The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043318	Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 chromosome, complete genome	5111427	485168	543478	5111427	integrase,tRNA,protease,transposase	Enterobacteria_phage(15.38%)	53	490767:490782	540822:540837
WP_162838707.1|485168_486408_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	79.4	1.9e-131
WP_016154418.1|486860_488822_-	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_016154417.1|488818_489307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016154416.1|489303_490527_-	hypothetical protein	NA	NA	NA	NA	NA
490767:490782	attL	ACGGCGTTCGGTCATG	NA	NA	NA	NA
WP_016154415.1|491094_492117_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016154414.1|492518_493709_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.7	1.5e-122
WP_032643750.1|494129_494975_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032643752.1|495011_495602_+	LysE family translocator	NA	NA	NA	NA	NA
WP_032643754.1|495598_496174_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032643756.1|496223_497915_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_014168278.1|497890_498214_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_024907357.1|498327_499629_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_003855923.1|499744_501181_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_023616652.1|501516_501981_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_032643758.1|502004_503252_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_003855929.1|503431_503725_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
WP_014882201.1|503756_505400_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.3	1.5e-189
WP_008502942.1|505534_505888_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_032643760.1|505935_506964_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_008502940.1|507004_507571_+	elongation factor P	NA	NA	NA	NA	NA
WP_032643762.1|507629_507761_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_003025482.1|507869_508016_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_032643765.1|508053_508653_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_006178944.1|508914_509232_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_032643767.1|509228_509759_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	3.9e-46
WP_032644152.1|509912_511058_-	cephalosporin-hydrolyzing class C beta-lactamase ACT-53	NA	NA	NA	NA	NA
WP_032643769.1|511190_512066_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032643770.1|512095_512455_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_032643771.1|512465_512861_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_032643773.1|512871_513606_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_032643775.1|513598_515389_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	26.8	2.9e-16
WP_032643778.1|515699_516677_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.8	2.0e-27
WP_032643780.1|516875_518375_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_032643782.1|518412_521736_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_032643784.1|521755_522724_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_032643786.1|522821_523874_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_032643791.1|523981_524527_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	6.9e-30
WP_032643793.1|525293_526433_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_032643795.1|526431_527955_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_013095283.1|527947_528409_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032643797.1|528425_529763_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	2.0e-17
WP_032643799.1|529772_531617_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.5	2.2e-59
WP_032643804.1|531609_532560_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_008502919.1|532645_532957_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032643806.1|533031_534312_+	GTPase HflX	NA	NA	NA	NA	NA
WP_032643807.1|534368_535628_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_010427498.1|535630_536635_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_032643808.1|536706_536904_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_024907332.1|537007_538306_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	1.7e-66
WP_023310139.1|538507_538933_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_032643809.1|538971_541416_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	7.1e-66
540822:540837	attR	CATGACCGAACGCCGT	NA	NA	NA	NA
WP_032643810.1|541481_542216_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_149067757.1|542323_543478_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP043318	Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 chromosome, complete genome	5111427	1064841	1113372	5111427	tail,holin,head,capsid,integrase,plate	Salmonella_phage(44.64%)	66	1058390:1058404	1119404:1119418
1058390:1058404	attL	GGTGCGCCAGAACAT	NA	NA	NA	NA
WP_032638328.1|1064841_1065894_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	2.9e-117
WP_028017715.1|1066199_1067303_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	5.9e-60
WP_032638331.1|1067314_1068568_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.6	4.6e-93
WP_077064321.1|1068769_1069933_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	67.2	3.6e-153
WP_077064320.1|1070198_1070438_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	89.9	1.1e-32
