The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019413	Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 chromosome, complete genome	4942273	1037545	1131199	4942273	terminase,head,portal,capsid,tRNA,protease,tail,holin	Salmonella_phage(59.32%)	96	NA	NA
WP_001154025.1|1037545_1038349_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1038341_1039664_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060024.1|1039644_1040349_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_076735497.1|1040348_1044815_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_076735498.1|1045159_1047007_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1047266_1047815_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1047842_1048490_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462706.1|1048551_1049742_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977709.1|1049926_1051018_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_076735499.1|1051624_1053025_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000762342.1|1053225_1053687_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_076735500.1|1054003_1055218_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_076735501.1|1055463_1056900_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191404.1|1056977_1058180_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1058374_1059667_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1059711_1059960_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1060000_1060240_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1060282_1061440_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017138.1|1061402_1064330_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	100.0	0.0e+00
WP_001669126.1|1064456_1064807_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	100.0	7.5e-62
WP_000917564.1|1064828_1064987_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001009038.1|1065385_1065790_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	100.0	4.2e-72
WP_000869364.1|1065919_1066156_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001538023.1|1066121_1066496_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	100.0	3.0e-64
WP_001669125.1|1066580_1067564_+	replication protein	NA	H6WRX7	Salmonella_phage	99.7	7.3e-163
WP_000800012.1|1067566_1068316_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000113621.1|1068326_1068674_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	98.3	1.5e-57
WP_000065341.1|1068670_1069072_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	100.0	2.9e-73
WP_000151011.1|1069068_1069521_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	100.0	3.8e-74
WP_000208070.1|1069517_1070327_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	100.0	4.5e-158
WP_001217670.1|1070846_1071086_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_076735502.1|1071419_1072022_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	1.1e-108
WP_023194651.1|1072230_1072842_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	97.0	2.7e-91
WP_023194650.1|1072838_1072979_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	76.3	2.1e-07
WP_023194649.1|1072975_1073665_+	Gifsy-1 prophage RegQ	NA	I6PDF8	Cronobacter_phage	51.5	6.9e-59
WP_162264800.1|1073865_1074207_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_023137782.1|1074209_1074836_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	80.2	7.8e-94
WP_076735503.1|1074832_1075372_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	47.9	3.7e-07
WP_000495546.1|1075414_1075792_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	66.1	1.2e-41
WP_023137451.1|1075859_1076204_+	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	3.9e-47
WP_000919036.1|1076336_1076801_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	7.4e-49
WP_023194832.1|1076754_1078497_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.2	9.7e-142
WP_000002707.1|1078496_1079801_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.9	6.2e-218
WP_000039020.1|1079814_1080663_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	87.9	1.7e-131
WP_001648716.1|1080672_1081890_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	89.6	5.8e-202
WP_020898873.1|1081933_1082194_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.9e-10
WP_001648719.1|1082193_1082520_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
WP_020898872.1|1082529_1082868_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
WP_000573486.1|1082864_1083314_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	95.3	2.1e-72
WP_000133674.1|1083310_1083658_+	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	77.0	3.1e-44
WP_053521184.1|1083715_1084420_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	74.4	9.7e-93
WP_001129938.1|1084447_1084819_+|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	92.6	3.4e-60
WP_024134502.1|1084842_1085121_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
WP_001805532.1|1085174_1085630_+	hypothetical protein	NA	A0A0S2SY43	Pseudomonas_phage	40.8	8.1e-08
WP_053533436.1|1085662_1088953_+|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	66.5	0.0e+00
WP_000171561.1|1088998_1089310_+	hypothetical protein	NA	S4TNM6	Salmonella_phage	80.2	1.7e-36
WP_000064923.1|1089348_1089561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000729325.1|1089726_1090320_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	100.0	8.7e-111
WP_000967282.1|1090319_1090904_+	hypothetical protein	NA	S4TND4	Salmonella_phage	100.0	1.5e-107
WP_000682267.1|1090910_1091309_+	hypothetical protein	NA	S4TR39	Salmonella_phage	100.0	8.8e-75
WP_001110473.1|1091308_1094029_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	100.0	0.0e+00
WP_001113925.1|1094037_1094997_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	100.0	9.6e-184
WP_023137449.1|1095007_1096138_+|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	100.0	4.4e-204
WP_001805559.1|1096206_1096365_-	DinI-like family protein	NA	S4TND2	Salmonella_phage	100.0	5.8e-22
WP_000776343.1|1096579_1097782_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	100.0	6.3e-209
WP_000497440.1|1098474_1098681_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_000193776.1|1099107_1101720_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	3.7e-20
