The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019404	Salmonella enterica subsp. enterica serovar Bardo strain SA20113257 chromosome, complete genome	4849139	978560	985873	4849139	protease	Dickeya_phage(16.67%)	7	NA	NA
WP_001201753.1|978560_979679_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125877.1|979675_981622_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|981751_981973_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|982296_982617_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|982647_984924_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|985136_985334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|985495_985873_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 2
NZ_CP019404	Salmonella enterica subsp. enterica serovar Bardo strain SA20113257 chromosome, complete genome	4849139	1050338	1099383	4849139	holin,tail,lysis,capsid,tRNA,plate	Salmonella_phage(84.62%)	59	NA	NA
WP_000117867.1|1050338_1051739_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000762343.1|1051939_1052401_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544861.1|1052717_1053932_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893192.1|1054177_1055611_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191404.1|1055691_1056894_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1057088_1058381_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1058425_1058674_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1058714_1058954_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1058996_1060154_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017138.1|1060116_1063044_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	100.0	0.0e+00
WP_001669126.1|1063170_1063521_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	100.0	7.5e-62
WP_000917564.1|1063542_1063701_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001009038.1|1064099_1064504_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	100.0	4.2e-72
WP_000869364.1|1064633_1064870_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001538023.1|1064835_1065210_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	100.0	3.0e-64
WP_001669125.1|1065294_1066278_+	replication protein	NA	H6WRX7	Salmonella_phage	99.7	7.3e-163
WP_000800012.1|1066280_1067030_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000113621.1|1067040_1067388_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	98.3	1.5e-57
WP_000065341.1|1067384_1067786_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	100.0	2.9e-73
WP_000151011.1|1067782_1068235_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	100.0	3.8e-74
WP_000208070.1|1068231_1069041_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	100.0	4.5e-158
WP_001217670.1|1069560_1069800_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000929790.1|1070133_1070736_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096547.1|1070944_1071556_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_000801757.1|1071552_1071693_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_000993184.1|1071689_1072379_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	51.9	2.4e-59
WP_162264800.1|1072579_1072921_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_001005894.1|1072923_1073550_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	80.7	7.1e-95
WP_001050821.1|1073546_1074032_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	88.2	4.2e-71
WP_000381863.1|1074231_1074495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118125.1|1074564_1075194_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	99.5	9.3e-111
WP_001130809.1|1075196_1076819_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.3	0.0e+00
WP_000113508.1|1076818_1078285_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.6	1.2e-281
WP_077905805.1|1078172_1078910_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	99.0	6.4e-111
WP_000873180.1|1078924_1080157_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	97.6	2.0e-226
WP_000128058.1|1080161_1080659_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	100.0	3.0e-88
WP_000627464.1|1080670_1081612_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_001040702.1|1081653_1082022_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_001125673.1|1081987_1082395_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	100.0	3.8e-73
WP_000008736.1|1082391_1082946_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.8e-94
WP_001142474.1|1082932_1083322_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	97.7	6.0e-68
WP_023261525.1|1083296_1083860_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	4.7e-82
WP_023261524.1|1083863_1085009_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	2.0e-164
WP_000535993.1|1085021_1085465_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	6.0e-56
WP_001669124.1|1085468_1085921_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	81.3	3.2e-65
WP_000990863.1|1086098_1088108_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	98.5	0.0e+00
WP_000353826.1|1088107_1088683_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000155111.1|1088682_1088985_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000081751.1|1088987_1090052_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	85.9	8.8e-162
WP_024156220.1|1090054_1090780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000301076.1|1090843_1091596_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	71.7	1.2e-93
WP_001270643.1|1091595_1091949_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	97.4	2.1e-59
WP_001197094.1|1091949_1093149_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	97.7	2.2e-214
WP_000049935.1|1093145_1093826_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.2	1.4e-128
WP_023261522.1|1093825_1095487_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	57.8	7.3e-131
WP_023261776.1|1095501_1096020_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	1.9e-45
WP_065304850.1|1096887_1097022_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001669084.1|1097140_1098109_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	8.7e-193
