The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	94152	166325	8920478	transposase,capsid,terminase	Bacillus_phage(14.29%)	54	NA	NA
WP_077022372.1|94152_95976_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_077028006.1|96370_97762_-	neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_077028007.1|97784_99332_-	arylsulfatase	NA	NA	NA	NA	NA
WP_077028008.1|100449_100920_+	DUF1579 domain-containing protein	NA	NA	NA	NA	NA
WP_077028009.1|101046_102168_+	DUF899 family protein	NA	NA	NA	NA	NA
WP_145943856.1|102215_102476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022375.1|102453_102864_+	VOC family protein	NA	NA	NA	NA	NA
WP_077022376.1|102947_103352_+	DoxX family protein	NA	NA	NA	NA	NA
WP_077022377.1|103348_103708_+	YciI family protein	NA	NA	NA	NA	NA
WP_158520813.1|103715_105098_+	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_077022378.1|111474_112119_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158520814.1|112355_112649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022379.1|112833_113358_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_077028011.1|113526_114003_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_077022380.1|114114_115599_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_099091771.1|115717_116353_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_077022381.1|116973_117321_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077022382.1|117354_117819_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_077022383.1|117863_118124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158520815.1|119424_119580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077028012.1|119975_120917_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_077022384.1|120921_121341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145943857.1|121432_122692_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_077022387.1|124109_125570_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083731700.1|125712_127110_+	PhoH family protein	NA	A0A223LDL5	Bacillus_phage	32.8	8.8e-53
WP_083732514.1|127392_128442_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SJA4	Synechococcus_phage	38.8	3.7e-56
WP_077022388.1|128501_129488_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_083731701.1|129484_130402_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_077022389.1|130414_131236_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.3	3.3e-15
WP_077022391.1|131576_131798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022392.1|132131_140831_+	choice-of-anchor D domain-containing protein	NA	NA	NA	NA	NA
WP_077022393.1|140980_141688_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_077022394.1|141899_143588_+	exosortase U	NA	NA	NA	NA	NA
WP_077022395.1|143584_145117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145943858.1|145215_145491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083731702.1|145657_146392_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_179954429.1|148123_149752_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_099091772.1|150027_150813_-	family 16 glycosylhydrolase	NA	NA	NA	NA	NA
WP_145943859.1|150843_151113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022399.1|151223_152993_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_077022400.1|152985_153570_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077022401.1|154388_155162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145943861.1|155209_155446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022403.1|155445_155775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022404.1|155771_158009_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_158520816.1|158632_158986_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_145943862.1|159001_159382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022408.1|159667_159886_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077022409.1|159885_161154_+|capsid	phage major capsid protein	capsid	D6PFE3	uncultured_phage	27.2	5.1e-07
WP_145943864.1|161166_161601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022411.1|161827_163627_+	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	25.1	5.5e-15
WP_077022413.1|164509_165190_+	DUF5131 family protein	NA	Q8W6R4	Burkholderia_virus	35.5	3.6e-36
WP_077022414.1|165222_166101_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	35.0	8.0e-36
WP_077022415.1|166097_166325_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	177666	247867	8920478	transposase,tRNA	Mycobacterium_phage(14.29%)	56	NA	NA
WP_077022414.1|177666_178545_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	35.0	8.0e-36
WP_077022415.1|178541_178769_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077022433.1|178909_179770_+	recombinase zinc beta ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_077022434.1|179857_181357_+	recombinase family protein	NA	A0A0K2CNN5	Brevibacillus_phage	19.5	2.5e-05
WP_077022436.1|181750_182710_-	NAD-dependent epimerase/dehydratase family protein	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	34.2	1.8e-36
WP_083731705.1|183150_185214_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_077022437.1|185693_185885_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	43.1	3.8e-07
WP_077022438.1|188103_188712_-	LUD domain-containing protein	NA	NA	NA	NA	NA
WP_077022439.1|188708_190088_-	lactate utilization protein	NA	NA	NA	NA	NA
WP_077022440.1|190089_190839_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_077022441.1|190951_192160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022442.1|192185_193271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083732515.1|193309_194464_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_077022444.1|196921_198010_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_077022445.1|198102_198486_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_077022446.1|198647_201506_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.5	1.2e-269
WP_077022447.1|201773_202751_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077022448.1|202989_203946_-	mitochondrial fission ELM1 family protein	NA	NA	NA	NA	NA
WP_083731706.1|203967_205962_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	3.9e-46
WP_077028020.1|206244_207033_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_077022450.1|207127_207874_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_077022451.1|207920_209207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077028021.1|209199_210333_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_077022452.1|210388_211054_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_077022453.1|211504_212224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022454.1|212334_213141_+	phosphotransferase	NA	NA	NA	NA	NA
WP_077022455.1|213354_213651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022456.1|213826_214591_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_077022457.1|214590_216522_-	fumarate reductase/succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_145943870.1|216592_217333_-	succinate dehydrogenase cytochrome b subunit	NA	NA	NA	NA	NA
WP_077022460.1|217749_218406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022462.1|219217_219841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083732516.1|219871_221116_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	51.8	2.0e-109
WP_077022464.1|221429_221810_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_077022465.1|222082_223282_+	YcaQ family DNA glycosylase	NA	NA	NA	NA	NA
WP_077022466.1|223443_224565_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_077022467.1|224797_225175_-	GxxExxY protein	NA	A0A0P0YNF4	Yellowstone_lake_phycodnavirus	35.5	1.1e-10
WP_158520817.1|225355_226729_-	MFS transporter	NA	NA	NA	NA	NA
WP_099091852.1|226721_227489_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_077022470.1|227654_228653_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	1.9e-17
WP_099091853.1|228784_231202_-|tRNA	class I tRNA ligase family protein	tRNA	A0A2I2L3Y0	Orpheovirus	25.6	9.2e-66
WP_077022472.1|232973_233384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022473.1|233834_235514_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	39.6	5.6e-86
WP_077022474.1|235630_236182_-	phosphopantothenoylcysteine decarboxylase	NA	A0A1V0S7W6	Shearwaterpox_virus	32.6	8.3e-15
WP_077022475.1|236280_236571_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_077022476.1|236563_237175_-	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	32.1	1.8e-18
WP_083731708.1|237167_238046_-	YicC family protein	NA	NA	NA	NA	NA
WP_077022479.1|238937_239711_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_077022480.1|239809_240652_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_077022481.1|240658_241696_-	ferredoxin	NA	NA	NA	NA	NA
WP_145943874.1|241827_243504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083731709.1|243508_244576_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_077022483.1|244694_245225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022484.1|245348_246101_+	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_145943876.1|246359_246599_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083732516.1|246622_247867_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	51.8	2.0e-109
>prophage 3
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	674698	731774	8920478	transposase,protease,tRNA	Klosneuvirus(20.0%)	53	NA	NA
WP_077022725.1|674698_675793_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_083731747.1|675794_676778_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_077022727.1|677166_678210_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077022728.1|678315_679257_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_077022729.1|679310_680681_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_077022730.1|681268_682315_+	nucleoside monophosphate kinase	NA	A0A1V0SK76	Klosneuvirus	30.2	1.7e-16
WP_158520832.1|682319_682466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022731.1|682579_683785_+	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_077022732.1|684026_685304_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077022733.1|685296_686115_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_083732529.1|686126_687392_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	28.7	3.4e-35
WP_099091860.1|687396_688449_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	24.5	3.7e-19
