The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019411	Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 chromosome, complete genome	4651794	898160	968477	4651794	integrase,plate,capsid,terminase,protease,tail,holin,portal,head	Cronobacter_phage(59.09%)	76	898069:898086	928779:928796
898069:898086	attL	AGGCAACAAAAAACCCAC	NA	NA	NA	NA
WP_060615706.1|898160_899213_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	1.7e-104
WP_060615707.1|899308_899989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001628745.1|899985_901014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108288.1|901029_901623_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	35.5	1.3e-29
WP_000804006.1|901715_901937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|901969_902473_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001628747.1|902482_902710_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_058106283.1|902699_903125_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	50.4	7.6e-24
WP_000022786.1|903124_903526_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000057334.1|903593_903824_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279402.1|903814_904675_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	83.8	2.4e-133
WP_060615708.1|904671_906693_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	4.7e-297
WP_023199746.1|906806_907025_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	2.8e-06
WP_001552031.1|906998_907322_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038208.1|907318_908380_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
WP_001151948.1|908376_910152_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.9	6.3e-290
WP_000018798.1|910312_911113_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|911174_912197_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_020437986.1|912200_912902_+|terminase	Phage terminase, endonuclease subunit	terminase	F1BUM0	Cronobacter_phage	66.8	2.7e-87
WP_001628758.1|912998_913451_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.0	3.6e-64
WP_000084220.1|913447_913954_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560083.1|913950_914658_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
WP_000220203.1|914654_915782_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|915778_916234_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|916243_916537_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_001628760.1|916533_916875_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	90.1	8.4e-50
WP_000376370.1|916874_917207_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
WP_000411339.1|917353_917611_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_001628763.1|917798_919769_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	67.4	6.2e-254
WP_001002797.1|919765_920095_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|920091_921276_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001823.1|921268_921856_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	8.4e-90
WP_000084300.1|921865_924112_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	70.4	3.1e-169
WP_047638016.1|924124_924670_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	1.2e-87
WP_000267951.1|924659_925385_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_001628767.1|925356_925902_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	7.1e-59
WP_170872962.1|925901_927605_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.1	4.9e-223
WP_001229272.1|928126_928624_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001024853.1|928940_930626_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
928779:928796	attR	AGGCAACAAAAAACCCAC	NA	NA	NA	NA
WP_000680850.1|930896_931274_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_000495513.1|931305_931569_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.5	5.9e-27
WP_001259137.1|931738_932029_+	YbjC family protein	NA	NA	NA	NA	NA
WP_000075300.1|932012_932735_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684366.1|932792_933695_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	2.6e-34
WP_000624810.1|933790_934267_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000125769.1|934615_935728_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001000698.1|935815_936949_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	6.5e-30
WP_000105453.1|936958_937912_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061621.1|937908_938754_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000505788.1|938827_939301_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149800.1|939343_940471_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.0	3.1e-24
WP_000399318.1|940765_942109_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000655399.1|942138_942459_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_023197601.1|942468_943956_+	sulfatase	NA	NA	NA	NA	NA
WP_000737537.1|944162_944894_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000895393.1|945130_945799_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001677.1|945798_946515_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756586.1|946521_947253_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027186.1|947270_947999_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
WP_001270724.1|948227_948743_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160725.1|948870_949194_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001202293.1|949190_950021_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
WP_000866902.1|950017_951031_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023197081.1|951126_952560_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566346.1|952570_953572_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815322.1|953610_955329_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.3	2.9e-29