WP_000334547.1|1098756_1099383_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
>prophage 3
NZ_CP019404	Salmonella enterica subsp. enterica serovar Bardo strain SA20113257 chromosome, complete genome	4849139	1279544	1332510	4849139	holin,tail,terminase,lysis,capsid,protease,integrase,tRNA	Salmonella_phage(51.43%)	76	1273021:1273034	1288828:1288841
1273021:1273034	attL	CAGAGCAGTGGCGA	NA	NA	NA	NA
WP_000004540.1|1279544_1280651_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476069.1|1280704_1281166_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000825956.1|1281177_1281507_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001249407.1|1281503_1282169_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444507.1|1282340_1283591_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
WP_076937888.1|1283704_1284847_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000089141.1|1284836_1285073_-	excisionase	NA	NA	NA	NA	NA
WP_001749540.1|1285689_1285920_-	hypothetical protein	NA	A0A220NQV0	Salmonella_phage	97.3	5.0e-38
WP_076937889.1|1285922_1286402_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	56.1	4.1e-42
WP_075584470.1|1286510_1287128_-	Eae-like protein	NA	Q5G8U6	Enterobacteria_phage	72.1	6.1e-75
WP_001215095.1|1287115_1287286_-	DUF2737 family protein	NA	Q5G8U5	Enterobacteria_phage	92.9	5.7e-23
WP_000773122.1|1287282_1287570_-	hypothetical protein	NA	Q5G8U4	Enterobacteria_phage	96.8	3.4e-44
WP_058108948.1|1287580_1287874_-	DUF2856 family protein	NA	Q5G8U3	Enterobacteria_phage	90.7	3.5e-44
WP_001016182.1|1287889_1288438_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
WP_000168279.1|1288446_1288953_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	99.4	2.3e-91
1288828:1288841	attR	TCGCCACTGCTCTG	NA	NA	NA	NA
WP_076937890.1|1288953_1289661_-	recombinase	NA	E7C9Q0	Salmonella_phage	97.0	8.5e-137
WP_000361564.1|1289854_1289968_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_001541875.1|1289960_1290107_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	E7C9Q3	Salmonella_phage	100.0	1.3e-20
WP_076937891.1|1290315_1290975_-	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	85.5	2.3e-80
WP_000246166.1|1291058_1291253_-	Restriction inhibitor protein ral	NA	A0A2H4FS18	Salmonella_phage	100.0	2.5e-30
WP_023200932.1|1291331_1291664_-	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	95.5	1.1e-51
WP_052934935.1|1292042_1292246_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	97.0	2.3e-26
WP_020899481.1|1292281_1293205_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	99.7	4.3e-181
WP_000712403.1|1293293_1293983_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000182204.1|1294093_1294309_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|1294419_1294701_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_119472050.1|1294735_1294882_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	97.9	2.8e-18
WP_006789497.1|1294874_1295774_+	hypothetical protein	NA	A0A220NQX5	Salmonella_phage	99.3	1.5e-154
WP_023200930.1|1295763_1297200_+	AAA family ATPase	NA	A0A220NQX0	Salmonella_phage	98.7	8.2e-272
WP_000654041.1|1297274_1297547_+	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	98.9	1.0e-42
WP_001552357.1|1297777_1298107_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	67.7	4.6e-37
WP_001640862.1|1298063_1298510_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	97.3	7.8e-80
WP_001254255.1|1298506_1298683_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_076937893.1|1298679_1299090_+	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	76.8	9.8e-53
WP_000950975.1|1299082_1299259_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	9.7e-26
WP_001108033.1|1299251_1299863_+	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.5	4.6e-99
WP_001659073.1|1299859_1300063_+	phage NinH family protein	NA	A0A075B8J4	Enterobacteria_phage	94.0	8.8e-31
WP_016048830.1|1300043_1300223_+	hypothetical protein	NA	A0A192Y814	Salmonella_phage	100.0	7.1e-24
WP_023200924.1|1300219_1300984_+	antitermination protein	NA	Q5G8R6	Enterobacteria_phage	99.2	1.1e-142
WP_000738703.1|1301427_1301754_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_046380608.1|1301737_1302175_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	1.4e-73
WP_076937894.1|1302171_1302642_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	83.3	5.7e-65
WP_076937895.1|1302859_1303549_+	Rha family transcriptional regulator	NA	Q5G8R0	Enterobacteria_phage	99.1	1.2e-124
WP_000147264.1|1303984_1304416_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	100.0	7.6e-72
WP_076937896.1|1304399_1305719_+|terminase	PBSX family phage terminase large subunit	terminase	H6WRS9	Salmonella_phage	99.3	3.5e-261
WP_052929380.1|1305851_1307204_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	99.8	1.5e-259
WP_058820360.1|1307157_1308117_+|capsid	minor capsid protein	capsid	H6WRT1	Salmonella_phage	97.8	1.8e-174
WP_076937897.1|1308132_1309395_+	hypothetical protein	NA	H6WRT2	Salmonella_phage	99.8	1.4e-238
WP_001747835.1|1309407_1309857_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	100.0	1.6e-77
WP_076937898.1|1309874_1310951_+	hypothetical protein	NA	I6RSK5	Salmonella_phage	99.4	1.3e-205
WP_076937899.1|1310960_1311149_+	glycoprotein	NA	Q5G8X9	Enterobacteria_phage	98.4	5.0e-28
WP_070818895.1|1311200_1311602_+	hypothetical protein	NA	I6S619	Salmonella_phage	95.5	2.5e-69
WP_000312329.1|1311601_1311781_+	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	100.0	8.6e-30
WP_070818894.1|1311773_1312136_+	hypothetical protein	NA	H6WRT8	Salmonella_phage	99.2	1.2e-67
WP_076937900.1|1312143_1312581_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	99.3	2.3e-76
WP_070818892.1|1312577_1312964_+	hypothetical protein	NA	I6R9A6	Salmonella_phage	98.4	3.8e-67
WP_070818891.1|1312981_1313722_+	immunoglobulin domain-containing protein	NA	H6WRU1	Salmonella_phage	98.8	5.6e-131
WP_070818890.1|1313766_1314420_+	hypothetical protein	NA	H6WRU2	Salmonella_phage	98.6	5.6e-119
WP_076937901.1|1314778_1316308_+	DUF4041 domain-containing protein	NA	Q5G8X0	Enterobacteria_phage	99.0	1.3e-166
WP_102136173.1|1316405_1316876_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	100.0	1.7e-80