WP_083732530.1|688487_689234_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_077022735.1|689411_690293_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077022736.1|690334_691366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022737.1|691610_692498_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077022738.1|692494_692779_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077022740.1|693155_693575_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_077022741.1|693715_694537_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_145943924.1|694536_695034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022743.1|695050_696184_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_077022744.1|696231_697365_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_077022745.1|697623_698091_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_077022747.1|700413_701196_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_083731750.1|701385_702834_+	sulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	28.0	6.8e-32
WP_077022749.1|702964_703936_+	transaldolase	NA	E3SQJ7	Cyanophage	37.9	2.6e-11
WP_077022750.1|703984_705403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022751.1|705434_705617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022752.1|705638_705890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083731751.1|705886_706249_+|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_077022753.1|706286_707078_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_077022754.1|707209_707428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077028063.1|707610_708186_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_077022755.1|708496_709936_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_077022756.1|710027_711998_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_077022757.1|712005_712545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022758.1|712522_712939_-	rod-binding protein	NA	NA	NA	NA	NA
WP_083731752.1|712944_714090_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_077022759.1|714226_714868_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_077022760.1|714943_715975_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_077022761.1|715979_716780_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_158520834.1|716820_717570_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_145943926.1|717914_720125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022764.1|720201_721536_-	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_158520835.1|721540_723919_-	DUF1592 domain-containing protein	NA	NA	NA	NA	NA
WP_077022767.1|724762_725566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083731753.1|725578_726568_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_077022768.1|726602_727427_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_077022769.1|727644_728349_+	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_099091780.1|728327_729212_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077022770.1|729368_730391_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145943927.1|730909_731242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083731754.1|731465_731774_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	1065551	1107971	8920478	transposase,protease,integrase	uncultured_Caudovirales_phage(40.0%)	31	1104419:1104478	1107972:1108090
WP_077022985.1|1065551_1066301_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_077022986.1|1066302_1067292_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_158520845.1|1067465_1071545_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_077022988.1|1072069_1074310_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_077022989.1|1074465_1075365_+	DUF3473 domain-containing protein	NA	NA	NA	NA	NA
WP_077022990.1|1075361_1076588_+	TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase	NA	NA	NA	NA	NA
WP_077022991.1|1076584_1077955_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_077022992.1|1077974_1079594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022993.1|1079670_1080570_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_099091861.1|1080511_1082770_-	glycoside hydrolase family 2	NA	NA	NA	NA	NA
WP_077022995.1|1083233_1083956_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_083732532.1|1084035_1084929_-	lipase family protein	NA	A0A1B1IWX0	uncultured_Mediterranean_phage	46.9	2.2e-57
WP_077022997.1|1085176_1087162_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_077022998.1|1087174_1087648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145943959.1|1087843_1088611_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_077023001.1|1088838_1089807_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_077023002.1|1089846_1091310_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.4	1.2e-63
WP_077023004.1|1091582_1092956_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_077023005.1|1092997_1093711_+	creatininase family protein	NA	NA	NA	NA	NA
WP_077023006.1|1093777_1094776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023007.1|1095206_1095380_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_077028087.1|1096217_1098407_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_077028088.1|1098994_1099984_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.6	2.9e-50
WP_077023008.1|1100565_1101252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145943961.1|1101535_1101844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023010.1|1102177_1103395_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077023011.1|1103395_1104418_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	23.1	8.2e-08
1104419:1104478	attL	GAAATGGTCTCCCTGAAAGTGAAAGAAACAATCAGAAAGACATGGCACAAGATTTCACTA	NA	NA	NA	NA
WP_077023012.1|1104614_1104881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145943963.1|1104870_1105437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077023010.1|1105730_1106948_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077023011.1|1106948_1107971_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	23.1	8.2e-08
1107972:1108090	attR	GAAATGGTCTCCCTGAAAGTGAAAGAAACAATCAGAAAGACATGGCACAAGATTTCACTACATTCGCAAATCAGACTCCATTAGAAAATACCCCGCCGCGCAGCGGCTCACTTGAACAA	NA	NA	NA	NA
>prophage 5
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	1162700	1208283	8920478	transposase,tail	Moraxella_phage(25.0%)	34	NA	NA
WP_077022387.1|1162700_1164161_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077023055.1|1164488_1166237_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_077023056.1|1166233_1166881_-	YfiR family protein	NA	NA	NA	NA	NA
WP_083731791.1|1166983_1169047_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_077023058.1|1169955_1171137_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_077023059.1|1171195_1173475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077023060.1|1173476_1174775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099091862.1|1174801_1175851_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_077023062.1|1175984_1177013_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_077023063.1|1177061_1178411_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	25.9	1.7e-21
WP_145943979.1|1178510_1178780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077023065.1|1179086_1179824_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077023066.1|1179820_1180723_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_083731792.1|1180719_1180857_-	universal stress protein	NA	NA	NA	NA	NA
WP_145943980.1|1180853_1181171_-	universal stress protein	NA	NA	NA	NA	NA
WP_077023068.1|1181384_1182818_+	sulfatase	NA	NA	NA	NA	NA
WP_077023069.1|1182954_1183590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145943981.1|1183724_1184057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077023071.1|1184044_1184977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077023072.1|1185063_1185294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083732534.1|1186579_1188076_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	27.5	6.2e-12
WP_077023074.1|1188747_1188975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023075.1|1189137_1189851_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077028094.1|1190200_1191139_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	36.3	2.6e-32
WP_077023077.1|1191913_1192981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077028095.1|1193188_1196653_+	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_077023078.1|1196679_1197735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077023079.1|1197794_1199117_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_083731794.1|1199116_1200538_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_158520847.1|1200534_1202319_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_077023080.1|1202440_1203430_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_077023081.1|1203595_1205056_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077022615.1|1205510_1206740_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_077023082.1|1206687_1208283_-|tail	phage tail tape measure protein	tail	D9ZNE6	Clostridium_phage	31.9	1.4e-38
>prophage 6
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	1479141	1516782	8920478	transposase,integrase	Lactobacillus_phage(100.0%)	24	1499176:1499189	1518753:1518766
WP_077022415.1|1479141_1479369_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145944525.1|1479506_1479806_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_077022387.1|1480261_1481722_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145944002.1|1482315_1482786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023272.1|1482836_1483778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023273.1|1485076_1486111_+	amidohydrolase	NA	NA	NA	NA	NA
WP_077023274.1|1486112_1488800_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_077023275.1|1488904_1489777_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077023276.1|1489773_1491216_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_077023277.1|1491193_1494367_-	PSD1 domain-containing protein	NA	NA	NA	NA	NA
WP_077023279.1|1495147_1497358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023280.1|1497525_1498449_+	terpene cyclase/mutase family protein	NA	NA	NA	NA	NA
WP_077023281.1|1498686_1500396_-	GH3 auxin-responsive promoter family protein	NA	NA	NA	NA	NA
1499176:1499189	attL	GCGGACGACGTCGA	NA	NA	NA	NA
WP_077023282.1|1500507_1502910_-	CehA/McbA family metallohydrolase	NA	NA	NA	NA	NA
WP_077028130.1|1503376_1503730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022414.1|1504282_1505161_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	35.0	8.0e-36
WP_077022415.1|1505157_1505385_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077023283.1|1505533_1506190_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077023285.1|1506870_1507452_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_077022615.1|1507458_1508688_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_083731826.1|1508698_1510363_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_145944003.1|1513775_1514231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158520860.1|1514670_1514943_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_083731829.1|1515552_1516782_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1518753:1518766	attR	TCGACGTCGTCCGC	NA	NA	NA	NA