WP_001538209.1|955486_956455_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458793.1|956466_958119_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491118.1|958262_959162_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_000599770.1|959362_961021_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001542594.1|961017_961968_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_023197082.1|962113_963232_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125898.1|963228_965175_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|965304_965526_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|965849_966170_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|966200_968477_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
>prophage 2
NZ_CP019411	Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 chromosome, complete genome	4651794	1229087	1233507	4651794		Escherichia_phage(50.0%)	7	NA	NA
WP_052907371.1|1229087_1229501_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	3.2e-19
WP_001656363.1|1229517_1230246_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.0	4.6e-61
WP_001628914.1|1230438_1230981_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	8.1e-71
WP_001277616.1|1231128_1231506_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_001529135.1|1231578_1232388_-	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001036547.1|1232885_1233050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497451.1|1233267_1233507_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
>prophage 3
NZ_CP019411	Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 chromosome, complete genome	4651794	1868206	1874147	4651794	tail	Salmonella_phage(50.0%)	7	NA	NA
WP_000143159.1|1868206_1868791_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	80.6	5.8e-83
WP_001529204.1|1868780_1869101_-	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	2.9e-44
WP_023196894.1|1869072_1870410_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	52.1	3.8e-77
WP_001629197.1|1870962_1871454_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.6e-44
WP_000789530.1|1871756_1871924_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001529209.1|1872192_1872726_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	42.4	1.6e-10
WP_023197384.1|1873040_1874147_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	Q9QF34	Lambdoid_phage	66.7	6.7e-56
>prophage 4
NZ_CP019411	Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 chromosome, complete genome	4651794	1980260	1987496	4651794		Morganella_phage(33.33%)	8	NA	NA
WP_001655552.1|1980260_1981691_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377042.1|1981764_1982460_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|1982551_1982851_-	membrane protein	NA	NA	NA	NA	NA
WP_039514025.1|1983500_1984679_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.0	2.5e-109
WP_024131109.1|1984939_1985128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|1985138_1985351_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_039514021.1|1985805_1987074_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.4	1.4e-227
WP_000394197.1|1987076_1987496_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 5
NZ_CP019411	Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 chromosome, complete genome	4651794	2142778	2151949	4651794	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195337.1|2142778_2144812_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703136.1|2145052_2145511_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_001221797.1|2145682_2146213_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2146269_2146737_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2146783_2147503_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2147499_2149185_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240416.1|2149407_2150139_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2150198_2150306_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2150286_2151018_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2151001_2151949_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 6
NZ_CP019411	Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 chromosome, complete genome	4651794	2351526	2419044	4651794	integrase,capsid,terminase,tRNA,coat,protease,tail,holin	Cronobacter_phage(28.57%)	88	2375653:2375669	2419135:2419151
WP_000016631.1|2351526_2352339_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289141.1|2352338_2353352_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001630102.1|2353419_2354556_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
WP_000553396.1|2354659_2355661_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127731.1|2355657_2356836_-	MFS transporter	NA	NA	NA	NA	NA
WP_000280167.1|2357015_2357309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023196778.1|2357636_2358293_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000817161.1|2358390_2359605_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_001630106.1|2359764_2361765_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559749.1|2361816_2362092_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089211.1|2362124_2362673_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000368599.1|2362672_2363482_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000750428.1|2363481_2364306_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918457.1|2364309_2365395_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
WP_001542329.1|2365430_2366363_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730794.1|2366528_2367080_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001195801.1|2367179_2367665_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_023214275.1|2367873_2370021_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001248130.1|2370020_2371331_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030902.1|2371508_2371793_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001518618.1|2372163_2373471_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776787.1|2373531_2374287_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000377772.1|2374575_2375517_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	88.2	1.4e-147
