298_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010930366.1|2568319_2571562_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_023852833.1|2571572_2572727_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	3.3e-53
WP_010930364.1|2572953_2573916_+	transaldolase	NA	H6WFR1	Cyanophage	29.2	7.5e-11
WP_005013747.1|2574014_2574965_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930363.1|2575063_2576014_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930362.1|2576023_2576713_-	VIT family protein	NA	NA	NA	NA	NA
WP_003811741.1|2576772_2577210_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003811743.1|2577255_2578149_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003811746.1|2578196_2579369_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003811748.1|2579365_2580520_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003811750.1|2580716_2581067_-	RnfH family protein	NA	NA	NA	NA	NA
WP_003811752.1|2581056_2581491_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_010930800.1|2581507_2582458_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811754.1|2582605_2583073_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.1	6.2e-27
WP_010930360.1|2583053_2584211_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.2	2.3e-14
WP_003811759.1|2584276_2585203_-	paraslipin	NA	NA	NA	NA	NA
WP_005012067.1|2585320_2586271_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	2628551	2695051	4105464	transposase	uncultured_Caudovirales_phage(40.0%)	56	NA	NA
WP_005012067.1|2628551_2629502_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811850.1|2629871_2630444_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_003811852.1|2630446_2631457_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_010930335.1|2631449_2631950_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_003811855.1|2631960_2632302_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_015041547.1|2632313_2633105_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_003811859.1|2633121_2633391_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_010930333.1|2633413_2634202_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_010929632.1|2634248_2635265_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_014486070.1|2635481_2636924_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	41.8	1.0e-35
WP_010930332.1|2637102_2638722_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	1.5e-08
WP_010930331.1|2638842_2640663_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	6.4e-11
WP_010930330.1|2640741_2642274_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_010930329.1|2642307_2643954_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_010930328.1|2644023_2645046_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.4	1.9e-12
WP_010930327.1|2645063_2646197_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_010930326.1|2646199_2646889_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_010930325.1|2646888_2647674_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_003817181.1|2647717_2648482_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_003817180.1|2648520_2649942_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_010930324.1|2650007_2650712_-	flagellar basal body rod modification protein FlgD	NA	NA	NA	NA	NA
WP_003817176.1|2650759_2651179_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_010930323.1|2651191_2651599_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_010930322.1|2651782_2652493_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_003817172.1|2652619_2652910_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_003817170.1|2652927_2653410_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_010930321.1|2657915_2659070_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_010931363.1|2659375_2660392_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930319.1|2660638_2661427_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003812020.1|2661493_2662174_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812022.1|2662170_2662941_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
WP_010930208.1|2663039_2663990_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811401.1|2664045_2664963_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_003811400.1|2664973_2666152_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_010930318.1|2666171_2667167_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811396.1|2668755_2669364_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003811393.1|2669351_2670392_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003811391.1|2670409_2671372_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811389.1|2671368_2672562_-	CoA transferase	NA	NA	NA	NA	NA
WP_010930317.1|2672558_2673356_-	citryl-CoA lyase	NA	NA	NA	NA	NA
WP_014486069.1|2673381_2674368_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930316.1|2674386_2676426_-	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_010930315.1|2676627_2677308_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930314.1|2677321_2678233_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_003811381.1|2678229_2678808_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010930313.1|2678946_2679852_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930312.1|2679859_2683279_+	TM0106 family RecB-like putative nuclease	NA	NA	NA	NA	NA
WP_010930311.1|2683266_2685867_-	BP1344/BB2830 family autotransporter	NA	NA	NA	NA	NA
WP_003811375.1|2686822_2687455_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003811372.1|2687848_2688607_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_003811370.1|2688603_2689806_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_010930208.1|2689993_2690944_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930310.1|2691851_2692997_+	DUF3182 family protein	NA	NA	NA	NA	NA
WP_019247449.1|2692983_2693739_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003811361.1|2693855_2694035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930208.1|2694100_2695051_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	2893390	2966715	4105464	transposase,tRNA,protease	Catovirus(22.22%)	53	NA	NA
