The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019458	Streptomyces autolyticus strain CGMCC0516 chromosome, complete genome	10029028	7062967	7072489	10029028	transposase	Planktothrix_phage(25.0%)	11	NA	NA
WP_079258895.1|7062967_7064026_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	3.8e-16
WP_069864393.1|7064018_7065176_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	7.9e-15
WP_069864391.1|7065298_7065658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079258896.1|7065872_7066301_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	60.6	4.4e-40
WP_079258897.1|7066324_7067485_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJA0	Virus_Rctr71	40.9	1.6e-68
WP_079258898.1|7067567_7068002_-	ATP-binding protein	NA	A0A1V0E640	Streptomyces_phage	36.0	1.6e-05
WP_079153000.1|7068134_7069019_+	helix-turn-helix transcriptional regulator	NA	I4AZQ1	Saccharomonospora_phage	27.0	1.6e-12
WP_069864385.1|7069029_7069230_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_141729878.1|7069245_7069539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079258900.1|7070337_7071375_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	7.5e-17
WP_079258901.1|7071367_7072489_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	6.5e-14
>prophage 2
NZ_CP019458	Streptomyces autolyticus strain CGMCC0516 chromosome, complete genome	10029028	9772197	9834249	10029028	protease,plate,tail,integrase	Staphylococcus_phage(30.0%)	55	9749455:9749474	9815288:9815307
9749455:9749474	attL	GGGCGATGTCGAACAGCGCG	NA	NA	NA	NA
WP_079260067.1|9772197_9774231_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_167746916.1|9774627_9776241_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	34.9	3.4e-64
WP_069860581.1|9776405_9776774_-	arsenate reductase family protein	NA	NA	NA	NA	NA
WP_069860582.1|9776896_9777202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069860583.1|9777578_9778058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087684350.1|9778155_9778719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079260069.1|9778789_9779542_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_079260070.1|9779618_9780554_-	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_069860587.1|9780550_9780919_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_079260071.1|9781078_9781609_+	TerD family protein	NA	NA	NA	NA	NA
WP_079260072.1|9781713_9782580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079152770.1|9782579_9783848_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_079260073.1|9784014_9786828_+	alpha/beta fold hydrolase	NA	A0A2H4PQG7	Staphylococcus_phage	33.8	5.7e-27
WP_079260074.1|9786824_9787679_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_079260075.1|9787741_9788926_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_167746865.1|9789602_9791942_+	glycosyltransferase	NA	A0A1V0S9E5	Catovirus	32.1	2.2e-32
WP_079260076.1|9791938_9793201_+	acyltransferase	NA	NA	NA	NA	NA
WP_079260077.1|9793366_9793960_+	extensin	NA	NA	NA	NA	NA
WP_079260078.1|9794000_9794888_-	lysozyme	NA	I3VYU7	Thermoanaerobacterium_phage	35.4	8.4e-17
WP_079260079.1|9794970_9795618_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079260080.1|9795628_9797791_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_079260081.1|9797787_9798789_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_079260082.1|9798785_9799379_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_069860600.1|9799430_9800582_+	XdhC family protein	NA	NA	NA	NA	NA
WP_079260083.1|9800660_9802004_+	MFS transporter	NA	NA	NA	NA	NA
WP_069860602.1|9802188_9803643_-	NADP-dependent phosphogluconate dehydrogenase	NA	E3SIC7	Synechococcus_phage	30.2	1.8e-32
WP_158525958.1|9804690_9805290_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079260085.1|9805398_9806892_+	MFS transporter	NA	NA	NA	NA	NA
WP_079260086.1|9806987_9807947_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.0	8.8e-28
WP_069860606.1|9807943_9808705_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_148666322.1|9808679_9809195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079260087.1|9809365_9809857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069860608.1|9810090_9810648_-	DoxX family protein	NA	NA	NA	NA	NA
WP_079260088.1|9810739_9812122_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	36.9	4.2e-31
WP_069860610.1|9812235_9812739_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_079260816.1|9812839_9813406_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_079260089.1|9813527_9817034_-	multidrug transporter	NA	NA	NA	NA	NA
9815288:9815307	attR	GGGCGATGTCGAACAGCGCG	NA	NA	NA	NA
WP_079260817.1|9817193_9817616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079260090.1|9817736_9818744_-	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_167746917.1|9818782_9820063_-	MFS transporter	NA	NA	NA	NA	NA
WP_079260092.1|9820201_9821635_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.0	3.8e-35
WP_079260093.1|9821631_9822849_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	27.7	3.4e-45
WP_079260094.1|9822956_9823715_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079260818.1|9823831_9824356_-	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_079260095.1|9824991_9825552_-|tail	phage tail protein I	tail	NA	NA	NA	NA
WP_079260096.1|9825553_9827542_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_079260097.1|9827538_9827946_-	GPW/gp25 family protein	NA	A0A1D8KJJ7	Synechococcus_phage	32.7	2.7e-10
WP_069860619.1|9827948_9828224_-	PaaR repeat-containing protein	NA	NA	NA	NA	NA
WP_079260098.1|9828346_9830266_-	VgrG-related protein	NA	NA	NA	NA	NA
WP_069860621.1|9830269_9831073_-	peptidase M23	NA	NA	NA	NA	NA
