The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019416	Salmonella enterica subsp. enterica serovar Nitra strain S-1687 chromosome, complete genome	4691807	934626	941939	4691807	protease	Dickeya_phage(16.67%)	7	NA	NA
WP_001201751.1|934626_935745_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|935741_937688_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|937817_938039_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|938362_938683_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|938713_940990_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|941202_941400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|941561_941939_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 2
NZ_CP019416	Salmonella enterica subsp. enterica serovar Nitra strain S-1687 chromosome, complete genome	4691807	1013649	1024443	4691807	tail	Escherichia_phage(37.5%)	9	NA	NA
WP_000274547.1|1013649_1014279_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_000729406.1|1014262_1014889_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_076730917.1|1014885_1016595_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_076730918.1|1016594_1017176_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.0	5.0e-95
WP_001674638.1|1017653_1018622_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1019269_1019896_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|1020255_1020942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1021212_1021404_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1021830_1024443_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
>prophage 3
NZ_CP019416	Salmonella enterica subsp. enterica serovar Nitra strain S-1687 chromosome, complete genome	4691807	1226300	1238911	4691807	holin,integrase,tail,lysis	Salmonella_phage(33.33%)	15	1226136:1226165	1245757:1245786
1226136:1226165	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_076730932.1|1226300_1227380_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	6.7e-101
WP_001575998.1|1227354_1227633_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_076730933.1|1228046_1230026_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	5.6e-162
WP_000911593.1|1230714_1230963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|1231026_1231626_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|1231622_1231850_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|1231979_1232669_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|1232765_1233290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|1233663_1234113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|1234473_1235160_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|1235435_1235765_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1235748_1236201_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1236218_1236698_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|1237592_1238126_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1238215_1238911_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
1245757:1245786	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 4
NZ_CP019416	Salmonella enterica subsp. enterica serovar Nitra strain S-1687 chromosome, complete genome	4691807	1466846	1481122	4691807	holin,tRNA	Escherichia_phage(66.67%)	19	NA	NA
WP_000123700.1|1466846_1468220_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.8e-51
WP_001156218.1|1468263_1469199_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|1469515_1470133_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|1470160_1470478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|1470562_1470784_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|1471221_1471743_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_085981757.1|1471850_1472006_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|1472390_1472858_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|1473130_1473460_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|1473621_1474176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556390.1|1474172_1475105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|1475474_1475687_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000734094.1|1475977_1476148_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000940751.1|1476210_1476810_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|1476809_1477100_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|1477096_1477633_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_001688615.1|1480120_1480309_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000445513.1|1480298_1480580_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_000802786.1|1480576_1481122_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
>prophage 5
NZ_CP019416	Salmonella enterica subsp. enterica serovar Nitra strain S-1687 chromosome, complete genome	4691807	2015480	2068904	4691807	holin,head,terminase,plate,transposase,portal,integrase,tail,capsid,protease	Salmonella_phage(76.36%)	65	2060369:2060383	2066695:2066709
WP_001028172.1|2015480_2016503_-|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
WP_001176778.1|2016964_2017783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2019125_2019347_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2019559_2020567_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_015701331.1|2020851_2021451_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_076731000.1|2021420_2022983_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	99.6	3.7e-286
WP_001207832.1|2022969_2023557_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785580.1|2023559_2024639_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
WP_000605050.1|2024631_2025045_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273650.1|2025049_2025583_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_001066630.1|2025582_2026641_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863817.1|2026637_2027978_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_076731001.1|2028011_2029940_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.4	0.0e+00
WP_000588852.1|2030024_2030351_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2030347_2030704_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007993.1|2030703_2032200_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000497739.1|2032189_2032354_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779215.1|2032357_2032918_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_001135695.1|2032914_2033427_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000776844.1|2033398_2033803_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_000927251.1|2033799_2034123_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000766103.1|2034202_2035432_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000003793.1|2035441_2036044_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_077905357.1|2036036_2037131_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000838395.1|2037247_2037406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257219.1|2037402_2039133_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
WP_000501481.1|2039132_2039570_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_001135228.1|2039716_2040067_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000127618.1|2040090_2040630_-	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001075993.1|2040626_2041244_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_076731002.1|2041243_2041525_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	79.6	9.7e-36
WP_001294874.1|2041511_2041901_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000765639.1|2041989_2042562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357930.1|2042574_2043648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076731003.1|2043697_2044450_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	94.8	1.8e-137
WP_076731260.1|2044463_2045453_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	96.7	1.7e-188
WP_076731004.1|2045460_2046321_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.9e-159
WP_000779149.1|2046337_2046727_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_000200166.1|2046735_2047617_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_076731005.1|2047613_2048087_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	93.8	1.5e-52
WP_000096529.1|2048083_2049058_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000620702.1|2049054_2049279_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087406.1|2049275_2050433_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_023139406.1|2050429_2050984_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	1.2e-101
WP_001191666.1|2051012_2051237_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020644.1|2051334_2052030_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_001067433.1|2052235_2052421_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_000078504.1|2052496_2052748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551790.1|2053317_2054235_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_057517787.1|2054329_2054869_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	99.4	5.9e-98
WP_000764235.1|2054939_2055170_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071068.1|2055166_2055682_+	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000065085.1|2055678_2056038_+	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000267991.1|2056309_2056603_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000208076.1|2056599_2057463_+	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_001061370.1|2057459_2058029_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_001527041.1|2058068_2058296_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|2058297_2059287_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598921.1|2059578_2060376_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
2060369:2060383	attL	AACATTAATTCCTCA	NA	NA	NA	NA
WP_001680077.1|2061701_2062976_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
WP_000042271.1|2063047_2063299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084817.1|2063777_2064275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072670.1|2064636_2065200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000028416.1|2065610_2066492_+	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	42.0	3.3e-29
WP_076731007.1|2067065_2068904_-|tail	tail fiber protein	tail	I1TR70	Cronobacter_phage	49.0	1.0e-32
2066695:2066709	attR	AACATTAATTCCTCA	NA	NA	NA	NA
>prophage 6
NZ_CP019416	Salmonella enterica subsp. enterica serovar Nitra strain S-1687 chromosome, complete genome	4691807	2175901	2186408	4691807		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2175901_2177215_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2177241_2178321_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2178325_2179099_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_023200991.1|2179114_2180089_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2180094_2180646_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2180646_2181525_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2181572_2182472_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2182471_2183557_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2183933_2184827_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|2185004_2186408_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 7
NZ_CP019416	Salmonella enterica subsp. enterica serovar Nitra strain S-1687 chromosome, complete genome	4691807	2253605	2262776	4691807	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2253605_2255639_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2255879_2256338_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2256509_2257040_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2257096_2257564_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2257610_2258330_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2258326_2260012_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|2260234_2260966_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2261025_2261133_+	protein YohO	NA	NA	NA	NA	NA
WP_000824857.1|2261113_2261845_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|2261828_2262776_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
NZ_CP019416	Salmonella enterica subsp. enterica serovar Nitra strain S-1687 chromosome, complete genome	4691807	2504854	2510907	4691807		Salmonella_virus(50.0%)	6	NA	NA
WP_000377777.1|2504854_2505796_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	3.5e-146
WP_001576268.1|2507038_2507428_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|2507396_2507651_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|2507668_2509591_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|2510580_2510724_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_105789229.1|2510739_2510907_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