WP_010930211.1|2893390_2894746_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003813618.1|2896224_2896947_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930207.1|2897001_2897985_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012067.1|2898114_2899065_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813621.1|2899061_2899964_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930206.1|2900051_2900810_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023853245.1|2900822_2901914_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003813626.1|2902011_2903439_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	2.1e-41
WP_010930204.1|2903668_2904883_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_003813631.1|2904928_2907799_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_010930202.1|2910209_2910698_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930201.1|2910823_2913520_+	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_010930200.1|2913674_2915957_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_019248935.1|2916130_2916754_+	serotype 2 fimbrial subunit	NA	NA	NA	NA	NA
WP_010930198.1|2916852_2917803_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812405.1|2917849_2918404_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_003816844.1|2918471_2919317_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_019248398.1|2919386_2920355_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023995083.1|2920354_2921218_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010930196.1|2924050_2927977_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_010930194.1|2928712_2931943_-	autotransporter SphB3	NA	NA	NA	NA	NA
WP_010928340.1|2932224_2933052_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003812422.1|2933085_2933781_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.6	7.0e-35
WP_019247537.1|2933773_2935054_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010930192.1|2935063_2936041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930191.1|2936022_2937723_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.3e-50
WP_010926448.1|2937825_2938929_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_010926447.1|2938959_2939715_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930190.1|2939721_2941242_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.0	1.2e-82
WP_010930189.1|2941284_2941587_+	membrane protein	NA	NA	NA	NA	NA
WP_003812436.1|2941583_2942216_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930188.1|2942294_2944160_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	9.3e-50
WP_020699602.1|2944156_2944951_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	1.2e-11
WP_010930186.1|2944979_2946095_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930185.1|2946999_2947878_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930184.1|2947877_2948702_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	22.7	1.0e-08
WP_010929591.1|2948869_2949820_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930183.1|2950032_2952882_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010930182.1|2952863_2953592_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_019248549.1|2953732_2955196_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.5	1.7e-43
WP_010930180.1|2955192_2955564_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_003812701.1|2955581_2956895_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_003812703.1|2956931_2957390_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155120815.1|2957344_2957485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2957502_2958453_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930178.1|2958449_2959463_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_003812707.1|2959602_2960589_+	homoserine kinase	NA	NA	NA	NA	NA
WP_161633091.1|2960947_2961655_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_010929591.1|2962235_2963186_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809618.1|2963337_2963940_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_010930175.1|2963958_2964591_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_162096758.1|2964635_2964887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930174.1|2964828_2966715_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
>prophage 22
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	2978440	3028160	4105464	transposase,tRNA,holin	uncultured_Mediterranean_phage(60.0%)	43	NA	NA
WP_005013747.1|2978440_2979391_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809441.1|2979417_2979882_-	barstar family protein	NA	NA	NA	NA	NA
WP_014486065.1|2981088_2983377_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_010930165.1|2983493_2984366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930164.1|2984408_2985563_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010930163.1|2985597_2986428_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_023853525.1|2986511_2988056_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_010930161.1|2988098_2988458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003819794.1|2988459_2988873_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003809432.1|2988913_2989231_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003809431.1|2989315_2990032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930160.1|2990295_2991717_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_005015810.1|2994389_2995340_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_161633096.1|2995319_2995574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931363.1|2995912_2996929_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003809411.1|2997261_2998197_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.5	3.0e-41
WP_010930154.1|2998246_3000127_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003809416.1|3000193_3000538_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.4	1.0e-10
WP_010930155.1|3000682_3001819_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
WP_023853534.1|3001815_3002889_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003809423.1|3003046_3004483_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_010930157.1|3004573_3005215_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010931363.1|3005550_3006567_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_015041211.1|3007504_3008932_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_010930151.1|3008928_3009951_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