2375653:2375669	attL	CTGCAGGGGACACCATT	NA	NA	NA	NA
WP_076732526.1|2375830_2377000_+|integrase	tyrosine-type recombinase/integrase	integrase	C6ZR22	Salmonella_phage	91.5	1.4e-213
WP_149866782.1|2377149_2377506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078056546.1|2377521_2379762_-	SGNH/GDSL hydrolase family protein	NA	A0A172JGD9	Citrobacter_phage	35.4	4.6e-104
WP_058106360.1|2379819_2382297_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	88.3	0.0e+00
WP_058106361.1|2382283_2382649_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	92.4	6.4e-64
WP_076732531.1|2382662_2383133_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	1.2e-78
WP_058106362.1|2383132_2383630_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	88.5	1.4e-85
WP_078056551.1|2383629_2385951_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	54.8	3.5e-139
WP_058106365.1|2386734_2387406_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	48.9	3.8e-54
WP_023314032.1|2387463_2388207_-	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	86.1	4.5e-72
WP_032648620.1|2388269_2388653_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
WP_174330914.1|2388692_2389229_-	HNH endonuclease	NA	A0A2I7S6L5	Vibrio_phage	42.0	3.6e-31
WP_058106367.1|2389337_2389802_-	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	51.0	7.7e-30
WP_058106368.1|2389804_2390155_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	5.8e-38
WP_076732537.1|2390154_2390823_-	GIY-YIG nuclease family protein	NA	A0A292GBW5	Xanthomonas_phage	42.2	1.6e-07
WP_058106370.1|2390927_2391098_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_058106372.1|2391763_2392147_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	75.6	1.2e-47
WP_058106373.1|2392223_2392589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076732540.1|2392598_2393696_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	77.2	1.7e-160
WP_032648633.1|2393705_2394140_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	74.3	5.1e-52
WP_076732543.1|2394143_2395340_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	48.5	1.8e-91
WP_076732547.1|2395462_2396470_-|capsid	minor capsid protein	capsid	F1C5D8	Cronobacter_phage	69.5	2.2e-114
WP_076732550.1|2396396_2397866_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.2	2.6e-148
WP_076732553.1|2397878_2399351_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	4.5e-249
WP_058106374.1|2399350_2399866_-	hypothetical protein	NA	A0A0H5AUE2	Pseudomonas_phage	62.1	5.2e-51
WP_033486587.1|2399869_2400073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032105111.1|2400449_2400728_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	50.6	6.7e-13
WP_058106375.1|2400724_2401267_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	70.9	9.2e-75
WP_001514184.1|2401269_2401545_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_048244398.1|2401541_2401943_-	membrane protein	NA	NA	NA	NA	NA
WP_076732556.1|2402447_2403137_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	7.1e-56
WP_149866783.1|2403133_2403250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106376.1|2403246_2403429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106377.1|2403425_2404025_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	63.4	1.7e-66
WP_076732559.1|2404017_2404188_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	3.9e-16
WP_058106378.1|2404187_2404643_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	7.8e-59
WP_058106379.1|2404829_2405420_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	63.6	1.7e-21
WP_058106388.1|2405416_2405716_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	50.5	2.4e-16
WP_063850938.1|2405720_2407094_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	64.0	3.1e-167
WP_013095956.1|2408237_2408405_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	78.2	2.1e-14
WP_001514165.1|2408493_2409060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013095954.1|2409089_2409323_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	67.6	1.1e-21
WP_032656806.1|2409427_2410132_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	66.7	1.5e-88
WP_058106381.1|2410142_2410439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106389.1|2410802_2411429_+	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	57.5	6.1e-62
WP_023330696.1|2411469_2411700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106383.1|2411859_2412069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_188317947.1|2412070_2412229_+	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	92.2	6.4e-21
WP_058106384.1|2412225_2412435_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	1.1e-33
WP_022651075.1|2412507_2412792_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	96.8	1.0e-48
WP_044856898.1|2412810_2413557_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
WP_076732562.1|2413553_2414171_+	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	57.3	3.6e-59
WP_058106390.1|2414167_2414596_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.1	9.8e-72
WP_045281530.1|2414592_2414745_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	42.3	2.8e-05
WP_076732565.1|2414741_2415476_+	DNA cytosine methyltransferase	NA	A0A2I7QIW2	Vibrio_phage	50.8	3.3e-59
WP_058106391.1|2415486_2416038_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.0	6.3e-55
WP_045307574.1|2416034_2416253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045332478.1|2416249_2416816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001856439.1|2416812_2417004_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	66.1	5.4e-14
WP_058106385.1|2417095_2417314_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.9	1.6e-17
WP_076732568.1|2417407_2417785_+	DUF2591 family protein	NA	G9L6B5	Escherichia_phage	56.3	4.6e-33
WP_149866784.1|2417762_2418077_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	75.3	2.2e-28