>prophage 7
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	1521856	1585422	8920478	transposase,integrase	Enterobacteria_phage(25.0%)	54	1543661:1543720	1581054:1581164
WP_077022421.1|1521856_1523029_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_077023293.1|1523277_1524447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145944004.1|1524853_1525087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077028133.1|1525140_1526862_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_077023295.1|1527063_1527432_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_077023296.1|1527431_1527827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023297.1|1527881_1528082_-	response regulator	NA	NA	NA	NA	NA
WP_145944005.1|1528082_1529003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022387.1|1528995_1530456_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158520861.1|1530496_1531039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023300.1|1531240_1531993_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.0	2.7e-40
WP_077023302.1|1533576_1535238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022387.1|1535270_1536731_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077023303.1|1536983_1538213_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_077023305.1|1539583_1540462_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	35.0	8.0e-36
WP_077022415.1|1540458_1540686_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077023307.1|1542067_1543660_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1543661:1543720	attL	GGAAGGCCTCCCCGATACCGATTTCGGTAACTCTTGGTTGAGGCAACCACTCTACGAAAG	NA	NA	NA	NA
WP_077023308.1|1543758_1543956_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158520863.1|1544596_1546171_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_077023312.1|1546744_1549006_-	FUSC family protein	NA	NA	NA	NA	NA
WP_145944007.1|1549044_1550175_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_083731835.1|1550584_1550806_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_077023314.1|1551245_1551848_+	TolC family protein	NA	NA	NA	NA	NA
WP_077023315.1|1551891_1552347_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_077023316.1|1552395_1553256_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077023317.1|1553286_1555011_-	amidohydrolase	NA	NA	NA	NA	NA
WP_077023318.1|1555210_1555525_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_179954431.1|1555638_1555827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023320.1|1556263_1557067_-	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
WP_077023321.1|1557204_1557804_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_077022615.1|1557865_1559095_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_077023322.1|1559237_1559849_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_077023323.1|1559902_1562296_-	fatty acid cis/trans isomerase	NA	NA	NA	NA	NA
WP_158520865.1|1562650_1564030_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_179954432.1|1564339_1564480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023325.1|1564526_1564937_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_145944004.1|1565057_1565291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077028133.1|1565344_1567066_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_077023295.1|1567267_1567636_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_077023296.1|1567635_1568031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023326.1|1568085_1568277_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1P8CWQ3	Bacillus_phage	47.4	2.2e-07
WP_083731840.1|1568772_1571133_-	arylsulfatase	NA	NA	NA	NA	NA
WP_077028136.1|1571804_1573166_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_077023330.1|1573340_1573826_-	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
WP_077023331.1|1573910_1574651_-	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_077023332.1|1574762_1577156_-	CoA transferase	NA	NA	NA	NA	NA
WP_077023333.1|1577222_1578119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023334.1|1578140_1579067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023307.1|1579460_1581053_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077023335.1|1581195_1582281_+	hypothetical protein	NA	A0A220A398	Liberibacter_phage	31.5	1.2e-20
1581054:1581164	attR	GGAAGGCCTCCCCGATACCGATTTCGGTAACTCTTGGTTGAGGCAACCACTCTACGAAAGTAGCGCTTTCAGTGACGCAGCGCGAACCGAACGACTAATTGTCGCCGAACA	NA	NA	NA	NA
WP_077023336.1|1582732_1583026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145944008.1|1583031_1583907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145944009.1|1584126_1584393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023339.1|1585083_1585422_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	1795485	1867981	8920478	transposase,protease,integrase	Planktothrix_phage(40.0%)	58	1866185:1866199	1871055:1871069
WP_077023449.1|1795485_1795989_-|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_077023450.1|1795985_1797347_-	Ni/Fe hydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_077028148.1|1797343_1798135_-	oxidoreductase	NA	NA	NA	NA	NA
WP_077023451.1|1798215_1799070_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_083731860.1|1799066_1800248_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_077028150.1|1800240_1800747_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077023452.1|1801080_1801503_+	universal stress protein	NA	NA	NA	NA	NA
WP_077023453.1|1801510_1802425_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_077023454.1|1802480_1806053_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_077023455.1|1806132_1807143_+	dihydroorotate dehydrogenase-like protein	NA	NA	NA	NA	NA
WP_077023456.1|1807263_1807845_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_083732549.1|1807870_1808221_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077028152.1|1808393_1809062_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_077023457.1|1809109_1809970_+	pirin family protein	NA	NA	NA	NA	NA
WP_077023458.1|1810225_1811368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077023459.1|1811509_1813096_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_077023460.1|1813846_1814242_-	response regulator	NA	NA	NA	NA	NA
WP_077023461.1|1814680_1815085_+	DUF4332 domain-containing protein	NA	NA	NA	NA	NA
WP_077023462.1|1815081_1816812_-	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_077022387.1|1817764_1819225_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145944018.1|1819353_1819623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145944019.1|1819824_1823100_+	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_077023465.1|1823103_1824138_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_077023466.1|1824137_1825025_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_083731863.1|1825027_1826164_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_077023467.1|1826160_1826559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023468.1|1826555_1827113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023469.1|1827109_1827520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023470.1|1827506_1828580_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_077023471.1|1828691_1830071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023472.1|1830195_1831257_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_077023473.1|1831535_1832786_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_077023474.1|1832792_1833239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158520879.1|1833307_1833937_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077023476.1|1834168_1835173_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_077023477.1|1835601_1836834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077023478.1|1836858_1837557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077023479.1|1837566_1839651_-	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_077028155.1|1839647_1840193_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077023480.1|1840239_1841577_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_077023481.1|1841686_1843351_-	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_077023482.1|1843617_1845012_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_077023483.1|1845015_1845708_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	2.7e-26
WP_077023485.1|1846500_1849308_+	TolC family protein	NA	NA	NA	NA	NA
WP_077023486.1|1849308_1851423_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_077023487.1|1851552_1852284_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	2.2e-31
WP_077023488.1|1852331_1853672_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_083732550.1|1853871_1854168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158520881.1|1854357_1855947_+	cyanophycinase	NA	NA	NA	NA	NA
WP_077023490.1|1856028_1857663_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_077028157.1|1857765_1859796_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158520883.1|1860209_1860455_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_077028158.1|1861229_1862492_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.3	8.0e-37
WP_083732534.1|1862673_1864170_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	27.5	6.2e-12
WP_077023493.1|1865463_1865727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023494.1|1865723_1866329_-|transposase	transposase	transposase	NA	NA	NA	NA
1866185:1866199	attL	GAGCCAGATACTTCA	NA	NA	NA	NA
WP_077023495.1|1866353_1867112_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_083732551.1|1867045_1867981_-|integrase	site-specific integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	29.7	1.5e-24
1871055:1871069	attR	TGAAGTATCTGGCTC	NA	NA	NA	NA
>prophage 9
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	2037754	2052369	8920478	transposase,integrase	Virus_Rctr41k(33.33%)	12	2022741:2022800	2044783:2046721
2022741:2022800	attL	ATCACTTTGGCTGTATCGCAATCAGGTCAGTCAGCTTCGAAGGAGATGCCAGGGGAAAGC	NA	NA	NA	NA
WP_077023619.1|2037754_2039578_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_077023493.1|2039801_2040065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023494.1|2040061_2040667_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077023495.1|2040691_2041450_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_083732551.1|2041383_2042319_-|integrase	site-specific integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	29.7	1.5e-24
WP_077028158.1|2043339_2044602_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.3	8.0e-37
WP_083732534.1|2044783_2046280_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	27.5	6.2e-12
WP_145943985.1|2047381_2047561_+	hypothetical protein	NA	NA	NA	NA	NA