WP_069860622.1|9831076_9831508_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_079260099.1|9831533_9833228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087684351.1|9833234_9833378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079260100.1|9833374_9833806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069860626.1|9833805_9834249_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 3
NZ_CP019458	Streptomyces autolyticus strain CGMCC0516 chromosome, complete genome	10029028	9938955	10004444	10029028	protease,plate,tail	Tupanvirus(20.0%)	59	NA	NA
WP_079260158.1|9938955_9939468_-|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_079260159.1|9939464_9940817_-	Ni/Fe hydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_079260160.1|9940813_9941656_-	oxidoreductase	NA	NA	NA	NA	NA
WP_079260161.1|9941657_9942470_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_079260162.1|9942466_9942922_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_079260163.1|9942918_9944076_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_079260164.1|9944282_9944996_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	37.5	5.4e-06
WP_079260165.1|9945169_9945778_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079260825.1|9945898_9946690_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079260166.1|9946821_9948444_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_079260167.1|9948433_9949657_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1J0GVU2	Streptomyces_phage	45.1	4.0e-33
WP_069860701.1|9950047_9951013_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_079260168.1|9951009_9951765_-	ergothioneine biosynthesis protein EgtC	NA	NA	NA	NA	NA
WP_079260169.1|9951764_9953093_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_069860704.1|9953089_9954355_-	ergothioneine biosynthesis glutamate--cysteine ligase EgtA	NA	NA	NA	NA	NA
WP_079260170.1|9954598_9955603_+	NADPH:quinone oxidoreductase family protein	NA	NA	NA	NA	NA
WP_079260171.1|9955599_9956805_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_079260172.1|9956801_9957941_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_069860708.1|9958230_9958425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079260173.1|9958484_9959873_-	cyclic nucleotide-binding domain-containing protein	NA	A0A2K9L690	Tupanvirus	31.6	4.7e-22
WP_079260174.1|9959944_9961357_-	cyclic nucleotide-binding domain-containing protein	NA	A0A2K9L690	Tupanvirus	31.9	3.9e-24
WP_079260175.1|9961754_9962660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079260176.1|9962777_9963266_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079260177.1|9963246_9964512_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_079260178.1|9964642_9966100_-	xylulokinase	NA	NA	NA	NA	NA
WP_069860714.1|9966217_9967390_+	xylose isomerase	NA	NA	NA	NA	NA
WP_079260179.1|9967562_9968663_-	pectin esterase	NA	NA	NA	NA	NA
WP_087684488.1|9969124_9970366_-	SWF or SNF family helicase	NA	NA	NA	NA	NA
WP_079260181.1|9970494_9973416_-	DEAD/DEAH box helicase	NA	D4P754	Rhodococcus_phage	31.4	2.8e-40
WP_069860718.1|9973558_9973741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079260182.1|9974057_9974855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079260826.1|9975433_9976042_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_079260827.1|9976324_9976843_+	roadblock/LC7 domain-containing protein	NA	NA	NA	NA	NA
WP_069860720.1|9976811_9978005_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_069860721.1|9978058_9978487_-	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069860722.1|9978606_9979011_+	roadblock/LC7 domain-containing protein	NA	NA	NA	NA	NA
WP_079260183.1|9979109_9980090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079260184.1|9980118_9981009_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_069860725.1|9981070_9983599_-	DEAD/DEAH box helicase	NA	M1I6E2	Acanthocystis_turfacea_Chlorella_virus	34.0	1.1e-45
WP_069860726.1|9983735_9984527_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_079260185.1|9984571_9986353_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_079260186.1|9986349_9988296_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_087684354.1|9988483_9989188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069860729.1|9989286_9989727_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079260188.1|9989862_9991806_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.3	4.1e-40
WP_079260189.1|9991884_9992697_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_069860732.1|9992872_9993100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069860733.1|9993278_9993857_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_079260190.1|9993853_9994579_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_079260191.1|9994589_9996854_+|tail	phage tail protein	tail	J9PVC2	Bacillus_phage	31.6	1.4e-47
WP_069860736.1|9996873_9997329_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_079260192.1|9997330_9998824_+|tail	phage tail protein	tail	H6WFT7	Cyanophage	31.8	4.1e-16
WP_069860738.1|9998820_9999339_+|tail	phage tail protein	tail	T2KT02	uncultured_phage	37.8	1.4e-08
WP_079260193.1|9999335_9999527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069860740.1|9999526_10000198_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_079260194.1|10000208_10001390_+	phage late control D family protein	NA	NA	NA	NA	NA
WP_079260195.1|10001386_10002088_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_069860743.1|10002084_10002498_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_079260196.1|10002494_10004444_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