WP_076732571.1|2417994_2418339_+	hypothetical protein	NA	I3PV00	Vibrio_phage	53.3	1.2e-22
WP_023311385.1|2418377_2418704_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	69.9	5.2e-33
WP_058106386.1|2418840_2419044_+	hypothetical protein	NA	I6RSG8	Salmonella_phage	64.2	4.1e-20
2419135:2419151	attR	CTGCAGGGGACACCATT	NA	NA	NA	NA
>prophage 7
NZ_CP019411	Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 chromosome, complete genome	4651794	2504921	2576758	4651794	integrase,capsid,terminase,tRNA,protease,tail,holin	Salmonella_phage(73.47%)	73	2511924:2511940	2591462:2591478
WP_001630219.1|2504921_2506940_-|tRNA	tRNA cytosine(34) acetyltransferase TmcA	tRNA	NA	NA	NA	NA
WP_001267519.1|2506955_2507819_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_001171630.1|2507949_2508663_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.5	9.1e-38
WP_000331870.1|2508837_2509872_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_000494020.1|2509888_2510767_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_001576288.1|2510846_2511485_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_001068686.1|2511484_2511955_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
2511924:2511940	attL	TGGTGCTGAACTGGCTG	NA	NA	NA	NA
WP_000706384.1|2512001_2513141_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.8	5.5e-45
WP_000200859.1|2513146_2514415_-	GntP family permease	NA	NA	NA	NA	NA
WP_001533732.1|2514482_2515670_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000892056.1|2515945_2517013_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000489631.1|2517220_2518684_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000132650.1|2518723_2519083_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	1.1e-18
WP_000100388.1|2519109_2519835_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000198344.1|2519905_2521195_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.6	3.9e-63
WP_000706208.1|2521282_2521909_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001656828.1|2522322_2523360_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.8	2.9e-69
WP_001028588.1|2523359_2523998_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	43.6	9.6e-31
WP_000529555.1|2524186_2526253_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_001123324.1|2526257_2527799_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_001630254.1|2527834_2530048_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_001581698.1|2530144_2530282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000075924.1|2530460_2530652_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
WP_077908867.1|2531347_2531677_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_076732575.1|2532311_2532809_-	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	64.0	1.4e-45
WP_076732578.1|2532805_2533435_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	92.3	3.8e-112
WP_016046623.1|2533424_2533733_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	100.0	2.6e-50
WP_001275998.1|2533719_2534124_-	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_076732581.1|2534281_2535385_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.5	1.4e-21
WP_003847193.1|2538143_2538404_+	hypothetical protein	NA	T1SA06	Salmonella_phage	100.0	7.6e-43
WP_058106464.1|2538719_2539424_+	Bro-N domain-containing protein	NA	A0A193GYJ9	Enterobacter_phage	79.9	8.5e-105
WP_001154802.1|2539800_2540349_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_076732584.1|2540401_2540710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076732586.1|2540719_2543194_-	hypothetical protein	NA	T1S9I6	Salmonella_phage	95.9	0.0e+00
WP_076732588.1|2543198_2545001_-	hypothetical protein	NA	T1SAQ5	Salmonella_phage	86.0	3.7e-269
WP_076732591.1|2544997_2547508_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	82.4	0.0e+00
WP_015971048.1|2547520_2548063_-	hypothetical protein	NA	Q858G1	Salmonella_phage	100.0	7.3e-72
WP_076732593.1|2548062_2548527_-	hypothetical protein	NA	T1SA73	Salmonella_phage	94.2	2.7e-83
WP_076732596.1|2548526_2551004_-	hypothetical protein	NA	Q858G3	Salmonella_phage	95.4	0.0e+00
WP_075584439.1|2551003_2551609_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	98.0	5.8e-110
WP_032636536.1|2551608_2551944_-	hypothetical protein	NA	Q858G5	Salmonella_phage	99.1	7.0e-57
WP_076732599.1|2552008_2552293_-	hypothetical protein	NA	T1SA01	Salmonella_phage	97.9	2.1e-46
WP_063150704.1|2552285_2552678_-	hypothetical protein	NA	T1SA71	Salmonella_phage	98.5	1.8e-59
WP_076732602.1|2552690_2553698_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	97.9	1.6e-189
WP_076732606.1|2553708_2554419_-	peptidase	NA	T1SAP9	Salmonella_phage	84.0	2.2e-76
WP_076732609.1|2554421_2554718_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	90.8	3.2e-45
WP_076732612.1|2554714_2556385_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	95.1	2.3e-302
WP_000334867.1|2556399_2556606_-	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
WP_076732615.1|2557272_2557707_+	hypothetical protein	NA	A0AR14	Salmonella_phage	70.1	4.5e-40
WP_076732618.1|2557801_2559283_-|terminase	terminase	terminase	M1F3C4	Salmonella_phage	97.2	3.7e-291
WP_076732620.1|2559279_2559957_-|terminase	terminase small subunit	terminase	M1F219	Salmonella_phage	80.0	7.9e-92
WP_058106474.1|2559986_2560244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106473.1|2560319_2560658_-	hypothetical protein	NA	Q858C6	Salmonella_phage	87.5	1.9e-49
WP_139386098.1|2560847_2561078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078056549.1|2561074_2562169_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	86.5	9.6e-47
WP_058106472.1|2562172_2562379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106471.1|2562976_2563324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058106470.1|2564050_2564395_-	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	94.7	2.0e-59
WP_071700937.1|2564525_2565203_-	Pyocin large subunit	NA	Q858D3	Salmonella_phage	99.1	2.2e-126