2044783:2046721	attR	ATCACTTTGGCTGTATCGCAATCAGGTCAGTCAGCTTCGAAGGAGATGCCAGGGGAAAGCGAGCTATGTACGCATCGAACTGAGGCCAGGTCTTTGACTTCCTCTGCGAACGACGATTGAGCCAGCGGAAGGCCAGCTGCTTTGCTGCCTGGCGGAATTTCATCAGTTGGGACCAATTGTCATTGATTCCATAGTACTGATAATGGCCACGCAGCTTCGCATTCAACTTCGCCCAGACTTCGGACAAAGGTGTCGTCAGATTCCGTCGGAACCAATGCTTCAGATCGCCTACCTTAGCTCGGTATTTCTTACTGGCTGTCTTCCGTTTCGGCTTGAACTTTCCCGCACGACTCAGGCCGCAGTAATGAGTGAAGCCGAGGAAGTCGAACGTCGCGGGAGCCCCTTCGCCAAGACGCTGGCAATCGCGTCTCGCAAAGCGGCCGAACCGCAGCAGTTTAGTCTTCTCTTCGGCCAGCTCCAGCGAGTATCGGGCCAGTCGCTTCGGTAGCACATCCTGAAAGCGTCTCGCGTCAGACTCCAGTTCGAACGCACAAATGAAGTCGTCCGCGAAGCGGACAATGTACGATTCACCTCGCATACGCGGCTGCACATCCCGGTCGAACCATTGGTCCAGGACGTAATGCAAATACACGTTCGCTAATAACGGTGAAAGAACCGAGCCTTGCGGAACACCTTCGTCAGTGTTACGGCGACGACCTTCGATCATCACACCGGACTTCAGAAAGCGCTGGATCAGGGCCAATAGCTTCGGATCGGAAATCCGCTTTTGTAGCAGTTCGAGCAAACGTTCATGACAAACGTTATCGAAGAAGCCACGGATATCCGCGTCCGAAATCCAGCTCACTTTCCGGGTCGCGATGGTTTGACCGTGCACACTTAAAGCCTGGTGGCATGACCGTCCCGGACGGAAACCATAGGAAGTCTCACAGAAGTCGACTTCGTAGATCCGTTCCAGAATCATCACGACCGCACGTTGTACGATCTTGTCTTCCACACTGGCGATACCCAGCGGTCTGGTCTTGCCATTCCCTTTCGGAATGTCACGACGAAGACTGGGCTGAGGCCGATACGCACCACGGTGTAATCTGGTTAACAGGTCGTGCAGGTTGTCCCGCAGATTCGACTCGTATTGATCCACCGTGACACCGTCGACTCCGGGTGCCTTGCCTCGCTTGAGCTTGCGAAACGCATACCACAGCAACTCGTAATTGAGCAGCGAAAAGAGGTTGTTAAACGCCTCTTCAGAGTACGTTTCCGCGCGTTGGGTGATGCGATCCAGTCGATCAAGCACCGGTGATCCGCCACTGAGTGCGGTCGGTGTATCGCTGGAGTCGCGTGATGGCCTGGCGGCCTTCCCTGCACCCGCATTACCGGGCTTCAATTCACGCGATTGGTCTTCGCGCTTCAACGGTACTATGCCGCCATCCGACTTCCCAGAGTCGTCTGCACTCCTTGCCTTTTCAGCTTGTACGTGCATACTCGTTTCGTCGTGATTGGACGTCACGTCGAACAAGAACAGCTGGGATCTCACTGGTTGCTTCATTGGCATCATGTGTAGCGCGATCGTGGCCTTCGACCCCGGGTCTCCGAGCTTCGCTCGCCAAAACGCGAAACTCAGTGTTGCCTTTAGCAGGTCCGAATGCCTGGGCAGATACCGAGAAAACATGCATTTCGGGGCTCAATACCATTCACGGTTTGGGCGGCCAGCCCAGTCCATTCGTCCTCACTACCTTTCTGTGTACGCTTCAACGCAACTGTTACCAGTGACGCTGCAACACTCGATACCGGGCCTCAGGCTAAGAGTTACCCGGACGGGATTCGCACCCGCTTGTCAATAAACCATTTCCAGTTCGCTCCGGACCCGCATGTCAGGTGGTGTGGGGAGGGTCACCGGAAACGGTGGCTCTTACCCGATTTC	NA	NA	NA	NA
WP_077023621.1|2047553_2049647_+	recombinase family protein	NA	NA	NA	NA	NA
WP_083731883.1|2050441_2050660_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077023623.1|2050930_2051245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145944040.1|2051157_2052369_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	2527553	2582173	8920478	transposase,protease,plate	Mollivirus(33.33%)	35	NA	NA
WP_083731928.1|2527553_2528972_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_077023947.1|2529050_2531270_-	serine/threonine protein kinase	NA	A0A0M3SGV8	Mollivirus	27.4	4.7e-16
WP_077023948.1|2531273_2531852_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077023949.1|2532079_2533279_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_077023950.1|2533371_2535837_+	BatA domain-containing protein	NA	NA	NA	NA	NA
WP_077028200.1|2536364_2537555_+	HRDC domain-containing protein	NA	NA	NA	NA	NA
WP_077023951.1|2537635_2540965_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_077023952.1|2541013_2542081_-	squalene--hopene cyclase	NA	NA	NA	NA	NA
WP_077023953.1|2542315_2545597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023954.1|2546071_2547610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077023955.1|2547834_2548863_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_077023956.1|2548977_2549871_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_077023958.1|2550419_2551832_+	MFS transporter	NA	NA	NA	NA	NA
WP_077023959.1|2551828_2552488_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_077023960.1|2552511_2553927_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_077023961.1|2554227_2554620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077023962.1|2554616_2555285_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077023963.1|2555363_2556488_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_077023964.1|2556627_2557167_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_077023965.1|2557166_2558657_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_158520924.1|2558871_2560482_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_077023966.1|2560494_2561292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077023967.1|2561425_2561911_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_077023968.1|2561918_2563769_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_077023969.1|2563732_2564848_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_077023970.1|2565088_2567872_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.3	6.4e-79
WP_077028202.1|2568249_2568834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023971.1|2569395_2571126_+	GntP family permease	NA	NA	NA	NA	NA
WP_077023972.1|2571154_2572204_-	ThuA domain-containing protein	NA	NA	NA	NA	NA
WP_077023973.1|2572556_2573486_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	5.3e-14
WP_077023974.1|2573482_2575891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077023975.1|2576177_2577569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077023976.1|2577993_2579643_+	terpene cyclase/mutase family protein	NA	NA	NA	NA	NA
WP_077023977.1|2580503_2580806_-	hydrolase	NA	NA	NA	NA	NA
WP_158520925.1|2581036_2582173_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	2999470	3080757	8920478	protease,transposase,tRNA	Planktothrix_phage(25.0%)	55	NA	NA
WP_077024245.1|2999470_3000970_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_077024246.1|3001389_3003093_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_145944111.1|3003357_3005178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024248.1|3005277_3006987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024249.1|3006991_3009856_+	Hsp70 family protein	NA	A0A1V0SG59	Hokovirus	36.6	6.7e-07
WP_077024250.1|3010236_3011412_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_169929140.1|3011625_3012459_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_077024252.1|3012864_3013377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024253.1|3013405_3014956_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_077024254.1|3015144_3016251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024255.1|3016470_3017493_-	EF-P lysine aminoacylase GenX	NA	NA	NA	NA	NA
WP_077028240.1|3017489_3018797_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_077024256.1|3018802_3019786_-	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_083731973.1|3019913_3021245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024257.1|3021734_3022811_+	zinc-binding dehydrogenase	NA	A0A2K9V7Y5	Bandra_megavirus	27.8	4.6e-09
WP_179954437.1|3022877_3023786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024260.1|3024178_3026068_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	26.6	2.2e-43
WP_077024262.1|3026570_3030179_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_077024263.1|3030191_3030419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024264.1|3030421_3033736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024265.1|3033976_3034768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024266.1|3034783_3035794_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077024267.1|3036075_3037059_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	1.4e-17
WP_077024268.1|3037062_3038097_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	3.2e-15
WP_077024269.1|3038100_3039357_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077024270.1|3039353_3040370_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077024271.1|3040503_3042516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024272.1|3042922_3046288_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_077028242.1|3046488_3048213_-	L-lactate permease	NA	NA	NA	NA	NA
WP_077024273.1|3048748_3049219_-	universal stress protein	NA	NA	NA	NA	NA
WP_077024274.1|3049579_3049996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077028243.1|3050036_3050774_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	2.9e-15
WP_158520948.1|3050827_3051778_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077024275.1|3052135_3053140_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_077024276.1|3053152_3053968_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_077028245.1|3054323_3055103_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_083731975.1|3055531_3055927_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_077028247.1|3056495_3058538_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5ESM9	Bathycoccus_sp._RCC1105_virus	41.2	8.8e-102
WP_145944112.1|3060037_3060361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024280.1|3060401_3061523_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_077024281.1|3062593_3063055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024283.1|3063225_3063786_+	exonuclease domain-containing protein	NA	A0A1L3KJK8	Beihai_sea_slater_virus	31.1	1.7e-15
WP_077024284.1|3064563_3065112_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_077024285.1|3065775_3065961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083731976.1|3066881_3068651_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_077024288.1|3068672_3069299_+	CRTAC1 family protein	NA	NA	NA	NA	NA
WP_077024289.1|3069298_3070591_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077024290.1|3070587_3072390_+	CRTAC1 family protein	NA	NA	NA	NA	NA
WP_077024292.1|3073182_3074154_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145944114.1|3074171_3075371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158520949.1|3075406_3076999_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_145944116.1|3077312_3078035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024296.1|3078292_3079219_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_083731883.1|3079654_3079873_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145944117.1|3079869_3080757_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	3379949	3534558	8920478	transposase,integrase	Kaumoebavirus(10.0%)	109	3458382:3458396	3534905:3534926
WP_077024479.1|3379949_3381179_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_077024480.1|3381205_3382924_-	DUF1587 domain-containing protein	NA	NA	NA	NA	NA
WP_083732006.1|3382920_3384381_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_158520962.1|3384467_3387533_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_077024483.1|3387604_3389062_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_077024484.1|3389249_3392003_-	PSD1 domain-containing protein	NA	NA	NA	NA	NA
WP_077024485.1|3391999_3392701_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077024487.1|3393465_3394449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024488.1|3394578_3395829_+	PQQ-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_077024489.1|3396059_3396848_-	Fpg/Nei family DNA glycosylase	NA	A0A1V0CNR6	Kaumoebavirus	23.0	2.2e-08
WP_083732007.1|3397054_3398026_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_077024490.1|3398126_3399014_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_158520963.1|3399091_3399946_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_083732009.1|3400361_3402227_-	sulfatase	NA	NA	NA	NA	NA