WP_070818888.1|1316937_1320312_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	98.6	0.0e+00
WP_076937902.1|1320312_1320711_-	hypothetical protein	NA	Q5G8W7	Enterobacteria_phage	97.7	2.5e-69
WP_031608850.1|1320803_1321151_+|tail	phage tail protein	tail	Q5G8W6	Enterobacteria_phage	95.7	2.4e-60
WP_049836263.1|1321172_1321409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031608851.1|1321362_1321620_-	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	87.7	9.5e-30
WP_031608852.1|1321788_1322493_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.4	6.0e-135
WP_031608854.1|1322492_1323212_+	C40 family peptidase	NA	I6S1R8	Salmonella_phage	97.5	1.2e-143
WP_031608855.1|1323154_1323682_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	82.8	1.1e-64
WP_076937903.1|1323691_1326874_+|tail	phage tail protein	tail	H6WRW4	Salmonella_phage	93.3	0.0e+00
WP_052934738.1|1326882_1327842_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	96.2	2.3e-177
WP_058806116.1|1327851_1329033_+	hypothetical protein	NA	S4TSP4	Salmonella_phage	70.5	2.9e-57
WP_058806117.1|1329206_1329449_-	DinI family protein	NA	S4TND2	Salmonella_phage	87.9	9.2e-27
WP_058806118.1|1329689_1330109_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	1.4e-35
WP_058806119.1|1330111_1331380_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	98.6	5.8e-245
WP_058806120.1|1331372_1332044_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_001521673.1|1332297_1332510_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
>prophage 4
NZ_CP019404	Salmonella enterica subsp. enterica serovar Bardo strain SA20113257 chromosome, complete genome	4849139	2088892	2141283	4849139	holin,tail,terminase,lysis,capsid,head,portal,protease,integrase,plate	Salmonella_phage(74.19%)	68	2128492:2128507	2140023:2140038
WP_001157313.1|2088892_2090323_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377048.1|2090396_2091092_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.1e-07
WP_000107430.1|2091183_2091483_-	membrane protein	NA	NA	NA	NA	NA
WP_001080683.1|2092132_2093344_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.0	1.3e-108
WP_024131109.1|2093601_2093790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000187976.1|2093800_2094013_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	5.1e-21
WP_000457666.1|2094467_2095736_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	1.3e-225
WP_000394197.1|2095738_2096158_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_001532308.1|2096284_2096446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2097639_2097852_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2097848_2098262_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2098309_2098423_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2098497_2098731_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2098844_2099450_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000554735.1|2099419_2100982_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_001207832.1|2100968_2101556_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785581.1|2101558_2102638_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_000605055.1|2102630_2103044_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_001273649.1|2103048_2103582_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066632.1|2103581_2104640_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_000863828.1|2104636_2105977_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	4.4e-251
WP_001033736.1|2106036_2106486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785381.1|2106502_2108428_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_000588852.1|2108512_2108839_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515953.1|2108835_2109192_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_001007988.1|2109191_2110688_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.2	1.2e-276
WP_000497755.1|2110677_2110842_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001241332.1|2110863_2111409_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_001179802.1|2111405_2111918_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	86.5	3.1e-80
WP_001255650.1|2111889_2112303_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	3.5e-50
WP_000901160.1|2112314_2112638_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	56.5	8.3e-31
WP_001530535.1|2112637_2112898_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.9e-10
WP_000005722.1|2112941_2114159_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.4	1.4e-195
WP_000039021.1|2114168_2115017_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	4.4e-132
WP_000002707.1|2115030_2116335_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.9	6.2e-218
WP_000229716.1|2116334_2118077_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_000919034.1|2118030_2118495_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
WP_023891432.1|2118627_2118972_-	HNH endonuclease	NA	K7P6U5	Enterobacteria_phage	73.0	7.4e-46
WP_000268746.1|2119067_2119391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077906432.1|2119875_2120319_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	5.4e-57
WP_001005904.1|2120351_2120966_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	97.1	8.2e-112
WP_001668825.1|2120968_2121313_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	98.8	3.4e-43
WP_001668823.1|2122947_2123784_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	80.8	6.5e-128
WP_000609695.1|2123780_2124053_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	76.3	2.1e-27
WP_001202280.1|2124067_2125057_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	5.4e-190
WP_001061460.1|2125064_2125925_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	2.1e-161
WP_000779148.1|2125941_2126331_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_000200164.1|2126339_2127221_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	100.0	1.3e-171
WP_000054228.1|2127217_2127691_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_072600588.1|2127687_2128662_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	99.4	2.6e-168