WP_076732632.1|2565192_2566263_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	76.1	2.2e-165
WP_003037808.1|2566607_2566841_-	hypothetical protein	NA	Q858D6	Salmonella_phage	100.0	5.4e-40
WP_076732635.1|2566996_2567593_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	98.5	1.7e-106
WP_076732642.1|2567971_2568274_+	hypothetical protein	NA	T1SA88	Salmonella_phage	97.0	5.0e-46
WP_076732645.1|2568270_2569092_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	98.2	4.4e-161
WP_076732648.1|2569088_2569970_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	94.2	5.6e-154
WP_015971066.1|2570019_2570268_+	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	100.0	4.0e-41
WP_058106344.1|2570377_2570677_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	97.0	4.5e-47
WP_076732651.1|2570669_2570828_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	76.9	2.8e-16
WP_058106342.1|2570824_2571955_+	site-specific DNA-methyltransferase	NA	A0A060D598	Salmonella_phage	49.2	5.6e-90
WP_058106343.1|2571951_2572203_+	hypothetical protein	NA	T1SA82	Salmonella_phage	58.3	6.0e-05
WP_076732654.1|2572205_2573453_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	95.2	1.1e-227
WP_000138296.1|2573645_2575223_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000944174.1|2575291_2576758_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
2591462:2591478	attR	TGGTGCTGAACTGGCTG	NA	NA	NA	NA
>prophage 8
NZ_CP019411	Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 chromosome, complete genome	4651794	2682425	2781782	4651794	plate,capsid,terminase,tRNA,protease,tail,holin,portal,head	Salmonella_phage(52.83%)	93	NA	NA
WP_000083343.1|2682425_2683163_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_001630400.1|2683292_2684627_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	2.7e-43
WP_000365861.1|2684644_2685544_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2685646_2686234_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2686295_2686679_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023197684.1|2686997_2687687_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	50.0	4.6e-55
WP_000997366.1|2687802_2688840_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2689043_2689463_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183645.1|2689535_2690216_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_023197685.1|2690269_2692930_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2693044_2694400_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264480.1|2694444_2694768_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807818.1|2694764_2696066_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_000985653.1|2696169_2696625_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235092.1|2702448_2705022_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992639.1|2705151_2705883_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2705879_2706860_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2706991_2707729_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2708000_2708339_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2708442_2708490_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200082.1|2708589_2709750_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210994.1|2709710_2710619_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2710676_2711798_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2711807_2712878_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212375.1|2713306_2713825_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030989.1|2713817_2715038_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2715193_2715541_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469807.1|2715581_2716349_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2716393_2716942_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2716960_2717209_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2717461_2718823_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001630424.1|2718988_2719780_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2719799_2721086_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_023136472.1|2721206_2721812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2721846_2722437_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2722559_2723438_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2723523_2725185_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2725333_2725672_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2725832_2726123_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242604.1|2726112_2726589_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2726738_2727221_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_052907311.1|2727835_2739310_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533867.1|2739374_2740784_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_023196890.1|2740780_2742961_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_072101562.1|2742968_2744132_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001072751.1|2744733_2745654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000143151.1|2745981_2746551_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.7	6.5e-87
WP_000593427.1|2746540_2747365_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	93.4	6.0e-150
WP_072002374.1|2747361_2748537_-|tail	tail fiber protein	tail	Q8HAB4	Salmonella_phage	93.1	1.1e-48
WP_052907309.1|2748523_2749111_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	4.1e-113
WP_052907308.1|2749113_2750193_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	1.2e-203
WP_000605051.1|2750185_2750599_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273652.1|2750603_2751137_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	98.3	5.5e-96
WP_001066633.1|2751136_2752195_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	5.0e-202
WP_000863824.1|2752191_2753532_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.3	2.2e-250