WP_169929122.1|3402201_3402345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083732010.1|3402694_3403285_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_077024493.1|3403288_3404206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083732011.1|3404389_3406276_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_077024494.1|3406443_3406758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024495.1|3406947_3408069_+	muconate cycloisomerase	NA	Q6A202	Oenococcus_phage	24.9	1.0e-19
WP_077024496.1|3408193_3410467_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_158520964.1|3411041_3413111_+	DUF1583 domain-containing protein	NA	NA	NA	NA	NA
WP_077024498.1|3413208_3416625_+	DUF1583 domain-containing protein	NA	NA	NA	NA	NA
WP_158520965.1|3416731_3420190_+	DUF1583 domain-containing protein	NA	NA	NA	NA	NA
WP_077024500.1|3420224_3420716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083732013.1|3420740_3424088_-	DUF1583 domain-containing protein	NA	NA	NA	NA	NA
WP_083732014.1|3424281_3427647_-	DUF1583 domain-containing protein	NA	NA	NA	NA	NA
WP_158520966.1|3428267_3428942_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_083732570.1|3429749_3431576_+	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_077024504.1|3431586_3432918_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_077024505.1|3432914_3434651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083732016.1|3434647_3435733_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_077028278.1|3435831_3436797_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_077024506.1|3436845_3439239_+	BatA domain-containing protein	NA	NA	NA	NA	NA
WP_077024507.1|3439372_3442225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083732017.1|3442367_3447068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099091880.1|3447198_3448278_+	terpene cyclase/mutase family protein	NA	NA	NA	NA	NA
WP_077024509.1|3448419_3448962_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_077024510.1|3449037_3449499_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_099091799.1|3449891_3450884_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077024511.1|3451117_3451705_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077024512.1|3452031_3452475_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077024513.1|3452532_3452877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024514.1|3453022_3453688_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_077024515.1|3453832_3456349_+	serine/threonine protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	29.3	6.7e-19
WP_077022466.1|3456461_3457583_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_077023010.1|3457968_3459186_-|transposase	transposase	transposase	NA	NA	NA	NA
3458382:3458396	attL	GAGCCAGATACTTCA	NA	NA	NA	NA
WP_077023497.1|3459186_3460209_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	23.1	6.3e-08
3458382:3458396	attL	GAGCCAGATACTTCA	NA	NA	NA	NA
WP_145944020.1|3460561_3461098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083732551.1|3461469_3462405_+|integrase	site-specific integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	29.7	1.5e-24
WP_077023495.1|3462338_3463097_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_077023494.1|3463121_3463727_+|transposase	transposase	transposase	NA	NA	NA	NA
3463252:3463266	attR	TGAAGTATCTGGCTC	NA	NA	NA	NA
WP_077023493.1|3463723_3463987_+	hypothetical protein	NA	NA	NA	NA	NA
3463252:3463266	attR	TGAAGTATCTGGCTC	NA	NA	NA	NA
WP_077024516.1|3464091_3465267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024517.1|3465511_3465925_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_077024518.1|3466099_3466531_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_077024519.1|3466818_3467661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083732019.1|3468439_3469738_+	glucose-1-phosphate adenylyltransferase	NA	H9NC64	Sphingomonas_phage	23.0	1.8e-07
WP_158520967.1|3469814_3470597_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_077024522.1|3470644_3471856_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_077024523.1|3471891_3473628_-	alpha-amylase	NA	NA	NA	NA	NA
WP_077024524.1|3474345_3474903_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145944530.1|3475116_3475209_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077024525.1|3475354_3475624_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077024526.1|3475982_3477083_+	alpha/beta hydrolase fold domain-containing protein	NA	A0A076YS55	Mycobacterium_phage	30.7	6.8e-16
WP_077024527.1|3477272_3478703_-	DUF1593 domain-containing protein	NA	NA	NA	NA	NA
WP_077024528.1|3478769_3480011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024529.1|3480261_3481536_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_077024530.1|3481829_3482150_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_077024531.1|3482223_3482628_-	DUF3859 domain-containing protein	NA	NA	NA	NA	NA
WP_077024532.1|3482690_3484223_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	30.7	2.2e-28
WP_145944145.1|3484446_3484917_+	globin	NA	NA	NA	NA	NA
WP_077024534.1|3485152_3485491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022387.1|3485851_3487312_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145944146.1|3487380_3488781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024537.1|3489197_3489419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024538.1|3489415_3489835_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_077024540.1|3490666_3490924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145944147.1|3491407_3491749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145944148.1|3492062_3492296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024543.1|3492515_3494048_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077024544.1|3494230_3494527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024545.1|3494578_3497035_-	DUF4838 domain-containing protein	NA	NA	NA	NA	NA
WP_077028281.1|3497163_3497850_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_158520968.1|3499418_3499613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158520969.1|3500498_3501635_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077024548.1|3501859_3502213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024549.1|3502677_3503448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024550.1|3503495_3504434_-	ribokinase	NA	NA	NA	NA	NA
WP_077024551.1|3504430_3505468_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_077028282.1|3505469_3506426_-	MoxR family ATPase	NA	A0A1C9EG61	Acidianus_two-tailed_virus	28.1	2.6e-08
WP_077024552.1|3506644_3507892_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_083732022.1|3508183_3508777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024553.1|3508970_3509429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024554.1|3509471_3511079_-	NADH-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
WP_077024555.1|3511146_3512772_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_077024556.1|3512855_3515303_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_077024557.1|3515426_3515735_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_077024558.1|3515764_3516346_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_077024559.1|3516345_3517740_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_145944150.1|3518270_3519446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024561.1|3519712_3520147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077028284.1|3520262_3521366_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_077024562.1|3521679_3523398_-	serine/threonine protein kinase	NA	B5LWE2	Feldmannia_species_virus	26.7	8.4e-21
WP_077024563.1|3523709_3525299_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158520970.1|3525709_3527260_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_077022387.1|3527632_3529093_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077024567.1|3532144_3532723_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077024568.1|3532740_3534558_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
3534905:3534926	attR	GGCGGTGCAGAATCCGGTGCAG	NA	NA	NA	NA
>prophage 13
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	3715470	3908046	8920478	transposase,tail,integrase	uncultured_Mediterranean_phage(22.73%)	111	3803653:3803671	3873684:3873702
WP_077023619.1|3715470_3717294_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_077024661.1|3717735_3718740_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_077024662.1|3718936_3720250_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_083732040.1|3720319_3720475_-	Rdx family protein	NA	NA	NA	NA	NA
WP_077024663.1|3720799_3721270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099091803.1|3721946_3723248_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_077024665.1|3723332_3725246_-	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_077024666.1|3725484_3726051_+	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.4	8.6e-15
WP_083732042.1|3726050_3728498_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_099091882.1|3728545_3730051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024668.1|3730057_3730954_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_083732043.1|3730950_3732369_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_158520978.1|3732499_3733444_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_083732044.1|3733807_3735235_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	25.2	5.5e-18
WP_077024670.1|3735250_3736711_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_145944163.1|3737221_3738958_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_077024672.1|3738993_3739698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024673.1|3739715_3740390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024674.1|3740422_3743041_-	ATP-dependent chaperone ClpB	NA	A0A1S6UBG5	Serratia_phage	36.9	2.9e-126
WP_077024675.1|3743230_3745135_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	50.6	7.8e-145
WP_077028305.1|3745642_3746821_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_077024676.1|3746916_3747957_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_158520979.1|3748128_3748296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024677.1|3748302_3751161_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_077024678.1|3751157_3754406_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_077028306.1|3754398_3755694_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_077024679.1|3756077_3756272_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	45.1	1.4e-06
WP_077024680.1|3756541_3756856_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_077024681.1|3757195_3757840_+	RsmD family RNA methyltransferase	NA	NA	NA	NA	NA
WP_077024682.1|3757913_3759827_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	30.7	5.4e-85
