The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019415	Salmonella enterica subsp. enterica serovar Moscow str. S-1843 chromosome, complete genome	4690402	934920	942233	4690402	integrase,protease	Dickeya_phage(16.67%)	7	923658:923672	942451:942465
923658:923672	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|934920_936039_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|936035_937982_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|938111_938333_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|938656_938977_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|939007_941284_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|941496_941694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|941855_942233_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942451:942465	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP019415	Salmonella enterica subsp. enterica serovar Moscow str. S-1843 chromosome, complete genome	4690402	992692	1092554	4690402	tail,protease,terminase,portal,capsid,tRNA,holin,head,lysis	Salmonella_phage(39.66%)	103	NA	NA
WP_001154025.1|992692_993496_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|993488_994811_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|994791_995496_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_076734504.1|995495_999962_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925870.1|1000306_1002157_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001109471.1|1002992_1003640_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_058106851.1|1003701_1004892_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977709.1|1005076_1006168_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117867.1|1006761_1008162_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000762342.1|1008362_1008824_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544855.1|1009141_1010356_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893200.1|1010601_1012038_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191404.1|1012115_1013318_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262311.1|1013512_1014805_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.3e-252
WP_000065276.1|1014849_1015098_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1015138_1015378_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1015420_1016578_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_058106852.1|1016540_1019468_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	98.7	0.0e+00
WP_022742800.1|1019594_1019945_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_000917563.1|1019966_1020125_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_038988958.1|1020753_1021125_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	1.5e-31
WP_023226317.1|1021102_1022164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015406390.1|1022233_1022629_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_051124477.1|1022733_1022970_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	71.8	2.6e-26
WP_010835408.1|1022935_1023310_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_072208318.1|1023401_1023590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077946708.1|1023604_1024660_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	53.2	4.9e-40
WP_076734505.1|1024662_1025412_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	99.6	3.3e-139
WP_000113626.1|1025422_1025770_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
WP_000065089.1|1025766_1026087_+	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
WP_000974174.1|1026086_1026332_+	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
WP_000132543.1|1026642_1027860_+	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
WP_107251218.1|1027840_1027909_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_000802853.1|1028002_1028329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1028576_1028810_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1028926_1029175_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1029209_1029812_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_051124475.1|1030020_1030632_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	96.6	7.9e-91
WP_000801757.1|1030628_1030769_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_051124474.1|1030765_1031446_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	1.4e-59
WP_001534381.1|1031755_1031944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526513.1|1032146_1032449_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_024798992.1|1032426_1032915_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	1.0e-56
WP_099800562.1|1032935_1033376_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.0	6.2e-53
WP_000867564.1|1033843_1034389_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_021000150.1|1034360_1036295_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	66.1	7.0e-258
WP_000224407.1|1036278_1036482_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	80.0	1.0e-18
WP_000820305.1|1036478_1038065_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	6.4e-185
WP_023233092.1|1038054_1039569_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	51.8	2.1e-100
WP_000143301.1|1039568_1039916_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	4.6e-19
WP_058106856.1|1039970_1040999_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	58.1	9.2e-108
WP_000448213.1|1041062_1041437_+	DNA breaking-rejoining protein	NA	A0A2R9YJP4	Escherichia_phage	34.9	4.8e-06
WP_000083787.1|1041447_1041804_+|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	58.5	1.8e-31
WP_000053601.1|1041813_1042413_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	68.7	8.3e-69
WP_001032919.1|1042412_1042814_+	hypothetical protein	NA	A0A291AWY2	Escherichia_phage	59.8	8.1e-44
WP_000126419.1|1042826_1043579_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	70.0	1.9e-94
WP_000478854.1|1043627_1044017_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	58.9	1.5e-31
WP_001175132.1|1044037_1044340_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	58.6	2.8e-25
WP_000978295.1|1045454_1045787_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_058106857.1|1045885_1046383_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.0	4.0e-16
WP_000877926.1|1046499_1047033_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1047122_1047818_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1047827_1048565_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1048462_1049167_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_076734506.1|1049238_1052589_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000178849.1|1052627_1052870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144693.1|1052923_1055362_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.3	8.3e-91