WP_080500339.1|1070440_1073011_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	47.7	2.2e-219
WP_077064319.1|1073007_1073166_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	54.9	1.4e-07
WP_077064318.1|1073162_1073894_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.3	1.8e-25
WP_077064317.1|1073910_1074582_-	AAA family ATPase	NA	G9L667	Escherichia_phage	46.1	2.0e-50
WP_077064316.1|1074578_1075250_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	35.4	1.5e-13
WP_167513844.1|1075233_1075401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072778541.1|1075485_1075686_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	8.2e-13
WP_077064315.1|1075906_1076116_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	82.8	1.9e-20
WP_077064313.1|1076455_1076890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077064329.1|1076976_1077672_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	79.8	2.0e-98
WP_077064312.1|1077782_1078010_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	73.2	6.9e-24
WP_000426372.1|1078047_1078368_+	hypothetical protein	NA	H6WRX6	Salmonella_phage	88.7	2.9e-44
WP_167513845.1|1078371_1078521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077064311.1|1078855_1079746_+	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	50.9	8.0e-68
WP_077064310.1|1079742_1081140_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	63.6	2.8e-168
WP_077064309.1|1081139_1081430_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	61.7	1.2e-28
WP_059445267.1|1082052_1082334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077064307.1|1082330_1082642_+	ead/Ea22-like family protein	NA	K7PHN2	Enterobacterial_phage	79.3	1.1e-27
WP_077064306.1|1082638_1083034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100249864.1|1083090_1083792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077064305.1|1084099_1084552_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	53.1	1.3e-37
WP_044702921.1|1084541_1084841_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	88.0	5.1e-43
WP_044242279.1|1084837_1085197_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	76.3	5.7e-49
WP_047635042.1|1085367_1085877_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	41.4	3.6e-28
WP_077064304.1|1086019_1086571_+	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	46.9	5.5e-43
WP_077064303.1|1086564_1087506_+	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	49.5	1.2e-74
WP_077064302.1|1087411_1088026_+	methyltransferase domain-containing protein	NA	H2BDB7	Pseudomonas_virus	49.0	6.4e-48
WP_032666047.1|1088142_1088541_+	membrane protein	NA	NA	NA	NA	NA
WP_063217305.1|1088537_1088813_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_031275085.1|1088813_1089428_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	91.7	2.9e-101
WP_077064301.1|1089424_1089817_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	73.4	2.9e-46
WP_077064299.1|1089960_1090146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077064298.1|1090200_1090821_+	hypothetical protein	NA	I6S676	Salmonella_phage	73.7	2.6e-89
WP_000729396.1|1090852_1091326_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	72.8	4.7e-51
WP_063217301.1|1091328_1092951_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	2.1e-311
WP_077064297.1|1092950_1094420_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	95.3	1.0e-269
WP_000224761.1|1094304_1095042_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	96.0	6.0e-109
WP_077064296.1|1095056_1096289_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	95.1	1.7e-217
WP_077064295.1|1096293_1096797_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	84.4	2.9e-75
WP_044702584.1|1096808_1097750_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	96.8	3.6e-175
WP_077064294.1|1097791_1098181_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	55.8	3.9e-27
WP_077064293.1|1098146_1098554_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.0	4.6e-71
WP_077064292.1|1098550_1099105_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	85.9	9.4e-83
WP_077064291.1|1099091_1099481_+|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	96.9	1.7e-67
WP_077064290.1|1099455_1100019_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.0	1.6e-82
WP_077064289.1|1100022_1101183_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.6	9.9e-159
WP_000257257.1|1101193_1101634_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	77.4	7.5e-59
WP_000393957.1|1101637_1102063_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	57.5	1.6e-37
WP_077064288.1|1102240_1104322_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	56.9	1.3e-206
WP_077064287.1|1104321_1104924_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	69.5	2.1e-64
WP_001160174.1|1104925_1105231_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	53.5	9.2e-24
WP_077064286.1|1105233_1106298_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	66.8	1.3e-136
WP_100249863.1|1106381_1106666_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	47.9	4.1e-18
WP_131825683.1|1106665_1107103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077064327.1|1107137_1107878_+|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	65.2	1.8e-76
WP_016239889.1|1107877_1108231_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	76.1	1.1e-44
WP_077064285.1|1108231_1109431_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	84.0	8.3e-185
WP_077064284.1|1109427_1110108_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	80.1	8.8e-107