WP_077028307.1|3760026_3761433_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_077024683.1|3761643_3763065_+	neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_083732045.1|3763077_3764469_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	25.7	2.1e-22
WP_077028309.1|3764481_3765873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024684.1|3766198_3767062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024685.1|3767197_3769897_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_077024686.1|3770245_3771700_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_077024687.1|3771725_3772520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024688.1|3772516_3773473_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.9	1.7e-18
WP_145944164.1|3773486_3774467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024690.1|3774453_3775404_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	2.2e-23
WP_077024691.1|3775494_3776430_-	histone deacetylase	NA	NA	NA	NA	NA
WP_077022421.1|3777141_3778314_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_077024694.1|3779957_3780944_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.3	1.8e-07
WP_077024695.1|3781171_3781807_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077024696.1|3782089_3784501_+	serine/threonine protein kinase	NA	G5CT46	Megavirus	27.2	1.3e-16
WP_077024697.1|3784490_3785582_-	cadherin-like domain-containing protein	NA	S0A226	Cellulophaga_phage	27.7	1.4e-10
WP_077024698.1|3786302_3786716_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	32.0	1.1e-06
WP_158520980.1|3787043_3787502_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_145944167.1|3787566_3788286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083732048.1|3788364_3789624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024702.1|3789591_3790134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158520981.1|3790844_3792059_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_077024705.1|3792519_3792924_+|tail	lamin tail domain-containing protein	tail	NA	NA	NA	NA
WP_158520982.1|3793179_3809379_+	hypothetical protein	NA	NA	NA	NA	NA
3803653:3803671	attL	GGTGTCGATGACACCATCG	NA	NA	NA	NA
WP_077022615.1|3809507_3810737_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_077024707.1|3810790_3815602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022414.1|3815835_3816714_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	35.0	8.0e-36
WP_077022415.1|3816710_3816938_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077024708.1|3817075_3817879_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_077022466.1|3818481_3819603_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_077024710.1|3819604_3820366_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_145944170.1|3820628_3821927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077028310.1|3822186_3822450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145944171.1|3822483_3822813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024713.1|3822809_3823256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077028311.1|3823257_3824283_-	DUF932 domain-containing protein	NA	NA	NA	NA	NA
WP_158520983.1|3824598_3824769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083732050.1|3826553_3827516_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077024714.1|3827512_3828778_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_083732051.1|3829037_3830042_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077024715.1|3830062_3831022_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145944173.1|3831284_3833174_-	RiPP maturation radical SAM protein 1	NA	NA	NA	NA	NA
WP_077024717.1|3833201_3833435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158520984.1|3833894_3835976_+	caspase family protein	NA	A0A1V0SAU3	Catovirus	28.0	2.7e-05
WP_077024719.1|3836071_3837139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145944174.1|3837271_3838312_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077024721.1|3838354_3839719_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	27.6	2.1e-06
WP_077024722.1|3839807_3841958_-	caspase family protein	NA	NA	NA	NA	NA
WP_077024723.1|3842010_3842772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024724.1|3843603_3843876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145944175.1|3844194_3848226_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145944176.1|3848309_3851666_+	caspase family protein	NA	NA	NA	NA	NA
WP_077024727.1|3852094_3855628_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_077024728.1|3855752_3856448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158520985.1|3856546_3856714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024730.1|3856937_3857387_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_077024731.1|3857628_3858987_-	HD domain-containing protein	NA	E5AG12	Erwinia_phage	33.2	3.2e-31
WP_145944177.1|3859220_3860006_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158520986.1|3860002_3860152_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077022387.1|3860214_3861675_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158520987.1|3861882_3862050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022421.1|3862214_3863387_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099091804.1|3863493_3864634_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	26.9	5.6e-13
WP_158520988.1|3864785_3865244_-	nucleotidyltransferase domain-containing protein	NA	A0A292GK16	Xanthomonas_phage	43.2	1.0e-21
WP_077024736.1|3865541_3866726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024737.1|3867104_3869669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024280.1|3869781_3870903_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145944179.1|3870909_3873288_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_158520989.1|3873926_3877061_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
3873684:3873702	attR	GGTGTCGATGACACCATCG	NA	NA	NA	NA
WP_158520990.1|3877169_3879284_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	29.4	1.4e-14
WP_077024743.1|3879798_3883443_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145944181.1|3883875_3884262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024746.1|3885415_3887392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145944182.1|3887435_3890447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024749.1|3890929_3891754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158520991.1|3892138_3896437_-	protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	30.3	6.3e-17
WP_077024751.1|3896837_3897419_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077024752.1|3898298_3898589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024754.1|3899033_3906545_+	cadherin-like domain-containing protein	NA	K4JS89	Caulobacter_virus	27.8	5.7e-13
WP_077022387.1|3906585_3908046_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	4001223	4097171	8920478	transposase,integrase	Bodo_saltans_virus(25.0%)	57	4083056:4083071	4101438:4101453
WP_077024841.1|4001223_4002282_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_083732067.1|4002510_4006098_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_077028319.1|4006258_4006675_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083732068.1|4006718_4009382_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_077024842.1|4009847_4011308_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_077028320.1|4011316_4012216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024843.1|4012504_4013653_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077024844.1|4013928_4015023_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_083732576.1|4019526_4020738_+	esterase family protein	NA	NA	NA	NA	NA
WP_077024845.1|4020770_4021922_+	esterase	NA	NA	NA	NA	NA
WP_077024846.1|4023524_4026983_+	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_158521007.1|4027621_4028002_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_077024848.1|4027998_4030638_+	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_077024849.1|4030692_4033137_+	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_077024850.1|4033165_4034434_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_077024851.1|4034455_4035643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024853.1|4036716_4037313_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077024854.1|4037501_4039676_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	31.3	7.8e-24
WP_077024855.1|4039719_4041177_+	TIGR03067 domain-containing protein	NA	NA	NA	NA	NA
WP_077024856.1|4041182_4041491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024857.1|4041527_4041791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024858.1|4041787_4042156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024859.1|4042240_4042573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024860.1|4042572_4042992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099091883.1|4043850_4045020_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_158521009.1|4046254_4049662_-	FG-GAP repeat protein	NA	NA	NA	NA	NA
WP_077024863.1|4049834_4050917_-	TIGR03032 family protein	NA	NA	NA	NA	NA
WP_077024865.1|4051542_4052067_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077022421.1|4052068_4053241_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_077024866.1|4053286_4054927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024867.1|4054923_4055910_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_145944194.1|4055928_4056468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077024869.1|4056529_4057084_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145944195.1|4057257_4057449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024871.1|4057520_4058327_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_077024872.1|4058326_4059772_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_077024873.1|4059768_4060389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024874.1|4060385_4060838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024875.1|4060834_4061113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024877.1|4061732_4064459_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_077024878.1|4064461_4064887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024879.1|4065099_4065384_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_158521011.1|4065376_4065760_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_179954448.1|4065762_4066716_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077024882.1|4066975_4080778_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_077024884.1|4081292_4082333_-	replication initiator protein A	NA	A0A0K1Y6J9	Rhodobacter_phage	43.3	1.9e-68
WP_083732072.1|4082953_4083913_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	48.8	7.8e-77
4083056:4083071	attL	ACCAACACGATTGTTG	NA	NA	NA	NA