WP_003809396.1|3009940_3010414_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_010930149.1|3010554_3011442_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_014486064.1|3011438_3013082_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_010930148.1|3013078_3014128_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_010931363.1|3014916_3015933_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003817162.1|3016032_3016665_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_003811911.1|3016673_3017063_-	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	5.7e-10
WP_010930146.1|3017115_3018168_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_023995045.1|3019031_3019796_-	Tar ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_003811919.1|3019869_3020370_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_010930144.1|3020384_3022442_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_019247393.1|3022468_3022762_-	response regulator	NA	NA	NA	NA	NA
WP_003817154.1|3022863_3023811_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_003811927.1|3023823_3024699_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003811929.1|3024819_3025380_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_010930143.1|3025414_3025738_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003811933.1|3026173_3026911_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_005012067.1|3027209_3028160_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	3036370	3098525	4105464	transposase	Erysipelothrix_phage(20.0%)	46	NA	NA
WP_023853531.1|3036370_3037504_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930137.1|3037607_3038249_+	glutathione transferase	NA	NA	NA	NA	NA
WP_010930136.1|3038403_3040752_+	DUF3141 domain-containing protein	NA	NA	NA	NA	NA
WP_003809454.1|3040748_3041687_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_010930135.1|3041712_3042903_+	acetate kinase	NA	NA	NA	NA	NA
WP_010930134.1|3042899_3043673_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010930133.1|3043702_3044896_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_010930132.1|3045013_3046024_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_010930131.1|3046041_3048078_-	transketolase	NA	NA	NA	NA	NA
WP_010930130.1|3048272_3049013_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_010929969.1|3049111_3050062_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929584.1|3050160_3051111_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003817151.1|3051153_3052329_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_010930129.1|3052550_3054341_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	2.4e-39
WP_010930128.1|3054353_3056015_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_010930127.1|3056027_3058733_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_003817147.1|3059025_3060780_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_010930126.1|3060776_3061403_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003811948.1|3061399_3062251_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.1e-33
WP_019248379.1|3062326_3064441_+	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_010930124.1|3064627_3065242_+	SCO family protein	NA	NA	NA	NA	NA
WP_010930123.1|3065387_3065639_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014486063.1|3065708_3067091_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010930121.1|3067087_3070267_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_029443805.1|3071074_3071992_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930119.1|3072043_3072775_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_010926548.1|3072834_3073407_+	chorismate lyase	NA	NA	NA	NA	NA
WP_010929632.1|3074915_3075932_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930118.1|3076069_3077119_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_005012067.1|3077223_3078174_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813314.1|3078269_3078995_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_003813315.1|3079205_3079586_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_014905652.1|3079891_3080764_+	EamA family transporter	NA	NA	NA	NA	NA
WP_023852686.1|3080771_3081152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023852693.1|3081305_3082580_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_010930113.1|3084067_3084976_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_010930112.1|3085773_3086838_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	3.8e-24
WP_170954292.1|3088674_3089676_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003813333.1|3089898_3090540_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003821527.1|3090622_3092449_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010930111.1|3092692_3093622_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_010930110.1|3093621_3094371_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_003821521.1|3094442_3095357_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.7	9.8e-45
WP_010930108.1|3095376_3096522_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_014486062.1|3096582_3097494_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	38.8	8.0e-47
WP_005012067.1|3097574_3098525_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	3117947	3173077	4105464	transposase	Bacillus_phage(28.57%)	48	NA	NA
WP_005012808.1|3117947_3118898_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566317.1|3119027_3119420_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	45.0	4.8e-25
WP_003821497.1|3119696_3120608_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.4e-05
WP_010930088.1|3120732_3121707_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012067.1|3121703_3122654_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810865.1|3122752_3123838_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_010930072.1|3123935_3124346_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003810859.1|3124961_3126875_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_010930071.1|3127010_3129623_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_019248496.1|3129624_3130359_-	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.2	1.9e-62
WP_003810851.1|3130522_3131704_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003810850.1|3131700_3131913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930069.1|3131909_3132890_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_010930068.1|3132935_3133763_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.4	1.7e-67
WP_023852913.1|3133912_3135727_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	27.9	5.7e-44