WP_077064326.1|1110107_1111229_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	81.7	2.1e-49
WP_077064283.1|1111228_1111819_+|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	51.5	1.5e-54
WP_077064282.1|1112166_1113372_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.4	1.9e-128
1119404:1119418	attR	GGTGCGCCAGAACAT	NA	NA	NA	NA
>prophage 3
NZ_CP043318	Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 chromosome, complete genome	5111427	1169781	1178333	5111427		Pectobacterium_phage(14.29%)	13	NA	NA
WP_032638353.1|1169781_1170264_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.7	5.5e-71
WP_077064280.1|1170253_1170475_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032638357.1|1170485_1170683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032638359.1|1170679_1170892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032638360.1|1172966_1173155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045889989.1|1173153_1173840_+	DUF4145 domain-containing protein	NA	A0A088CBI8	Shigella_phage	36.0	3.2e-32
WP_032638362.1|1173882_1174431_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	4.2e-67
WP_080282995.1|1174445_1174865_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	64.7	1.4e-30
WP_032638364.1|1174863_1175103_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	94.9	1.0e-38
WP_032638367.1|1175102_1175420_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	78.2	1.2e-42
WP_045889987.1|1175966_1177031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025912594.1|1177027_1177327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032638369.1|1177655_1178333_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	60.7	2.3e-75
>prophage 4
NZ_CP043318	Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 chromosome, complete genome	5111427	1409546	1462146	5111427	holin,transposase	Catovirus(16.67%)	44	NA	NA
WP_032638714.1|1409546_1411211_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	1.0e-60
WP_032638716.1|1411224_1412697_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032638719.1|1412710_1413298_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_032638721.1|1413426_1415460_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.3	9.9e-21
WP_032642492.1|1416554_1417100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032638725.1|1417215_1417770_+	fimbrial protein	NA	NA	NA	NA	NA
WP_032638727.1|1417830_1418508_+	molecular chaperone	NA	NA	NA	NA	NA
WP_032638729.1|1418680_1421044_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_077064098.1|1421105_1422101_+	fimbrial protein	NA	NA	NA	NA	NA
WP_032638732.1|1422245_1422911_-	enterobactin synthase subunit EntD	NA	NA	NA	NA	NA
WP_032638734.1|1423391_1425641_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_032638736.1|1425786_1426983_+	enterochelin esterase	NA	NA	NA	NA	NA
WP_032638738.1|1426993_1427206_+	MbtH family NRPS accessory protein	NA	NA	NA	NA	NA
WP_032638740.1|1427202_1431060_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	28.9	4.4e-62
WP_080283032.1|1431146_1432301_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_032638745.1|1432444_1433245_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1I2G3	Paramecium_bursaria_Chlorella_virus	25.9	7.6e-09
WP_077064588.1|1433241_1434231_-	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_032638749.1|1434230_1435235_-	Fe(3+)-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_032638751.1|1435343_1436579_+	enterobactin transporter EntS	NA	NA	NA	NA	NA
WP_032638753.1|1436662_1437622_-	Fe2+-enterobactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032638756.1|1437808_1438984_+	isochorismate synthase EntC	NA	NA	NA	NA	NA
WP_032638758.1|1438993_1440604_+	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_032638760.1|1440614_1441469_+	isochorismatase	NA	NA	NA	NA	NA
WP_032638762.1|1441465_1442221_+	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_032638764.1|1442221_1442635_+	proofreading thioesterase EntH	NA	NA	NA	NA	NA
WP_077064585.1|1442725_1443838_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_032638769.1|1443851_1444316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032638771.1|1444312_1445026_-	membrane protein	NA	NA	NA	NA	NA
WP_032638775.1|1445305_1447411_+	carbon starvation protein CstA	NA	NA	NA	NA	NA
WP_014169079.1|1447529_1447727_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_032638778.1|1447723_1448128_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	32.5	2.0e-05
WP_077064584.1|1448099_1448405_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032638782.1|1448588_1449332_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_077064587.1|1449388_1450477_-	oxidoreductase	NA	NA	NA	NA	NA
WP_077064583.1|1450635_1452138_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	9.9e-18
WP_032638787.1|1452134_1453130_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032638790.1|1453150_1454215_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032638792.1|1454298_1455540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080283032.1|1455653_1456808_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_032638794.1|1456892_1458092_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_032638796.1|1458196_1459213_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_032638798.1|1459255_1459726_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_032638800.1|1459951_1460887_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_149067757.1|1460991_1462146_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP043318	Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 chromosome, complete genome	5111427	3040756	3150298	5111427	tail,tRNA,protease,holin,portal,head,capsid,terminase,transposase,integrase,coat,lysis	Enterobacterial_phage(31.15%)	111	3043858:3043877	3138425:3138444