WP_077024885.1|4083998_4084376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024886.1|4084908_4085202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077024887.1|4085262_4085457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083732073.1|4085820_4086183_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077024890.1|4086694_4087375_+	AAA family ATPase	NA	A2I303	Vibrio_virus	43.6	5.4e-40
WP_145944197.1|4088013_4089393_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_158521013.1|4089602_4093727_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077024894.1|4094000_4095422_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_077024895.1|4095774_4096005_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077024896.1|4096001_4097171_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4101438:4101453	attR	CAACAATCGTGTTGGT	NA	NA	NA	NA
>prophage 15
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	4269689	4278065	8920478		uncultured_virus(50.0%)	7	NA	NA
WP_077025007.1|4269689_4270628_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	45.4	8.2e-79
WP_145944205.1|4270897_4271296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077025008.1|4271306_4272314_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.6	5.4e-36
WP_077025009.1|4272709_4274419_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.2	6.1e-149
WP_077025010.1|4274580_4274868_+	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	50.0	2.1e-17
WP_077028333.1|4275005_4276622_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	54.9	1.1e-158
WP_077025011.1|4276901_4278065_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.2	7.2e-16
>prophage 16
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	6347730	6502469	8920478	transposase,protease,tRNA	Mollivirus(15.38%)	109	NA	NA
WP_077026337.1|6347730_6348330_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_077026338.1|6348637_6349735_-	deoxyhypusine synthase family protein	NA	NA	NA	NA	NA
WP_083732280.1|6349749_6351759_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	44.3	1.0e-102
WP_077026339.1|6352206_6353775_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.4	3.0e-41
WP_077026340.1|6353858_6354383_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_077026341.1|6354391_6355174_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.6	5.1e-18
WP_077026342.1|6355257_6355803_-	DUF1579 domain-containing protein	NA	NA	NA	NA	NA
WP_077026343.1|6356073_6358896_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_083732281.1|6359286_6360657_-	Na+/H+ antiporter NhaA	NA	NA	NA	NA	NA
WP_077026344.1|6361143_6361704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077026345.1|6361700_6362009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077026346.1|6362007_6362619_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_083732624.1|6362872_6363328_+	protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	33.1	1.6e-08
WP_077022421.1|6363401_6364574_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_077026348.1|6364575_6367269_+	serine/threonine protein kinase	NA	F2WL08	Lausannevirus	32.8	4.1e-14
WP_077026349.1|6367601_6368588_+	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_077026350.1|6368856_6369873_+	ROK family protein	NA	NA	NA	NA	NA
WP_077026351.1|6369853_6370075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077026352.1|6370071_6371220_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_077026353.1|6371466_6372102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083732282.1|6372107_6373448_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_077026355.1|6373738_6374695_+	EamA family transporter	NA	NA	NA	NA	NA
WP_077026356.1|6374691_6375147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077026357.1|6375282_6375846_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077026358.1|6376050_6379509_+	protein kinase	NA	A0A0M3SGV8	Mollivirus	31.3	1.6e-15
WP_145944347.1|6380270_6381371_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_077026360.1|6381478_6382627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077026362.1|6383116_6384346_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_083732625.1|6387774_6393687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077026364.1|6393795_6395586_-	Hsp70 family protein	NA	A0A1V0SC87	Catovirus	27.8	8.2e-11
WP_077026365.1|6396026_6399110_+	PSD1 domain-containing protein	NA	NA	NA	NA	NA
WP_083732284.1|6399081_6400599_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_077028518.1|6400651_6401113_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_077026367.1|6401167_6401716_-	formaldehyde-activating enzyme	NA	NA	NA	NA	NA
WP_077028519.1|6401826_6402474_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077026368.1|6402598_6404023_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145944348.1|6404129_6404801_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_077026370.1|6405263_6406343_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_083732285.1|6406466_6407348_+	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_077026371.1|6407589_6407952_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_077026372.1|6407966_6409985_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_077026373.1|6410123_6410540_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_077026374.1|6410526_6410763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077026375.1|6411015_6411531_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077026376.1|6411546_6413787_+	serine hydrolase	NA	A0A1V0SLG8	Klosneuvirus	24.6	5.1e-10
WP_145944349.1|6414751_6416050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077026379.1|6416932_6419746_+	PSD1 domain-containing protein	NA	NA	NA	NA	NA
WP_077026380.1|6419754_6420867_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_077026381.1|6421017_6421785_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_077026382.1|6421825_6422971_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_077026383.1|6423325_6424555_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_077026384.1|6424581_6426666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077026386.1|6427363_6427648_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077023900.1|6427644_6428532_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_145944350.1|6428670_6429030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022387.1|6429249_6430710_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077026388.1|6430775_6431171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022421.1|6431308_6432481_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_077026390.1|6433338_6434736_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_077026391.1|6434900_6436418_-	sigma-70 family RNA polymerase sigma factor	NA	L7RGQ5	Acanthamoeba_polyphaga_moumouvirus	28.0	1.6e-20
WP_077028521.1|6436528_6436801_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_083732626.1|6436961_6437702_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_179954421.1|6437843_6440675_+	serine/threonine protein kinase	NA	A0A0G2Y7N1	Acanthamoeba_polyphaga_mimivirus	31.0	9.5e-22
WP_077026393.1|6441438_6443031_-	D-aminoacylase	NA	NA	NA	NA	NA
WP_077026394.1|6443232_6443913_-	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	48.8	4.1e-48
WP_077026395.1|6443934_6444261_-	MGMT family protein	NA	NA	NA	NA	NA
WP_099091911.1|6444307_6445213_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_077028524.1|6445401_6446475_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_077026396.1|6446738_6447968_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_077026397.1|6447977_6449333_-	DUF1800 domain-containing protein	NA	NA	NA	NA	NA
WP_145944351.1|6449337_6451068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077028525.1|6452386_6453595_+	nucleoside monophosphate kinase	NA	NA	NA	NA	NA
WP_145944352.1|6454143_6454497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077026400.1|6455236_6456466_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_099091824.1|6456573_6458274_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_077026402.1|6458508_6458994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077026403.1|6458994_6460047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022414.1|6460114_6460993_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	35.0	8.0e-36
WP_077022415.1|6460989_6461217_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077022387.1|6461848_6463309_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077026405.1|6463549_6464929_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_077026406.1|6465122_6465746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077026407.1|6465786_6467070_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_077026408.1|6467369_6467621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077026409.1|6467607_6468180_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_077026410.1|6468192_6469467_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_077026412.1|6469862_6470705_+	inositol oxygenase	NA	A0A2K9L6K3	Tupanvirus	45.8	2.4e-61
WP_145944353.1|6470960_6471323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077026414.1|6471558_6472665_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_083732288.1|6472667_6474503_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_077026415.1|6475600_6476365_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_083732289.1|6476553_6477354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083732627.1|6477554_6478319_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077026418.1|6479422_6480712_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_077026419.1|6481294_6482392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077026420.1|6482496_6483930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083732290.1|6484263_6485922_-	LamG domain-containing protein	NA	NA	NA	NA	NA
WP_077026422.1|6486604_6489745_+	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_077026423.1|6489903_6490509_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077028527.1|6490717_6491632_+	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_077028528.1|6491660_6491966_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_077026424.1|6492824_6493508_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_077026425.1|6493650_6494865_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_077026426.1|6494888_6495149_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_077022387.1|6495846_6497307_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077026428.1|6497393_6497624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145944354.1|6497837_6500255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145944355.1|6500476_6500989_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_077022387.1|6501008_6502469_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	7079731	7169460	8920478	transposase,tRNA	Pseudomonas_phage(12.5%)	58	NA	NA