2128492:2128507	attL	ATCAGCCTGTTTTTTG	NA	NA	NA	NA
WP_000620702.1|2128658_2128883_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087404.1|2128879_2130022_-	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000509731.1|2130018_2130573_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2130601_2130826_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2130923_2131619_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2131824_2132163_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2132125_2132350_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2132889_2133261_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2133318_2134146_+	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008353.1|2134282_2134822_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	99.4	1.3e-97
WP_000215886.1|2134892_2135426_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2135427_2135685_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000208069.1|2135695_2136529_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	99.6	4.0e-162
WP_001061334.1|2136532_2137102_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_001527041.1|2137141_2137369_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|2137370_2138360_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598921.1|2138651_2139449_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001219023.1|2140758_2141283_+	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
2140023:2140038	attR	CAAAAAACAGGCTGAT	NA	NA	NA	NA
>prophage 5
NZ_CP019404	Salmonella enterica subsp. enterica serovar Bardo strain SA20113257 chromosome, complete genome	4849139	2234426	2244933	4849139		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126352.1|2234426_2235740_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565902.1|2235766_2236846_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000648783.1|2236850_2237624_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018224.1|2237639_2238614_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973714.1|2238619_2239171_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000857530.1|2239171_2240050_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_001023659.1|2240097_2240997_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697840.1|2240996_2242082_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2242458_2243352_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111836.1|2243529_2244933_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 6
NZ_CP019404	Salmonella enterica subsp. enterica serovar Bardo strain SA20113257 chromosome, complete genome	4849139	2319431	2328602	4849139	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2319431_2321465_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2321705_2322164_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001265355.1|2322335_2322866_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2322922_2323390_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2323436_2324156_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2324152_2325838_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2326060_2326792_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2326851_2326959_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2326939_2327671_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|2327654_2328602_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
NZ_CP019404	Salmonella enterica subsp. enterica serovar Bardo strain SA20113257 chromosome, complete genome	4849139	2795428	2898696	4849139	holin,tail,terminase,transposase,portal,protease,tRNA	Enterobacteria_phage(28.57%)	95	NA	NA
WP_000083347.1|2795428_2796166_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2796295_2797630_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_024133293.1|2797647_2798547_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188410.1|2798649_2799237_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2799298_2799682_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2800000_2800690_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997374.1|2800805_2801843_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2802046_2802466_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183642.1|2802538_2803219_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082639.1|2803272_2805933_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2806047_2807403_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2807447_2807771_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807810.1|2807767_2809069_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	9.1e-44
WP_000985653.1|2809172_2809628_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235092.1|2815456_2818030_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992632.1|2818159_2818891_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2818887_2819868_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2819999_2820737_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2821008_2821347_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2821450_2821498_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200080.1|2821597_2822758_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210990.1|2822718_2823627_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225185.1|2823684_2824806_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2824815_2825886_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2826325_2826844_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2826836_2828057_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2828213_2828561_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469812.1|2828601_2829369_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2829413_2829962_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2829980_2830229_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2830572_2831934_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2832099_2832891_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2832910_2834197_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287924.1|2834317_2834923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2834957_2835548_