WP_000143167.1|1055361_1055943_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_076734507.1|1056418_1057387_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	98.8	7.4e-192
WP_000334547.1|1057914_1058541_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1058609_1058909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1058893_1059580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1059850_1060042_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|1060468_1063081_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_058106752.1|1063288_1064299_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001574119.1|1064464_1065007_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224079.1|1065003_1066113_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|1066211_1068320_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1068332_1070240_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333139.1|1070254_1071508_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1071512_1073153_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1073149_1073713_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1073968_1074136_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1074235_1074754_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|1074822_1076583_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1076768_1077221_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1077292_1078345_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288733.1|1078701_1079211_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_058106751.1|1079427_1080033_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950876.1|1080019_1082173_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1082191_1082638_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1082761_1084816_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1084851_1085310_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_058106750.1|1085404_1086067_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001676378.1|1086240_1086654_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1086698_1087016_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140478.1|1087073_1088285_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1088499_1089048_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548080.1|1089073_1089853_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1089901_1090183_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904449.1|1090179_1090509_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1090595_1091255_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938186.1|1091873_1092554_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
>prophage 3
NZ_CP019415	Salmonella enterica subsp. enterica serovar Moscow str. S-1843 chromosome, complete genome	4690402	1264916	1277527	4690402	tail,integrase,holin,lysis	Salmonella_phage(33.33%)	15	1264752:1264781	1284373:1284402
1264752:1264781	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|1264916_1265996_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|1265970_1266249_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|1266662_1268642_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000911593.1|1269330_1269579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106734.1|1269642_1270242_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.4	1.4e-95
WP_000784710.1|1270238_1270466_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|1270595_1271285_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|1271381_1271906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|1272279_1272729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|1273089_1273776_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|1274051_1274381_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1274364_1274817_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1274834_1275314_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|1276208_1276742_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1276831_1277527_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
1284373:1284402	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 4
NZ_CP019415	Salmonella enterica subsp. enterica serovar Moscow str. S-1843 chromosome, complete genome	4690402	1505451	1519808	4690402	tRNA	Escherichia_phage(76.92%)	17	NA	NA
WP_058106621.1|1505451_1506825_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	1.6e-51
WP_001156217.1|1506868_1507804_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|1508120_1508738_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|1508765_1509083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|1509167_1509389_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|1509826_1510348_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_085981757.1|1510455_1510611_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|1510996_1511464_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|1511736_1512066_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|1512227_1512782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556389.1|1512778_1513711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|1514080_1514293_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000734094.1|1514583_1514754_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000940751.1|1514816_1515416_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|1515415_1515706_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|1515702_1516239_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_058106622.1|1519190_1519808_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	83.9	1.1e-92
>prophage 5
NZ_CP019415	Salmonella enterica subsp. enterica serovar Moscow str. S-1843 chromosome, complete genome	4690402	1849139	1893686	4690402	integrase,tail,terminase,portal,capsid,plate,tRNA,holin,head,lysis	Enterobacteria_phage(63.89%)	53	1848072:1848096	1886375:1886399
1848072:1848096	attL	AAAGAAAAAAGGCCGCAATGCGGCC	NA	NA	NA	NA
WP_058106647.1|1849139_1850093_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	48.6	2.0e-77
WP_058106648.1|1850182_1850494_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	48.5	5.4e-19
WP_058343723.1|1850588_1850867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106649.1|1851026_1851425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844112.1|1851745_1851949_+	LapA family protein	NA	NA	NA	NA	NA
WP_023170322.1|1851918_1852110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106650.1|1852185_1852626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106651.1|1852622_1852880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106652.1|1852867_1853401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106653.1|1853397_1853637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048590829.1|1853633_1854599_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B2IH14	Erwinia_phage	42.4	3.1e-57