WP_003810840.1|3135781_3136165_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_010930066.1|3136161_3137112_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810839.1|3137224_3137476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003810835.1|3137981_3139100_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003810832.1|3139219_3139432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930064.1|3139591_3139813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3139865_3140816_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930062.1|3141992_3143363_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_010930061.1|3143395_3144187_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930060.1|3144199_3145255_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019247557.1|3145280_3146156_-	amidohydrolase	NA	NA	NA	NA	NA
WP_023852826.1|3146261_3146510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003819989.1|3146544_3147999_-	carboxylase	NA	NA	NA	NA	NA
WP_004568140.1|3147995_3148517_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_010930057.1|3148545_3149898_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_029444137.1|3150121_3153010_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_010930056.1|3155154_3156456_+	phospholipase A	NA	NA	NA	NA	NA
WP_010930055.1|3156470_3157187_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_010930054.1|3157468_3158149_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_003809770.1|3158160_3158328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023852837.1|3158436_3158583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930052.1|3158676_3159336_-	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_010930051.1|3159734_3161567_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.3e-27
WP_005012067.1|3161563_3162514_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814007.1|3163677_3165393_+	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_003814006.1|3165403_3165895_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_010930015.1|3165967_3166984_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814004.1|3167151_3167931_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003814003.1|3167949_3168477_-	lipoprotein	NA	NA	NA	NA	NA
WP_003814002.1|3168770_3169040_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_003821234.1|3169130_3171290_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003814000.1|3171410_3172130_+	lipoprotein	NA	NA	NA	NA	NA
WP_005013747.1|3172126_3173077_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	3254137	3327299	4105464	transposase	Klosneuvirus(16.67%)	57	NA	NA
WP_041337087.1|3254137_3255088_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813068.1|3255084_3256104_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	35.7	1.5e-49
WP_010930049.1|3256113_3258822_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.0	2.8e-15
WP_010930050.1|3258969_3259626_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005013747.1|3259724_3260675_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023998705.1|3260822_3261716_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_010930013.1|3261915_3263610_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_010930012.1|3263644_3264571_+	VOC family protein	NA	NA	NA	NA	NA
WP_010930011.1|3264639_3265737_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003818996.1|3265755_3266619_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	9.6e-34
WP_010930010.1|3266630_3267413_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004566042.1|3267409_3268528_+	DUF2817 domain-containing protein	NA	NA	NA	NA	NA
WP_010930009.1|3268524_3270057_+	acyl--CoA ligase	NA	NA	NA	NA	NA
WP_003818991.1|3270097_3271105_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_023999677.1|3271249_3271972_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930007.1|3271987_3273010_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_010930006.1|3273326_3274061_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930005.1|3274145_3275891_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_010930004.1|3275887_3276640_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930003.1|3276684_3277641_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003818983.1|3277729_3278296_+	membrane protein	NA	NA	NA	NA	NA
WP_010930002.1|3278303_3279164_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_020699739.1|3279193_3279922_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.4e-32
WP_003807497.1|3279953_3280637_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010930000.1|3281474_3282389_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929999.1|3282453_3283362_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929998.1|3283452_3284877_-	TolC family protein	NA	NA	NA	NA	NA
WP_010929997.1|3284878_3286201_-	cyclolysin T1SS periplasmic adaptor subunit CyaD	NA	NA	NA	NA	NA
WP_010929996.1|3286197_3288336_-	cyclolysin T1SS permease/ATPase CyaB	NA	W8CYL7	Bacillus_phage	29.2	2.7e-45
WP_010929995.1|3288413_3293534_-	bifunctional adenylate cyclase toxin/hemolysin CyaA	NA	NA	NA	NA	NA
WP_153302771.1|3293634_3293943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929994.1|3294012_3294570_+	cyclolysin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_010929993.1|3294585_3296067_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010929992.1|3298237_3299575_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010929991.1|3299609_3301607_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010929990.1|3301624_3303673_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010929989.1|3303803_3304670_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929988.1|3304938_3305904_-	octaprenyl diphosphate synthase	NA	NA	NA	NA	NA
WP_010929987.1|3306018_3307167_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_003807462.1|3307591_3307903_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003807460.1|3307936_3308197_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003807459.1|3308346_3309480_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003807457.1|3309550_3310687_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.8	5.8e-63
WP_010925762.1|3310852_3311647_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003807452.1|3311709_3312153_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|3312268_3313219_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929985.1|3313320_3313749_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929984.1|3313821_3316017_+	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|3316238_3317189_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852739.1|3317148_3317673_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003814467.1|3317804_3318776_+	FecR family protein	NA	NA	NA	NA	NA