WP_032641320.1|3040756_3041728_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_032641322.1|3041932_3042676_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_032641324.1|3042754_3043315_-	VOC family protein	NA	NA	NA	NA	NA
WP_032641326.1|3043554_3045288_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	34.5	7.5e-86
3043858:3043877	attL	TCTGACCGTCTGGGCGTTTC	NA	NA	NA	NA
WP_032641328.1|3045364_3046504_-	glycosyl hydrolase family 88	NA	NA	NA	NA	NA
WP_032641330.1|3046508_3048092_-	MFS transporter	NA	NA	NA	NA	NA
WP_032641332.1|3048354_3048747_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_032641334.1|3048746_3050825_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_032641336.1|3050817_3051966_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_032642640.1|3052114_3052759_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_008500431.1|3052769_3053159_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.2	7.7e-07
WP_032641339.1|3053176_3054226_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	2.3e-05
WP_023312253.1|3054222_3055089_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_032641341.1|3055108_3056710_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	77.3	2.2e-07
WP_077064180.1|3056754_3058422_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.1	2.6e-11
WP_032641346.1|3058508_3059474_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_077064179.1|3059470_3061855_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_032641348.1|3061830_3062589_-	molecular chaperone	NA	NA	NA	NA	NA
WP_032641349.1|3062605_3063154_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032641350.1|3063166_3063739_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032641351.1|3064168_3065428_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_008500420.1|3065642_3066146_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_032641353.1|3066165_3068202_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_014884353.1|3068206_3069136_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_008500417.1|3069132_3070020_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_013096051.1|3070143_3070722_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_028018603.1|3070724_3071084_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_032641357.1|3071870_3072299_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_032641359.1|3072316_3073741_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_032641361.1|3073715_3074519_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_032641363.1|3074695_3075682_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_032641366.1|3075696_3077211_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	3.3e-13
WP_008500409.1|3077282_3078272_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_032641368.1|3079048_3079552_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_032641370.1|3079706_3081050_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_008500405.1|3081092_3081344_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_014884364.1|3081452_3081536_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_032641373.1|3081749_3082088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884366.1|3082292_3082790_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_032641376.1|3082983_3084195_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_032641378.1|3084227_3084896_-	YecA family protein	NA	NA	NA	NA	NA
WP_032641380.1|3085309_3086431_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032641382.1|3086530_3087445_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032641384.1|3087456_3088731_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_032641386.1|3088727_3089603_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.1	6.8e-11
WP_032641388.1|3089599_3090316_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	5.9e-13
WP_125371976.1|3090659_3090962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032642642.1|3091316_3092405_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_077064177.1|3094518_3094839_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	57.5	4.2e-27
WP_077064196.1|3094838_3095078_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	83.3	6.5e-33
WP_077064176.1|3095402_3095999_-|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	48.5	4.1e-52
WP_077064175.1|3095998_3096991_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	48.2	5.6e-70
WP_077064174.1|3097049_3097283_-	cor protein	NA	E4WL42	Enterobacteria_phage	87.0	5.8e-34
WP_077064173.1|3097394_3098069_-	hypothetical protein	NA	K7PGV3	Enterobacterial_phage	54.1	2.5e-61
WP_077064172.1|3098068_3098371_-	hypothetical protein	NA	K7P7E0	Enterobacteria_phage	74.0	5.5e-37
WP_077064171.1|3098370_3102168_-	DUF1983 domain-containing protein	NA	K7PHL5	Enterobacterial_phage	80.6	0.0e+00
WP_080500333.1|3102221_3102812_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.0	5.3e-76
WP_047174732.1|3102870_3103284_-	lipoprotein	NA	G8C7Q7	Escherichia_phage	64.2	1.4e-51
WP_077064170.1|3103313_3104024_-	peptidase P60	NA	K7PGV2	Enterobacterial_phage	96.6	4.6e-143
WP_077064169.1|3104025_3104784_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	97.6	1.2e-144