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059160.1|2835670_2836549_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2836634_2838296_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2838444_2838783_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2838948_2839239_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2839228_2839705_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2839854_2840337_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237683.1|2840951_2852426_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533845.1|2852490_2853900_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196135.1|2853896_2856077_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000342601.1|2856084_2857248_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_072600494.1|2857976_2859182_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_072600492.1|2859369_2859759_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	71.3	1.1e-50
WP_000497432.1|2860079_2860322_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	3.4e-29
WP_001272641.1|2860545_2861727_-	hypothetical protein	NA	S4TSP4	Salmonella_phage	68.9	1.2e-55
WP_001113924.1|2861737_2862697_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	94.4	2.1e-175
WP_001162257.1|2862698_2865902_-	host specificity protein J	NA	O64335	Escherichia_phage	88.7	0.0e+00
WP_000659016.1|2865955_2866561_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	97.0	1.4e-100
WP_000709674.1|2866604_2866946_-	hypothetical protein	NA	K7PLP0	Enterobacteria_phage	92.9	5.6e-54
WP_001249174.1|2866975_2867686_-	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	90.7	1.1e-136
WP_000056207.1|2867687_2868443_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	85.3	1.8e-129
WP_000963482.1|2868439_2868787_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	69.6	1.0e-39
WP_000079422.1|2868790_2871307_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	69.2	1.0e-309
WP_071529728.1|2871284_2871605_-|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	2.1e-34
WP_000479023.1|2871613_2872021_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	57.9	3.8e-25
WP_000211139.1|2872057_2872795_-	Ig-like domain-containing protein	NA	O64327	Escherichia_phage	66.9	3.6e-90
WP_000797819.1|2872802_2873201_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	62.0	6.8e-43
WP_000023109.1|2873197_2873752_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	76.7	2.4e-62
WP_000933904.1|2873764_2874040_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	61.5	2.6e-25
WP_001097009.1|2874032_2874359_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	60.2	2.4e-30
WP_001125851.1|2874450_2876475_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.7	0.0e+00
WP_000054308.1|2876419_2877928_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	86.7	4.2e-258
WP_001082414.1|2877924_2878140_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	82.9	1.5e-25
WP_001118990.1|2878136_2880239_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	86.6	0.0e+00
WP_001670093.1|2880238_2880727_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	90.7	6.3e-75
WP_000761930.1|2880910_2881237_-	hypothetical protein	NA	M9NZE9	Enterobacteria_phage	80.0	2.9e-07
WP_000120194.1|2881746_2882061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100261.1|2882152_2882383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522146.1|2882523_2882793_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	69.0	2.2e-21
WP_072600490.1|2882800_2883415_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.4	5.5e-92
WP_000250463.1|2883414_2883696_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.0	3.1e-18
WP_001283171.1|2883682_2884069_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	93.0	1.0e-56
WP_076937917.1|2884230_2884671_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	4.3e-14
WP_000417508.1|2884857_2885433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609697.1|2885623_2886193_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	54.4	1.5e-46
WP_003034741.1|2887904_2888291_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	89.1	4.1e-61
WP_072600486.1|2888287_2889607_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	52.5	8.7e-119
WP_072600484.1|2889603_2890461_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	96.6	2.0e-60
WP_003034732.1|2890450_2890630_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	3.0e-14
WP_045445262.1|2890802_2891354_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	53.5	7.0e-46
WP_072600482.1|2891364_2891610_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	54.3	1.0e-17
WP_072600479.1|2891707_2892400_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	70.9	3.2e-88
WP_070810426.1|2893428_2893800_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	85.4	3.6e-54
WP_070810427.1|2893856_2894684_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	94.2	8.4e-144
WP_000120457.1|2894812_2895352_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	81.0	9.5e-80
WP_001253786.1|2895339_2895516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000125081.1|2895512_2895827_+	hypothetical protein	NA	I6RSM9	Salmonella_phage	85.0	3.4e-21
WP_000840609.1|2895826_2896300_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.1	1.1e-66
WP_000210516.1|2896303_2896744_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	40.3	3.1e-12
WP_001061331.1|2896745_2897315_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.3	3.7e-90
WP_000537359.1|2897520_2898696_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.4	1.4e-147
>prophage 8
NZ_CP019404	Salmonella enterica subsp. enterica serovar Bardo strain SA20113257 chromosome, complete genome	4849139	4213068	4305903	4849139	protease,holin,tail,plate,lysis,capsid,head,portal,terminase,integrase,tRNA	Salmonella_phage(45.45%)	103	4245977:4246023	4275995:4276041