WP_010929983.1|3318895_3321340_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_010929982.1|3321355_3321946_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_010929591.1|3322189_3323140_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814462.1|3323297_3324563_-	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003814461.1|3324596_3325694_-	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_005013747.1|3326348_3327299_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	3338586	3438699	4105464	transposase,terminase,protease,tail,tRNA	uncultured_Caudovirales_phage(14.29%)	108	NA	NA
WP_005012067.1|3338586_3339537_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814437.1|3340268_3340646_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_003814436.1|3340630_3341332_-	membrane protein	NA	NA	NA	NA	NA
WP_010931409.1|3341475_3342168_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_010931410.1|3342167_3343271_-	phosphotransferase	NA	NA	NA	NA	NA
WP_010931411.1|3343380_3345753_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010931412.1|3345749_3347309_+	chaperone SurA	NA	NA	NA	NA	NA
WP_010931413.1|3347333_3348131_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010931414.1|3348162_3349308_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.7e-41
WP_003814419.1|3349412_3350855_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_010929184.1|3350857_3352087_-	spore maturation protein	NA	NA	NA	NA	NA
WP_005012808.1|3354224_3355175_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247922.1|3356304_3356862_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247923.1|3356837_3357188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814657.1|3357356_3358151_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.4e-15
WP_010931416.1|3358147_3359197_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003814652.1|3359196_3359886_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_003814650.1|3359972_3360470_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_010931417.1|3360501_3361818_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_010931418.1|3361834_3362809_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003814643.1|3362845_3363304_-	protein TolR	NA	NA	NA	NA	NA
WP_003814641.1|3363303_3363984_-	protein TolQ	NA	NA	NA	NA	NA
WP_010931419.1|3363986_3364415_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814636.1|3364467_3366198_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.4	4.6e-11
WP_003814635.1|3366263_3366836_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_010931420.1|3366816_3367503_+	response regulator	NA	NA	NA	NA	NA
WP_010931421.1|3367858_3368530_+	SOS response-associated peptidase	NA	Q5QF62	Pseudomonas_virus	39.9	4.7e-36
WP_010931422.1|3368858_3369080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926433.1|3369079_3369361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931423.1|3369357_3369873_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_010931424.1|3369872_3370424_-	lysozyme	NA	NA	NA	NA	NA
WP_010931425.1|3370402_3370645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931426.1|3370649_3371462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926428.1|3371461_3371725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124740660.1|3371765_3371963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931428.1|3371943_3372360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931429.1|3372364_3376321_-	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
WP_010931430.1|3376313_3376703_-	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
WP_010931431.1|3376699_3377233_-	DUF1833 family protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
WP_010931432.1|3377300_3377660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931433.1|3377669_3380282_-|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
WP_010931434.1|3380307_3380598_-	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
WP_003813412.1|3380615_3380945_-|tail	phage tail assembly chaperone	tail	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
WP_010931435.1|3380954_3381473_-|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
WP_010931436.1|3381727_3382228_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
WP_010931437.1|3382235_3382658_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_010931438.1|3382654_3383053_-	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
WP_010931439.1|3383049_3383445_-	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_010931440.1|3383444_3383645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247789.1|3383646_3384129_-	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
WP_010931442.1|3384191_3384443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012808.1|3385117_3386068_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931443.1|3386496_3387099_-	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
WP_010931444.1|3387221_3387464_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
WP_010931445.1|3387469_3388525_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.6	2.6e-97
WP_010931446.1|3388553_3389972_-	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
WP_010931447.1|3389974_3391252_-|terminase	terminase large subunit	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
WP_019247942.1|3391238_3391724_-|transposase	transposase	transposase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
WP_005012067.1|3392363_3393314_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023853183.1|3393331_3393553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161633094.1|3393570_3394260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023853179.1|3394252_3394504_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010931451.1|3395058_3395670_+	S24 family peptidase	NA	NA	NA	NA	NA
WP_019247378.1|3395741_3395948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3396199_3397150_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248926.1|3397248_3398322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931475.1|3398489_3399284_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010925795.1|3399323_3399848_-	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_010931474.1|3399840_3401583_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_010931473.1|3401792_3402551_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