WP_000291723.1|1101927_1102938_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1103103_1103646_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_076735504.1|1103642_1104752_-	YcbX family protein	NA	NA	NA	NA	NA
WP_076735505.1|1104850_1106959_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053051.1|1106971_1108879_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	5.4e-53
WP_076735506.1|1108893_1110147_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1110151_1111792_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1111788_1112352_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1112607_1112775_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1112874_1113393_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156462.1|1113461_1115222_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1115407_1115860_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001747676.1|1115931_1116990_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1117346_1117856_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1118072_1118678_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950879.1|1118664_1120818_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1120836_1121283_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_076735507.1|1121406_1123461_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_000424187.1|1123496_1123955_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847736.1|1124049_1124712_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1124885_1125299_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1125343_1125661_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1125718_1126930_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_024155072.1|1127144_1127693_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_076735508.1|1127718_1128498_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1128546_1128828_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1128824_1129154_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1129240_1129900_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938182.1|1130518_1131199_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
>prophage 2
NZ_CP019413	Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 chromosome, complete genome	4942273	1345738	1387619	4942273	integrase,terminase,lysis,holin,tail,plate,head	Edwardsiella_phage(20.0%)	57	1345583:1345612	1390672:1390701
1345583:1345612	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_076735562.1|1345738_1346818_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.9	4.5e-105
WP_078061180.1|1346798_1347071_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	4.0e-10
WP_076735563.1|1347131_1347560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076735564.1|1347556_1349650_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.6	2.5e-197
WP_063390535.1|1349646_1349904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276802.1|1349997_1350177_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	62.1	4.3e-13
WP_047598971.1|1350787_1351120_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	74.2	3.8e-15
WP_076166144.1|1351112_1351433_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	60.6	6.1e-34
WP_076735565.1|1351468_1352299_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	8.5e-104
WP_076166140.1|1352291_1354982_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	3.7e-116
WP_076735566.1|1355122_1355458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613374.1|1355532_1355817_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_071992601.1|1356198_1356354_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	8.0e-08
WP_001224472.1|1356663_1357089_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
WP_001033911.1|1357185_1357440_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001574210.1|1357426_1357921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076735567.1|1357964_1358972_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.4e-123
WP_157872077.1|1358883_1359426_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_022742732.1|1359438_1359834_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	6.4e-17
WP_023139357.1|1359830_1360103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024150652.1|1360309_1360462_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_023139356.1|1360711_1360960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742730.1|1361023_1361623_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
WP_076735568.1|1361619_1361814_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	53.7	5.3e-09
WP_050942040.1|1361810_1362092_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	84.8	1.2e-38
WP_023139354.1|1362441_1362783_+	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.1e-54
WP_023139353.1|1363331_1364261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|1364773_1365076_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_001208105.1|1365053_1365593_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.2	5.7e-77
WP_001534346.1|1365693_1366158_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	82.4	1.3e-56
WP_001113128.1|1366383_1366566_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_022742724.1|1366636_1367389_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	75.6	5.3e-12
WP_022742723.1|1367354_1368776_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.8e-186
WP_076166126.1|1368775_1370296_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.1	6.3e-105
WP_000552017.1|1370336_1371026_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_023139349.1|1371022_1372369_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
WP_001525451.1|1372370_1372853_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
WP_001031913.1|1372852_1373881_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_001748493.1|1373884_1374232_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
WP_001748492.1|1374238_1374694_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
WP_001748491.1|1374687_1375272_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
WP_076166120.1|1375268_1375634_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	1.8e-21
WP_000094504.1|1375618_1376164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076166117.1|1376144_1377629_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	3.1e-96