WP_077026793.1|7079731_7081453_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077026794.1|7081614_7082730_-	hypothetical protein	NA	S5VZL8	Pseudomonas_phage	29.6	1.2e-07
WP_077026795.1|7083045_7083606_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_083732349.1|7083602_7084997_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_077026796.1|7085199_7085586_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_077026797.1|7085578_7089478_+	SLBB domain-containing protein	NA	NA	NA	NA	NA
WP_083732642.1|7089868_7091248_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	36.9	2.5e-36
WP_158521150.1|7091504_7092341_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_099091916.1|7093264_7094881_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_077026799.1|7094964_7096350_-	neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_077026800.1|7096433_7097213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077026801.1|7097358_7098762_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_077026802.1|7098778_7101724_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_077026803.1|7101917_7102115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083732353.1|7102198_7103560_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077026805.1|7103556_7104852_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_077026806.1|7105045_7106080_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_083732354.1|7106325_7108269_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077026808.1|7108406_7110404_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_083732635.1|7110923_7112168_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	51.5	4.5e-109
WP_077026809.1|7112280_7112907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077026810.1|7112923_7113979_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_077026811.1|7114132_7115458_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_077026812.1|7115672_7116659_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_077026813.1|7116752_7117181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077026814.1|7117335_7117911_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077026815.1|7117976_7120133_+	protein kinase	NA	A0A146JFA3	Tokyovirus	38.5	1.5e-06
WP_145944394.1|7120137_7121409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145944395.1|7121821_7122691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077026818.1|7122763_7124752_-	Hsp70 family protein	NA	A0A1V0SAK3	Catovirus	32.2	6.9e-59
WP_145944396.1|7124968_7126075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077026820.1|7126374_7127451_+	sugar kinase	NA	NA	NA	NA	NA
WP_077026821.1|7127587_7129057_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	30.9	8.4e-30
WP_083732355.1|7129053_7129947_+	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	33.9	2.7e-07
WP_077026822.1|7129984_7130887_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_158521151.1|7130900_7131944_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_145944397.1|7132270_7133596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077026825.1|7133779_7136446_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	1.6e-50
WP_077026826.1|7136922_7139100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077026532.1|7139349_7141173_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_145944398.1|7141311_7141590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077026828.1|7141651_7142161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145944399.1|7142870_7143545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022738.1|7144065_7144350_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077023095.1|7145144_7147220_-	recombinase family protein	NA	NA	NA	NA	NA
WP_145943985.1|7147212_7147392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145944400.1|7147719_7147857_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077026831.1|7147900_7148287_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077028574.1|7148346_7149852_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_077026832.1|7149966_7151349_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_077028575.1|7151599_7153516_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_077026833.1|7153555_7155250_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077028576.1|7155598_7157731_+	acetylxylan esterase	NA	NA	NA	NA	NA
WP_077028577.1|7158955_7159978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083732358.1|7160155_7162300_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158521152.1|7162699_7165861_+	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_077026835.1|7165893_7167300_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_077023619.1|7167636_7169460_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	7998337	8028856	8920478	transposase,integrase	uncultured_Mediterranean_phage(20.0%)	28	7989295:7989309	8010996:8011010
7989295:7989309	attL	AAAAAGTGGAAGCCG	NA	NA	NA	NA
WP_077027393.1|7998337_7999585_+|integrase	site-specific integrase	integrase	A0A1B1IUW9	uncultured_Mediterranean_phage	26.9	1.3e-23
WP_077027394.1|7999600_7999885_-	DUF1580 domain-containing protein	NA	NA	NA	NA	NA
WP_077027395.1|8000243_8001503_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077027396.1|8001499_8002438_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077027397.1|8002430_8003435_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_083732666.1|8003441_8003852_-	hypothetical protein	NA	A0A2I7RQZ3	Vibrio_phage	32.7	1.7e-09
WP_077027398.1|8003962_8004196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158521188.1|8004192_8004780_-	RNA 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_158521189.1|8004709_8005234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077027401.1|8005230_8006244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077027402.1|8006465_8006756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077027404.1|8006986_8007331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077027405.1|8007631_8010316_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_077027406.1|8010312_8011125_-	hypothetical protein	NA	NA	NA	NA	NA
8010996:8011010	attR	CGGCTTCCACTTTTT	NA	NA	NA	NA
WP_145944461.1|8011124_8011940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077027408.1|8012378_8013485_+	protein kinase	NA	NA	NA	NA	NA
WP_077027409.1|8013542_8014595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077027410.1|8014626_8015661_-	protein kinase	NA	NA	NA	NA	NA
WP_077027412.1|8015983_8017444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077027413.1|8017440_8018640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145944462.1|8019619_8020519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145944463.1|8020530_8020767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077027416.1|8020879_8021809_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.3	7.2e-11
WP_077028649.1|8021805_8022633_-	ParA family protein	NA	A0A240F4U1	Ochrobactrum_phage	31.4	2.1e-14
WP_145944464.1|8022976_8024233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077027419.1|8026242_8026896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077022415.1|8027753_8027981_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077022414.1|8027977_8028856_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	35.0	8.0e-36
>prophage 19
NZ_CP017641	Fuerstia marisgermanicae strain NH11 chromosome, complete genome	8920478	8279630	8338736	8920478	transposase,integrase	environmental_Halophage(12.5%)	38	8279352:8279403	8338761:8338812
8279352:8279403	attL	TTCTTAGAGGGGCCGGTGGGATTCGAACCCACGAATACGGGATTTGCAATCC	NA	NA	NA	NA
WP_077022387.1|8279630_8281091_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145944481.1|8281624_8281858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077027575.1|8281941_8285766_+	hypothetical protein	NA	H9YQQ0	environmental_Halophage	34.1	8.9e-39
WP_077027576.1|8286365_8286779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077027577.1|8286788_8287370_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.8	7.2e-17
WP_158521196.1|8287571_8288273_-	AAA family ATPase	NA	A0A1V0DYC6	Dinoroseobacter_phage	30.2	9.9e-13
WP_077027579.1|8288430_8289360_-	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	46.8	1.0e-57
WP_077027580.1|8289464_8289665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077027581.1|8289927_8290425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077027582.1|8290502_8291090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077027583.1|8291439_8293062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077025137.1|8293128_8294556_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_158521197.1|8295342_8295795_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077027585.1|8296240_8298007_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	28.2	3.0e-26
WP_077027588.1|8299649_8300654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077027589.1|8300872_8301643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083732463.1|8301862_8304316_-	alpha/beta fold hydrolase	NA	G9BWE0	Planktothrix_phage	31.7	1.6e-20
WP_077027590.1|8304377_8305004_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_158521198.1|8305895_8307359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145944482.1|8307822_8309529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077027592.1|8309919_8312310_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_077027593.1|8312376_8312595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158521199.1|8312892_8315937_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_158521200.1|8316513_8316777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145944483.1|8316810_8317038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077027595.1|8317109_8319398_+	serine/threonine protein kinase	NA	A0A1V0SDC3	Indivirus	29.1	6.8e-18
WP_077027596.1|8319340_8320663_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077027597.1|8321287_8325841_+	tandem-95 repeat protein	NA	R9ZZU2	Cellulophaga_phage	37.2	9.0e-06
WP_077027598.1|8325867_8326911_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145944484.1|8327507_8328011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077027601.1|8328148_8329870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077027602.1|8330345_8330747_-	VOC family protein	NA	NA	NA	NA	NA
WP_077027603.1|8330748_8332212_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_077027604.1|8332744_8332942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077027605.1|8333279_8333900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077022387.1|8334264_8335725_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077027606.1|8335779_8336070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077027607.1|8337518_8338736_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
8338761:8338812	attR	TTCTTAGAGGGGCCGGTGGGATTCGAACCCACGAATACGGGATTTGCAATCC	NA	NA	NA	NA