WP_031608922.1|2753565_2755494_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000588851.1|2755578_2755905_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	98.1	3.3e-51
WP_000515952.1|2755901_2756258_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_047590468.1|2756257_2757754_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	99.8	6.1e-278
WP_000497739.1|2757743_2757908_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_023210466.1|2757911_2758472_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	98.4	2.0e-104
WP_001135698.1|2758468_2758981_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	99.4	1.7e-91
WP_000776845.1|2758952_2759357_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	97.8	7.8e-71
WP_000927251.1|2759353_2759677_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000766105.1|2759756_2760986_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.4	8.7e-206
WP_000003793.1|2760995_2761598_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_077943548.1|2761611_2762685_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	84.4	2.3e-178
WP_153247003.1|2762797_2762959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052907306.1|2762955_2764686_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	1.2e-197
WP_052907305.1|2764685_2765123_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	62.8	4.6e-32
WP_001135218.1|2765266_2765617_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	3.6e-64
WP_001669430.1|2765731_2766589_+	trypsin-like peptidase domain-containing protein	NA	S5FV10	Shigella_phage	26.8	1.9e-10
WP_052907304.1|2766774_2767167_-	hypothetical protein	NA	A0A192Y6H8	Salmonella_phage	86.2	1.0e-54
WP_001075996.1|2767163_2767781_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	1.8e-90
WP_000226307.1|2767780_2768062_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_052907303.1|2768048_2768438_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.8	6.2e-41
WP_052907302.1|2768696_2769794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072103257.1|2769804_2770227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052907301.1|2770219_2770855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077943546.1|2770851_2771220_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	83.3	2.0e-52
WP_052907312.1|2771234_2772224_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.5	7.5e-192
WP_052907299.1|2772231_2773092_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	97.2	9.0e-157
WP_052907298.1|2773108_2773498_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	96.9	1.7e-67
WP_052907297.1|2773494_2774388_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.2	1.4e-160
WP_052907296.1|2774387_2774870_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	1.3e-85
WP_052907295.1|2774871_2775831_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.6e-117
WP_000620702.1|2775827_2776052_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_052907294.1|2776048_2777197_-	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	80.6	4.5e-164
WP_000509731.1|2777193_2777748_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2777776_2778001_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2778098_2778794_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_052907293.1|2779532_2780399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052907292.1|2780606_2781782_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.6	8.0e-148
>prophage 9
NZ_CP019411	Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 chromosome, complete genome	4651794	4061649	4150525	4651794	integrase,plate,capsid,terminase,tRNA,protease,transposase,tail,holin,portal,head	Cronobacter_phage(50.0%)	96	4093271:4093315	4123315:4123359
WP_000560969.1|4061649_4062087_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|4062131_4063073_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259011.1|4063087_4063534_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558166.1|4063530_4063842_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_001631559.1|4063927_4064857_-	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	44.4	4.4e-08
WP_001159630.1|4065074_4065386_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|4065386_4065677_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|4065723_4066653_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|4066649_4067285_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|4067281_4068184_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077905345.1|4068196_4071247_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_001059735.1|4071441_4072278_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000828042.1|4072470_4073571_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527680.1|4073926_4074250_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|4074249_4074909_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_001543608.1|4075009_4075558_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619478.1|4075646_4075961_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009253.1|4075957_4077106_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179685.1|4077232_4078060_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211469.1|4078202_4079462_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001631580.1|4079458_4080928_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217115.1|4081215_4082052_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013292.1|4082204_4083053_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063541.1|4083049_4084084_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|4084702_4085386_+	oligogalacturonate-specific porin KdgM family protein	NA	NA	NA	NA	NA