WP_010931472.1|3402553_3403261_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
WP_010931471.1|3403277_3404159_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019247734.1|3404169_3404928_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019248554.1|3404896_3405652_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931468.1|3405721_3407140_+	amidase	NA	NA	NA	NA	NA
WP_003819076.1|3407161_3407812_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_033446132.1|3407945_3408281_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_010930800.1|3408369_3409320_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931467.1|3409396_3411217_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	3.1e-74
WP_010931466.1|3411221_3412295_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.7	2.3e-08
WP_003814230.1|3412417_3413386_+	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_010927008.1|3413459_3414371_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_003814226.1|3414389_3414962_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010931465.1|3415042_3415591_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_010931464.1|3415590_3417180_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	8.7e-65
WP_003814221.1|3417249_3417489_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_023995141.1|3417529_3418555_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003814217.1|3418620_3419802_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_010931463.1|3419898_3420351_+	membrane protein	NA	NA	NA	NA	NA
WP_010931462.1|3420360_3421701_-	aminopeptidase P N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010931461.1|3422017_3423055_+	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_003814209.1|3423436_3423796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041166340.1|3423879_3424821_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879617.1|3424895_3425846_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814206.1|3426139_3427234_+	porin	NA	NA	NA	NA	NA
WP_003814205.1|3427315_3428197_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003814203.1|3428218_3429058_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
WP_010931459.1|3429133_3430651_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_010931458.1|3430747_3431848_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010931457.1|3431864_3432287_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003814195.1|3432309_3432522_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_010931456.1|3432568_3433489_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_010931455.1|3433671_3434421_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003814188.1|3434423_3434753_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_010931454.1|3434959_3436393_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	1.5e-52
WP_003814185.1|3436404_3436788_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_010931453.1|3436849_3437650_+	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015810.1|3437748_3438699_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	3599368	3654342	4105464	transposase	Lake_Baikal_phage(20.0%)	44	NA	NA
WP_005012067.1|3599368_3600319_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929827.1|3600435_3601503_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_019247670.1|3601578_3604707_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_023853155.1|3605214_3606180_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010929830.1|3606182_3606854_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010929831.1|3607010_3607970_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_003821340.1|3607977_3608640_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_005013747.1|3608636_3609587_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929806.1|3609708_3610962_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929805.1|3610939_3611902_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929804.1|3612033_3612528_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_010929803.1|3612527_3613760_+	CoA transferase	NA	NA	NA	NA	NA
WP_019247316.1|3614505_3614787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929802.1|3614773_3615760_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929801.1|3615903_3616308_+	RidA family protein	NA	NA	NA	NA	NA
WP_010929800.1|3616449_3619836_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010929799.1|3619866_3621330_+	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_019248869.1|3621350_3622967_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010929797.1|3623052_3623712_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929796.1|3623741_3624182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929795.1|3624692_3624896_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	5.8e-14
WP_010929794.1|3625071_3625977_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929577.1|3626075_3627026_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3627124_3628075_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814674.1|3629856_3631050_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_010929793.1|3631115_3632144_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_019247419.1|3632170_3633343_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003814681.1|3633468_3634446_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814685.1|3634456_3635428_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929791.1|3635494_3636280_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_003814691.1|3636272_3637505_-	CoA transferase	NA	NA	NA	NA	NA
WP_003814694.1|3637700_3638456_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	40.8	2.9e-42
WP_010929789.1|3638566_3639085_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	2.1e-12
WP_010929788.1|3640873_3642274_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003820700.1|3642373_3642718_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_003814701.1|3642806_3643277_+	universal stress protein	NA	NA	NA	NA	NA
WP_019247421.1|3643687_3644086_+	GTP-binding protein	NA	E4ZFJ7	Streptococcus_phage	44.3	9.0e-19
WP_010929577.1|3644217_3645168_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814730.1|3647612_3648347_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	43.8	1.4e-41