WP_000560974.1|4213068_4213506_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|4213550_4214492_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259012.1|4214506_4214953_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558159.1|4214949_4215261_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_001127707.1|4215346_4216276_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001159635.1|4216493_4216805_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|4216805_4217096_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_076937926.1|4217142_4218072_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|4218068_4218704_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|4218700_4219603_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077248424.1|4219615_4222666_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_001059739.1|4222860_4223697_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710968.1|4223964_4224996_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000527676.1|4226634_4226958_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|4226957_4227617_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_001517951.1|4227717_4228266_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619477.1|4228354_4228669_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009256.1|4228665_4229814_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179700.1|4229940_4230768_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211476.1|4230910_4232170_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000143970.1|4232166_4233636_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|4233923_4234760_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013290.1|4234912_4235761_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063541.1|4235757_4236792_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378723.1|4237410_4238094_+	oligogalacturonate-specific porin KdgM family protein	NA	NA	NA	NA	NA
WP_000566800.1|4238251_4239559_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|4239551_4240067_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812816.1|4240085_4241069_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000122632.1|4241397_4242018_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_000559216.1|4242087_4242777_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133449.1|4242788_4243184_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|4243234_4244608_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|4244604_4245303_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|4245453_4245954_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4245977:4246023	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_001526255.1|4246138_4247119_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	97.9	2.4e-182
WP_001017512.1|4247188_4247482_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	100.0	4.0e-48
WP_000453532.1|4247617_4247890_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	100.0	5.3e-47
WP_000217670.1|4248059_4248560_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4248623_4248848_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001526254.1|4248847_4249150_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	99.0	5.9e-47
WP_001113264.1|4249149_4249374_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|4249370_4249646_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001526225.1|4249635_4251915_+	replication endonuclease	NA	Q858T4	Yersinia_virus	96.7	0.0e+00
WP_001526224.1|4252153_4254637_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000517958.1|4255016_4256063_-|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
WP_076937928.1|4256062_4257832_-|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.8	0.0e+00
WP_001085936.1|4257997_4258852_+|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	98.6	8.9e-157
WP_052894588.1|4258927_4259995_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	89.5	3.0e-178
WP_052894587.1|4259998_4260748_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	86.7	2.2e-111
WP_023172566.1|4260841_4261348_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	98.2	9.5e-90
WP_000868400.1|4261347_4261551_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
WP_000134660.1|4261554_4261851_+|holin	phage holin family protein	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
WP_072600779.1|4261837_4262335_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	97.6	8.4e-91
WP_072600777.1|4262331_4262745_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	70.8	3.7e-44
WP_072105331.1|4262716_4262890_+|lysis	phage lysis protein	lysis	O80311	Escherichia_phage	96.5	1.8e-24
WP_072600775.1|4262852_4263320_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	98.7	4.6e-83
WP_072600773.1|4263312_4263762_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	96.0	1.9e-70
WP_072600770.1|4263830_4264472_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.2	3.2e-111
WP_072600768.1|4264468_4264816_+	GPW/gp25 family protein	NA	O80315	Escherichia_phage	95.7	1.5e-54
WP_024157126.1|4264822_4265731_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	98.7	2.0e-159
WP_072600765.1|4265723_4266254_+|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	99.4	1.6e-103
WP_072600763.1|4266264_4268007_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	98.6	1.4e-270
WP_072600761.1|4268006_4268576_+|tail	tail fiber assembly protein	tail	A0A0M4QWM3	Salmonella_phage	98.4	4.4e-104
WP_001279030.1|4268710_4269898_+|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_001207675.1|4269913_4270432_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001029727.1|4270493_4270829_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_085984508.1|4270825_4270981_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_072600759.1|4270973_4273415_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	98.5	0.0e+00
WP_070811924.1|4273427_4273913_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	98.8	2.6e-84
WP_001526245.1|4273909_4275079_+	phage late control D family protein	NA	S4TRX8	Salmonella_phage	96.9	2.3e-208
WP_000468311.1|4275156_4275375_+	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000468356.1|4275425_4275833_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	100.0	1.6e-71