WP_000566800.1|4085543_4086851_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|4086843_4087359_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812816.1|4087377_4088361_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000122632.1|4088689_4089310_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_000559223.1|4089379_4090069_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001631612.1|4090080_4090476_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|4090526_4091900_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|4091896_4092595_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|4092745_4093246_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4093271:4093315	attL	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023388.1|4093435_4094416_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4C5	Escherichia_virus	84.7	3.4e-160
WP_000781725.1|4094485_4094779_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	77.3	2.0e-36
WP_000387892.1|4094973_4095246_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	85.6	1.3e-40
WP_024149354.1|4095248_4095473_+	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	50.0	2.3e-11
WP_000361778.1|4095494_4095878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621308.1|4095948_4096932_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	61.0	5.9e-104
WP_000256717.1|4096931_4097159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123023.1|4097155_4098079_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.5	1.2e-93
WP_052905214.1|4098071_4100708_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	37.9	3.5e-127
WP_000865155.1|4100812_4101013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120879.1|4101102_4101795_+	hypothetical protein	NA	A0A0M4S5U3	Salmonella_phage	69.1	3.9e-86
WP_000247825.1|4101821_4102097_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	57.3	3.1e-26
WP_000163093.1|4102144_4103206_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	60.7	5.2e-122
WP_001631635.1|4103202_4105014_-|terminase	Phage terminase ATPase subunit	terminase	F1BUM5	Cronobacter_phage	54.5	1.9e-185
WP_052905215.1|4105190_4106252_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	45.3	7.7e-33
WP_001177623.1|4106280_4107303_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	56.1	2.8e-96
WP_001251930.1|4107305_4108007_+|terminase	putative terminase, endonuclease subunit	terminase	F1BUM0	Cronobacter_phage	57.1	3.4e-69
WP_000016519.1|4108109_4108583_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	54.3	1.6e-30
WP_000080427.1|4108579_4109056_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_024152063.1|4109049_4109748_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.2	4.7e-71
WP_000220188.1|4109750_4110893_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	61.6	1.9e-130
WP_000140062.1|4110896_4111352_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	52.3	1.5e-38
WP_000980879.1|4111356_4111668_+|holin	holin	holin	NA	NA	NA	NA
WP_000777032.1|4111654_4111993_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	86.1	6.2e-45
WP_001245146.1|4111992_4112376_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	38.5	1.2e-12
WP_000042652.1|4112478_4112748_+|tail	putative phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_000719046.1|4112756_4112936_+	hypothetical protein	NA	A5X9I8	Aeromonas_virus	63.0	6.4e-09
WP_000018642.1|4112937_4115052_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	41.4	4.5e-141
WP_000102749.1|4115048_4115384_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	57.7	3.6e-29
WP_000136917.1|4115376_4116561_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	69.2	1.2e-154
WP_000134369.1|4116553_4117147_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.8	4.7e-72
WP_076732692.1|4117158_4119105_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	67.8	1.1e-122
WP_000143183.1|4119104_4119692_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	55.5	1.0e-58
WP_000267979.1|4119681_4120404_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	40.3	1.5e-40
WP_000083770.1|4120375_4120918_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	56.0	7.1e-43
WP_000802618.1|4120925_4122650_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	63.0	1.3e-175
WP_001077322.1|4123437_4124340_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4123315:4123359	attR	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|4124524_4125487_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_023196918.1|4125690_4126680_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750757.1|4126780_4127536_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777307.1|4127798_4129133_+	MFS transporter	NA	NA	NA	NA	NA
WP_052907451.1|4129143_4130103_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557882.1|4130112_4131153_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001528882.1|4131215_4131938_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001631663.1|4132035_4133340_+	anion permease	NA	NA	NA	NA	NA
WP_023197539.1|4133449_4134217_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001631665.1|4134329_4134926_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|4135026_4135455_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796303.1|4135561_4136308_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250624.1|4136404_4137415_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|4137526_4139035_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|4139055_4139901_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|4140299_4140539_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|4140760_4141246_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139639.1|4141338_4142268_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|4142334_4143666_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|4143675_4144206_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068805.1|4144297_4145281_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000841337.1|4145374_4146400_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001528891.1|4146554_4148753_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000715284.1|4148956_4149169_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_088137194.1|4149270_4150525_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