WP_076735569.1|1377629_1378076_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_023234167.1|1378075_1378480_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	8.2e-20
WP_000228831.1|1378521_1378704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076735570.1|1378687_1380859_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_000010346.1|1380855_1381566_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	8.5e-28
WP_000890115.1|1381565_1381868_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_076735571.1|1381864_1382734_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.4	4.5e-31
WP_023257603.1|1382714_1383392_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
WP_023257604.1|1383404_1383761_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	9.5e-20
WP_023257605.1|1383757_1384999_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_076166114.1|1385000_1385603_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	7.7e-30
WP_076735572.1|1385592_1387044_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	71.2	2.9e-43
WP_076735573.1|1387043_1387619_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	2.2e-95
1390672:1390701	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 3
NZ_CP019413	Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 chromosome, complete genome	4942273	2278548	2318963	4942273	terminase,integrase,holin,portal,capsid,protease,tail,plate,head	Salmonella_phage(81.82%)	56	2278189:2278203	2319004:2319018
2278189:2278203	attL	TATTTTGTACTCAAT	NA	NA	NA	NA
WP_000798891.1|2278548_2278815_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	89.8	4.0e-39
WP_000343069.1|2278830_2279022_-	DUF2767 family protein	NA	A0A0M4R5C3	Salmonella_phage	97.7	5.8e-16
WP_001530989.1|2279130_2279565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532385.1|2280038_2280413_-	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	35.0	9.0e-13
WP_001259328.1|2280464_2281598_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	7.2e-37
WP_000267959.1|2281673_2281847_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	65.1	1.7e-11
WP_086011185.1|2281836_2282442_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	94.1	1.7e-101
WP_000554743.1|2282411_2283956_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	91.0	2.1e-257
WP_001207832.1|2283942_2284530_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|2284532_2285612_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|2285604_2286018_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_076735767.1|2286022_2286556_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	99.4	1.9e-96
WP_001066630.1|2286555_2287614_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|2287610_2288951_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_000785390.1|2288984_2290913_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_022742746.1|2290997_2291291_-	hypothetical protein	NA	A0A192Y6C5	Salmonella_phage	100.0	2.6e-47
WP_000515952.1|2291320_2291677_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007996.1|2291676_2293173_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000497740.1|2293162_2293327_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_000779216.1|2293330_2293891_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_001135699.1|2293887_2294400_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000702410.1|2294371_2294776_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2294772_2295096_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601352.1|2295098_2295299_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000257526.1|2295349_2296555_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_001193639.1|2296569_2297220_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466263.1|2297197_2298439_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.0	6.5e-241
WP_000605609.1|2298438_2298621_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088175.1|2298632_2300366_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000929171.1|2300362_2300857_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_001135098.1|2300982_2301333_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2301383_2301716_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2302178_2302571_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001005893.1|2302567_2303182_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	97.1	5.0e-109
WP_162264800.1|2303184_2303526_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_001097244.1|2303726_2304416_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	49.8	2.0e-58
WP_000801757.1|2304412_2304553_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_039501156.1|2304549_2305161_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	96.6	6.1e-91
WP_000929790.1|2305369_2305972_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_071841283.1|2306006_2306255_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	97.6	1.0e-41
WP_001217669.1|2306371_2306605_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_016062831.1|2307093_2307726_-	hypothetical protein	NA	H6WRY3	Salmonella_phage	100.0	3.8e-112
WP_045718384.1|2308788_2309289_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	75.1	1.7e-78
WP_045718387.1|2309945_2310641_-	phage replication protein P	NA	G8C7U6	Escherichia_phage	45.0	1.6e-55
WP_000024043.1|2310637_2311474_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.4	7.6e-52
WP_076735768.1|2311565_2311940_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.5e-63
WP_045718389.1|2311905_2312142_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	67.9	4.2e-24
WP_024133227.1|2312215_2312629_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	78.0	8.9e-46
WP_045718392.1|2312771_2313881_+	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	58.4	1.6e-118
WP_039501146.1|2314251_2314452_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	4.1e-12
WP_039501144.1|2314542_2314839_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	9.8e-47
WP_001648679.1|2314844_2315630_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.2	1.4e-148
WP_000187056.1|2315626_2316307_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	3.9e-131
WP_039501142.1|2316303_2317173_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	94.8	1.3e-158