WP_003814728.1|3648756_3648936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814726.1|3649126_3650440_+	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_010929786.1|3650455_3651967_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929785.1|3651963_3653169_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_022997984.1|3653364_3654342_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	3744155	3798350	4105464	transposase,protease	Paramecium_bursaria_Chlorella_virus(14.29%)	54	NA	NA
WP_005013747.1|3744155_3745106_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814960.1|3745228_3745957_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_010929739.1|3746053_3747232_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_010929738.1|3747228_3748062_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_010929737.1|3748098_3748839_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929736.1|3748958_3750134_-	dihydroorotase	NA	NA	NA	NA	NA
WP_003820560.1|3750130_3751084_-	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	35.8	2.5e-30
WP_010929735.1|3751097_3751499_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_010927118.1|3751491_3752097_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_003814980.1|3752184_3752349_-	rubredoxin	NA	NA	NA	NA	NA
WP_010929734.1|3752465_3753314_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003814984.1|3753310_3753964_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_010929733.1|3753980_3755264_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_010929732.1|3755503_3757129_+	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_003814990.1|3757222_3757624_-	RidA family protein	NA	NA	NA	NA	NA
WP_003814993.1|3757648_3758083_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814996.1|3758084_3759734_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.2	2.6e-56
WP_010929731.1|3759774_3760944_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929730.1|3760946_3761810_-	enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_010929729.1|3765173_3765878_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	1.1e-16
WP_003815010.1|3765871_3766666_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.5	2.6e-09
WP_003815011.1|3766662_3767628_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815013.1|3767631_3768552_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815015.1|3768648_3769812_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929728.1|3770034_3770925_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003815019.1|3770928_3771432_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929727.1|3771474_3772473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930048.1|3772469_3773420_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_111735998.1|3773508_3773796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|3773987_3774938_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566083.1|3774997_3775558_+	5'-3'-deoxyribonucleotidase	NA	A0A1E1EUN3	Acanthamoeba_castellanii_mimivirus	30.8	3.2e-14
WP_004566082.1|3777060_3777942_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929725.1|3778055_3779258_+	MFS transporter	NA	NA	NA	NA	NA
WP_003819105.1|3779386_3781246_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_003819104.1|3781323_3782133_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010929724.1|3782203_3783205_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_003807710.1|3783236_3784097_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010929723.1|3784296_3785301_+	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	31.5	7.5e-30
WP_003819100.1|3785297_3786884_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003807706.1|3786892_3787819_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_003807705.1|3787841_3788468_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_005015810.1|3788566_3789517_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014906092.1|3789513_3790650_-	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	31.2	1.2e-07
WP_010927226.1|3790703_3791480_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_010929721.1|3791504_3791963_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_003815815.1|3792102_3792744_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_003815816.1|3792808_3794191_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_019247426.1|3794210_3795065_+	cytochrome c1	NA	NA	NA	NA	NA
WP_003815819.1|3795223_3795835_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003815821.1|3795844_3796294_+|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
WP_010929719.1|3796812_3796953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929718.1|3796960_3797122_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_193394812.1|3797235_3797382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3797399_3798350_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	3808966	3869855	4105464	transposase,tRNA,protease	uncultured_Caudovirales_phage(33.33%)	51	NA	NA
WP_010929591.1|3808966_3809917_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929711.1|3810647_3811628_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929710.1|3811641_3812766_+	CoA transferase	NA	NA	NA	NA	NA
WP_003814321.1|3812773_3814528_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_010929709.1|3814634_3815534_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814324.1|3815598_3816582_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_010929708.1|3816717_3817698_+	AEC family transporter	NA	NA	NA	NA	NA
WP_010929707.1|3817714_3819106_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_010929706.1|3819257_3819794_+|tRNA	bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_019247543.1|3819724_3821110_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
WP_003814332.1|3821252_3821891_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_010929705.1|3821977_3823867_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	3.3e-79
WP_003814337.1|3823863_3824805_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003814339.1|3824910_3825960_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
WP_010929704.1|3826212_3826914_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_010929703.1|3826910_3827609_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010929702.1|3827609_3828965_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