WP_058106654.1|1854592_1855096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106655.1|1855092_1856112_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	67.8	1.0e-127
WP_058106656.1|1856108_1858613_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	47.4	6.0e-177
WP_048590832.1|1858605_1859019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106657.1|1859118_1859382_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_058106659.1|1863000_1864050_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.9	5.6e-153
WP_045900644.1|1864049_1865783_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	75.1	1.7e-263
WP_058106660.1|1865939_1866776_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.8	7.5e-100
WP_058106661.1|1866799_1867885_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.4	3.8e-136
WP_058106662.1|1867931_1868762_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	65.5	1.1e-90
WP_045900648.1|1868864_1869359_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	60.1	2.2e-51
WP_058106663.1|1869358_1869559_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	78.8	5.7e-22
WP_001658928.1|1869588_1869927_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_050154612.1|1869923_1870367_+	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.2	8.1e-45
WP_058106664.1|1870373_1870865_+|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	56.9	2.7e-33
WP_058106665.1|1870851_1871298_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.1	2.5e-33
WP_048590845.1|1871294_1871930_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	59.8	1.0e-64
WP_058106666.1|1871926_1872517_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.6	2.4e-68
WP_001658912.1|1872513_1872882_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	71.3	6.5e-40
WP_045900654.1|1872868_1873765_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	69.1	1.5e-106
WP_058106667.1|1873757_1874285_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	60.6	4.2e-56
WP_076734536.1|1874290_1876339_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	89.8	2.2e-217
WP_078057117.1|1876308_1876926_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	86.7	3.0e-98
WP_076734537.1|1876929_1877463_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.9	6.7e-78
WP_058106670.1|1877465_1878332_-	hypothetical protein	NA	A0A1S6KZZ8	Salmonella_phage	91.7	2.2e-147
WP_000980424.1|1878483_1878972_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	79.5	1.5e-71
WP_076734538.1|1878985_1881946_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.7	3.4e-256
WP_001627826.1|1881932_1882091_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	79.6	2.4e-15
WP_058106673.1|1882096_1882453_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	53.6	5.2e-18
WP_000115856.1|1882495_1883008_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.0	7.6e-63
WP_045900664.1|1883008_1884196_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	81.7	4.8e-185
WP_076734539.1|1884353_1885475_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	74.5	1.1e-149
WP_024143245.1|1885529_1885790_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_023229131.1|1886023_1886164_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	71.7	3.1e-11
WP_001229266.1|1886519_1886819_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1886375:1886399	attR	AAAGAAAAAAGGCCGCAATGCGGCC	NA	NA	NA	NA
WP_000672408.1|1886823_1889211_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018570.1|1889226_1890210_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|1890346_1890391_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1890511_1890868_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1890918_1891116_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001574431.1|1891211_1891754_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001144217.1|1891757_1893686_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	5.5e-130
>prophage 6
NZ_CP019415	Salmonella enterica subsp. enterica serovar Moscow str. S-1843 chromosome, complete genome	4690402	2185027	2195534	4690402		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2185027_2186341_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_058106704.1|2186367_2187447_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.1e-15
WP_058106705.1|2187451_2188225_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|2188240_2189215_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|2189220_2189772_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_058106732.1|2189772_2190651_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.7e-108
WP_001023658.1|2190698_2191598_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697846.1|2191597_2192683_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2193059_2193953_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144951.1|2194130_2195534_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 7
NZ_CP019415	Salmonella enterica subsp. enterica serovar Moscow str. S-1843 chromosome, complete genome	4690402	2262737	2271908	4690402	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|2262737_2264771_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|2265011_2265470_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|2265641_2266172_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|2266228_2266696_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|2266742_2267462_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2267458_2269144_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240421.1|2269366_2270098_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_001261696.1|2270157_2270265_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2270245_2270977_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|2270960_2271908_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 8
NZ_CP019415	Salmonella enterica subsp. enterica serovar Moscow str. S-1843 chromosome, complete genome	4690402	2508344	2514397	4690402		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|2508344_2509286_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|2510528_2510918_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|2510886_2511141_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_076734558.1|2511158_2513081_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	7.3e-300
WP_105789228.1|2514070_2514214_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_105789229.1|2514229_2514397_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