WP_001754984.1|2317178_2317418_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_001007943.1|2317781_2318963_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	99.5	1.3e-227
2319004:2319018	attR	TATTTTGTACTCAAT	NA	NA	NA	NA
>prophage 4
NZ_CP019413	Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 chromosome, complete genome	4942273	2345450	2351747	4942273		Enterobacteria_phage(50.0%)	6	NA	NA
WP_058805699.1|2345450_2345981_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.6	3.7e-52
WP_023215752.1|2345985_2346864_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	3.0e-107
WP_001023658.1|2346911_2347811_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697846.1|2347810_2348896_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2349272_2350166_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_076735773.1|2350343_2351747_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 5
NZ_CP019413	Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 chromosome, complete genome	4942273	2431601	2440772	4942273	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195343.1|2431601_2433635_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000703137.1|2433875_2434334_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_076735790.1|2434505_2435036_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_076735791.1|2435092_2435560_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	2.0e-73
WP_000598637.1|2435606_2436326_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2436322_2438008_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2438230_2438962_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001216964.1|2439021_2439129_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2439109_2439841_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2439824_2440772_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 6
NZ_CP019413	Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 chromosome, complete genome	4942273	2682535	2688566	4942273		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|2682535_2683477_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_076735827.1|2684719_2685109_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	96.6	1.1e-58
WP_000703599.1|2685077_2685332_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_076735828.1|2685348_2687271_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_106417236.1|2688260_2688404_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_115276122.1|2688419_2688566_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	69.6	4.6e-13
>prophage 7
NZ_CP019413	Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 chromosome, complete genome	4942273	4487241	4531789	4942273	tRNA,holin,plate,tail	Burkholderia_phage(38.1%)	46	NA	NA
WP_076736095.1|4487241_4489017_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.3e-52
WP_023232412.1|4489019_4489652_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	5.6e-23
WP_000951734.1|4489644_4490760_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|4490750_4491110_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_076736096.1|4491273_4492821_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.1e-48
WP_023137582.1|4492820_4493750_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000593184.1|4493746_4494109_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_076736097.1|4494436_4495159_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_048349019.1|4495168_4496212_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	3.8e-77
WP_001269716.1|4496199_4496409_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_076736098.1|4496408_4497362_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_076736099.1|4497361_4499716_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.4e-66
WP_001185654.1|4499812_4499941_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003641.1|4499900_4500218_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4500269_4500794_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729849.1|4500793_4502221_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_000875314.1|4502210_4502408_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_076736100.1|4502404_4502860_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|4503019_4503334_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_076736101.1|4503346_4503952_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	3.2e-60
WP_001226439.1|4503954_4504242_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615248.1|4504818_4505166_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136394.1|4505296_4506646_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790033.1|4506990_4508640_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_115276205.1|4509083_4509326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125469230.1|4509359_4510028_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_076736103.1|4510024_4510762_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750805.1|4510761_4512858_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982752.1|4513000_4513411_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252081.1|4513576_4514467_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_021001019.1|4514481_4516026_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695415.1|4516157_4517348_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|4517709_4518819_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_017465895.1|4518907_4520266_+	maltoporin	NA	NA	NA	NA	NA
WP_000782497.1|4520429_4521347_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019230.1|4521527_4522025_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|4522038_4522911_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|4523009_4525430_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002902.1|4525600_4525969_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|4526077_4526686_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128112.1|4526864_4528190_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_010989093.1|4528186_4528300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|4528321_4528531_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416271.1|4528630_4529146_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039335.1|4529392_4530703_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001825318.1|4530790_4531789_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