WP_048959837.1|3104780_3105119_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	72.3	3.3e-46
WP_077064168.1|3105118_3108445_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	67.7	0.0e+00
WP_075203025.1|3108444_3108660_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	67.6	5.0e-24
WP_048959839.1|3108683_3109046_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	54.3	6.2e-27
WP_048959840.1|3109110_3109563_-|tail	major tail shaft subunit	tail	Q7Y403	Yersinia_phage	77.4	2.4e-60
WP_063923370.1|3109595_3110000_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	72.7	2.2e-44
WP_063666303.1|3109996_3110386_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	62.8	3.2e-45
WP_077064167.1|3110366_3110711_-|head	phage head closure protein	head	Q7Y406	Yersinia_phage	54.5	8.5e-26
WP_077064166.1|3110707_3111034_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	89.8	2.3e-52
WP_167513839.1|3111033_3111303_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	76.2	1.8e-10
WP_077064165.1|3111344_3112556_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	84.0	4.7e-188
WP_077064164.1|3112565_3113414_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.1	1.8e-138
WP_077064163.1|3113427_3114732_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	92.9	1.7e-231
WP_077064162.1|3114731_3116468_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.1	0.0e+00
WP_077064161.1|3116467_3116941_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	5.0e-85
WP_077064160.1|3117097_3117448_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	76.7	2.1e-48
WP_077064158.1|3117760_3118351_-	hypothetical protein	NA	S4TR53	Salmonella_phage	80.9	7.4e-94
WP_085950818.1|3118432_3119553_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_131825688.1|3119741_3119960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167513850.1|3119936_3120095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077064566.1|3120107_3121565_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	89.7	4.0e-266
WP_077064565.1|3121697_3122048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077064563.1|3122921_3123104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077064562.1|3123131_3123602_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	58.5	5.2e-42
WP_077064561.1|3123598_3124039_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	78.5	1.2e-59
WP_077064560.1|3124135_3124417_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	91.4	9.1e-42
WP_077064559.1|3124403_3124799_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	4.5e-63
WP_077064558.1|3125312_3126092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077064557.1|3126243_3126822_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.2	4.8e-45
WP_077064556.1|3126835_3127825_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	95.7	1.0e-188
WP_077064555.1|3127821_3128211_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	97.7	4.1e-69
WP_077064554.1|3128207_3128528_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	83.0	2.2e-44
WP_077064553.1|3128524_3129451_-	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	89.5	6.0e-74
WP_077064552.1|3129407_3129620_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	3.9e-13
WP_077064551.1|3129860_3130331_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	90.4	5.2e-74
WP_074169863.1|3130356_3130581_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	56.1	1.4e-13
WP_077064550.1|3130688_3131348_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	63.5	9.8e-71
WP_131825687.1|3131735_3131969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077064567.1|3132740_3133154_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	89.1	9.8e-61
WP_077064547.1|3133153_3134188_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	95.3	3.7e-181
WP_077064546.1|3134174_3134723_+	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	49.3	1.0e-25
WP_080500351.1|3135080_3135974_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	63.3	1.5e-26
WP_077064545.1|3135966_3136269_+	RNA-binding protein	NA	A0A1B1W288	Salmonella_phage	69.3	1.4e-32
WP_016063584.1|3136638_3136866_+	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	100.0	3.4e-39
WP_077064543.1|3136865_3137876_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	91.7	5.2e-180
WP_077064542.1|3138340_3138625_+|transposase	transposase	transposase	NA	NA	NA	NA
3138425:3138444	attR	TCTGACCGTCTGGGCGTTTC	NA	NA	NA	NA
WP_077581086.1|3138621_3139476_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.5	2.7e-81
WP_077064541.1|3139696_3145432_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_047653977.1|3145618_3147661_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_047653976.1|3147653_3149108_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_120783684.1|3149129_3150298_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.4	6.2e-177
>prophage 6
NZ_CP043318	Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 chromosome, complete genome	5111427	3321049	3329816	5111427		Enterobacteria_phage(33.33%)	8	NA	NA
WP_032641604.1|3321049_3321928_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.7e-108
WP_032641606.1|3321980_3322880_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.9	3.7e-28
WP_032642665.1|3322879_3323965_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	4.8e-99
WP_077064121.1|3324067_3325954_-	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	28.6	8.9e-24
WP_032641611.1|3325992_3326553_-	sugar O-acyltransferase	NA	NA	NA	NA	NA