WP_001077320.1|4276119_4277022_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4275995:4276041	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|4277206_4278169_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758710.1|4278372_4279362_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750756.1|4279462_4280218_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777314.1|4280480_4281815_+	MFS transporter	NA	NA	NA	NA	NA
WP_000646502.1|4281825_4282785_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557882.1|4282794_4283835_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001533426.1|4283897_4284620_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000060999.1|4284717_4284888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076937929.1|4285124_4285475_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113083.1|4285488_4287081_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001283049.1|4287167_4288127_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167248.1|4288382_4289918_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_000911134.1|4289911_4290955_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981831.1|4290951_4291953_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090742.1|4291981_4293004_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774146.1|4293032_4293908_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001667977.1|4293990_4294281_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088049.1|4294290_4295055_+	epimerase	NA	NA	NA	NA	NA
WP_001216335.1|4295146_4295914_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802241.1|4296026_4296623_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|4296723_4297152_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796303.1|4297258_4298005_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250617.1|4298101_4299112_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|4299223_4300732_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|4300752_4301598_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|4301996_4302236_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|4302457_4302943_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139637.1|4303035_4303965_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|4304031_4305363_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|4305372_4305903_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 9
NZ_CP019404	Salmonella enterica subsp. enterica serovar Bardo strain SA20113257 chromosome, complete genome	4849139	4424561	4469336	4849139	holin,plate,tail,tRNA	Burkholderia_phage(36.36%)	47	NA	NA
WP_001177097.1|4424561_4425077_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
WP_000368203.1|4425086_4426568_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_000359500.1|4426570_4427203_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4427195_4428311_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4428301_4428661_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095009.1|4428824_4430372_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.5e-48
WP_000703628.1|4430371_4431301_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_000593182.1|4431297_4431660_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679389.1|4431987_4432710_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000818150.1|4432719_4433763_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	3.8e-77
WP_001269716.1|4433750_4433960_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271425.1|4433959_4434913_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262492.1|4434912_4437264_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.3	3.4e-65
WP_001185654.1|4437360_4437489_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003635.1|4437448_4437766_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4437817_4438342_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729853.1|4438341_4439769_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
WP_000875314.1|4439758_4439956_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449399.1|4439952_4440408_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|4440567_4440882_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001203711.1|4440894_4441500_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	9.3e-60
WP_001226439.1|4441502_4441790_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615248.1|4442366_4442714_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136394.1|4442844_4444194_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790042.1|4444538_4446188_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|4446631_4446874_+	outer membrane protein	NA	NA	NA	NA	NA
WP_123220402.1|4446907_4447576_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000977968.1|4447572_4448310_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750804.1|4448309_4450406_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|4450548_4450959_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252085.1|4451124_4452015_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382573.1|4452029_4453574_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695415.1|4453705_4454896_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_072600747.1|4455256_4456366_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973642.1|4456454_4457813_+	maltoporin	NA	NA	NA	NA	NA
WP_000782497.1|4457976_4458894_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019231.1|4459074_4459572_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|4459585_4460458_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|4460556_4462977_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|4463147_4463516_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|4463624_4464233_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128118.1|4464411_4465737_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001575282.1|4465733_4465847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|4465868_4466078_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416272.1|4466177_4466693_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039337.1|4466939_4468250_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001182219.1|4468337_4469336_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