WP_010929701.1|3828961_3829453_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003814351.1|3829471_3830428_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003814355.1|3831838_3833941_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_003814356.1|3834111_3835155_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814358.1|3835198_3835942_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814363.1|3836963_3837374_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010929700.1|3838323_3839121_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930742.1|3839219_3840170_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927663.1|3840166_3841117_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3841203_3842154_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929681.1|3842268_3843270_-	HindIII family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_010929682.1|3843360_3843927_-	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
WP_010929683.1|3844245_3846159_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_010929684.1|3846200_3847631_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_019247308.1|3847743_3849156_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003818947.1|3849172_3849868_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|3850086_3851037_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929687.1|3851061_3851961_-	virginiamycin B lyase	NA	NA	NA	NA	NA
WP_010929688.1|3852115_3852664_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
WP_010929689.1|3852702_3853422_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
WP_010929690.1|3853493_3856436_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_033455792.1|3857029_3859825_+|protease	serine protease autotransporter SphB1	protease	NA	NA	NA	NA
WP_010929692.1|3860282_3861215_+	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929693.1|3861326_3862676_+	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_010929694.1|3862707_3863433_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929695.1|3863483_3864335_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929696.1|3864464_3865151_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_003819086.1|3865150_3865795_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_003807674.1|3865851_3866127_+	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_003807672.1|3866152_3866449_+	YciI family protein	NA	NA	NA	NA	NA
WP_010929697.1|3866494_3867274_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_023853200.1|3867279_3868320_+	cyclase family protein	NA	NA	NA	NA	NA
WP_010929699.1|3868424_3868748_-	phosphate starvation-inducible protein	NA	NA	NA	NA	NA
WP_010931070.1|3868904_3869855_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP011762	Bordetella pertussis strain J076 chromosome, complete genome	4105464	4027635	4081067	4105464	transposase	Planktothrix_phage(40.0%)	46	NA	NA
WP_010931661.1|4027635_4028586_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931662.1|4028755_4029982_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_010931663.1|4030181_4031048_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003815027.1|4031040_4032003_+	Nudix family hydrolase	NA	A0A221LFJ1	Barns_Ness_breadcrumb_sponge_sobemo-like_virus	53.4	1.9e-06
WP_010927663.1|4032103_4033054_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|4033152_4034103_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|4034201_4035152_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994937.1|4035148_4036642_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003815032.1|4036638_4039746_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010931665.1|4039742_4042811_-	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010931666.1|4042807_4044058_-	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003815038.1|4044238_4045000_-	cell division protein ZapD	NA	NA	NA	NA	NA
WP_019247320.1|4045032_4045683_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003820519.1|4045685_4046525_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003815047.1|4046765_4047509_+	copper resistance protein NlpE N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003815049.1|4047591_4047939_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003815051.1|4048036_4048879_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_003815053.1|4048923_4049811_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003815055.1|4049837_4050026_-	DUF3460 family protein	NA	NA	NA	NA	NA
WP_010931669.1|4050123_4051581_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_010931670.1|4051567_4053094_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003815061.1|4053112_4053580_-	CopD family protein	NA	NA	NA	NA	NA
WP_010931671.1|4053579_4054602_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_169507388.1|4054722_4055442_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	4.7e-34
WP_003815066.1|4055517_4056618_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815068.1|4056619_4057810_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815070.1|4057929_4058946_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	42.1	1.0e-71
WP_003815073.1|4059264_4059936_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.2	9.5e-29
WP_010927126.1|4059932_4060841_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_010931672.1|4061052_4061700_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_010931673.1|4065551_4066628_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003815084.1|4066638_4067448_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003815086.1|4067537_4068311_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023853189.1|4068311_4068476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930363.1|4068493_4069444_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_077274100.1|4069332_4070355_+	CoA transferase	NA	NA	NA	NA	NA
WP_010931674.1|4070344_4071499_+	CoA transferase	NA	NA	NA	NA	NA
WP_010931675.1|4071538_4072951_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_019247370.1|4073075_4073942_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931677.1|4073943_4074768_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_023853488.1|4074764_4075526_+	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	31.0	2.0e-19
WP_003808010.1|4075606_4076293_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931679.1|4076466_4077474_+	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_003819309.1|4077470_4078250_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931680.1|4078307_4079570_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929591.1|4080116_4081067_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