WP_032641613.1|3326545_3327589_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_032642667.1|3327588_3328533_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1D7XFE8	Escherichia_phage	28.9	7.1e-06
WP_032641615.1|3328919_3329816_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	2.0e-42
>prophage 7
NZ_CP043318	Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 chromosome, complete genome	5111427	4142548	4180716	5111427	integrase,capsid,transposase	Escherichia_phage(11.11%)	44	4142453:4142477	4180805:4180829
4142453:4142477	attL	TTGGAGCGGGCGAAGGGAATCGAAC	NA	NA	NA	NA
WP_077064444.1|4142548_4143730_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_065883812.1|4143758_4144037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077064443.1|4144371_4146240_-	hypothetical protein	NA	A0A1Q1N989	Escherichia_phage	32.4	3.5e-65
WP_077064442.1|4146232_4146433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077064441.1|4146573_4147611_-|capsid	major capsid protein E	capsid	NA	NA	NA	NA
WP_077064440.1|4147629_4148007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077064439.1|4148010_4148235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077064438.1|4148876_4149209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046883285.1|4149198_4149408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022649395.1|4149698_4150667_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	6.9e-182
WP_077064508.1|4151155_4151869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077064507.1|4151819_4151990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077064506.1|4152058_4152250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077064511.1|4154040_4154619_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	26.3	2.6e-11
WP_077064505.1|4154612_4154822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167513855.1|4154818_4154986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077064504.1|4155239_4155737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080283029.1|4155760_4156327_-	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	69.4	8.0e-05
WP_023294888.1|4156987_4158193_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_023294887.1|4158329_4159526_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_023294886.1|4159618_4160086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023294884.1|4160569_4160983_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023294883.1|4160982_4161336_+	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_023294880.1|4163109_4163268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084832169.1|4163264_4163501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023294878.1|4164484_4164691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023294877.1|4164876_4165227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023294876.1|4165507_4166065_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	39.2	8.7e-28
WP_032635620.1|4166241_4166598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023294875.1|4166600_4167143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023294874.1|4167246_4167393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032635618.1|4167531_4167912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023294871.1|4168856_4169633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023337724.1|4169753_4170479_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_131824837.1|4171390_4171849_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063137463.1|4171971_4172724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063137464.1|4172959_4174075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063137470.1|4174221_4174599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063137465.1|4174804_4175365_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.7	4.6e-21
WP_045405059.1|4175555_4176023_+	DUF1643 domain-containing protein	NA	A0A1V0EBT6	Caulobacter_phage	41.0	8.9e-26
WP_077064503.1|4176178_4177192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080500349.1|4177599_4177881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063137468.1|4177983_4178535_+	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	35.6	1.3e-20
WP_001549654.1|4178775_4180716_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.7	1.8e-11
4180805:4180829	attR	TTGGAGCGGGCGAAGGGAATCGAAC	NA	NA	NA	NA
>prophage 1
NZ_CP043319	Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 plasmid pLAP2_050004, complete sequence	106698	35454	42476	106698	integrase	Escherichia_phage(33.33%)	10	26167:26180	46950:46963
26167:26180	attL	CCCTCGATGCGGCA	NA	NA	NA	NA
WP_022650038.1|35454_36234_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	3.5e-51
WP_022650037.1|36332_36611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650036.1|36610_37249_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	44.9	5.8e-44
WP_022650035.1|37485_38457_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	2.2e-66
WP_022650034.1|38461_38851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650033.1|38854_40126_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	2.9e-156
WP_022650032.1|40125_40554_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.3e-28
WP_080332517.1|40684_40942_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_022650031.1|40919_41387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650030.1|41783_42476_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	36.7	5.7e-29
46950:46963	attR	CCCTCGATGCGGCA	NA	NA	NA	NA
