The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019403	Salmonella enterica subsp. enterica serovar Apapa str. SA20060561 chromosome, complete genome	4801658	982523	990405	4801658	protease,transposase	Dickeya_phage(16.67%)	6	NA	NA
WP_076932675.1|982523_983642_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	37.2	5.3e-08
WP_076932676.1|983638_985585_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|985714_985936_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|986259_986580_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|986610_988887_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_149866934.1|989295_990405_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	6.4e-06
>prophage 2
NZ_CP019403	Salmonella enterica subsp. enterica serovar Apapa str. SA20060561 chromosome, complete genome	4801658	2038156	2045424	4801658		Morganella_phage(33.33%)	8	NA	NA
WP_076932906.1|2038156_2039587_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_076932907.1|2039660_2040356_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.2	7.3e-08
WP_000107435.1|2040435_2040747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076932908.1|2041396_2042608_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.7	4.9e-108
WP_024131109.1|2042866_2043055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2043065_2043278_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457658.1|2043733_2045002_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000394196.1|2045004_2045424_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 3
NZ_CP019403	Salmonella enterica subsp. enterica serovar Apapa str. SA20060561 chromosome, complete genome	4801658	2129327	2138747	4801658		Paramecium_bursaria_Chlorella_virus(16.67%)	8	NA	NA
WP_076932937.1|2129327_2130494_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.8	1.4e-115
WP_076932938.1|2130735_2132142_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
WP_076932939.1|2132452_2133265_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_149866937.1|2133345_2134713_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.2	2.9e-32
WP_079842010.1|2134716_2136165_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.4	5.5e-58
WP_078058936.1|2136157_2136658_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001041701.1|2136660_2137626_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	7.9e-85
WP_076932941.1|2137628_2138747_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.3	3.1e-133
>prophage 4
NZ_CP019403	Salmonella enterica subsp. enterica serovar Apapa str. SA20060561 chromosome, complete genome	4801658	2156147	2197385	4801658	integrase,tail,holin,plate,transposase,capsid	Burkholderia_virus(36.36%)	54	2186949:2186966	2193133:2193150
WP_000605946.1|2156147_2157590_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.7	9.4e-50
WP_076932952.1|2157586_2158810_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_078058940.1|2158806_2159280_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001041701.1|2159282_2160248_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	7.9e-85
WP_000048160.1|2160250_2161372_-	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	6.9e-133
WP_076932955.1|2161524_2162106_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	72.1	1.7e-66
WP_076933598.1|2162574_2163048_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.4	3.8e-24
WP_076933599.1|2163019_2163442_-|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	68.3	3.2e-14
WP_076932957.1|2164708_2165287_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.3	1.4e-65
WP_076932958.1|2165279_2166383_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	54.6	5.2e-109
WP_076932959.1|2166373_2166721_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	61.5	3.0e-34
WP_076932960.1|2166776_2167373_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	44.9	8.1e-24
WP_076932961.1|2167369_2168539_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	49.1	1.7e-86
WP_188318318.1|2168526_2168739_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	2.6e-17
WP_076932963.1|2168738_2169623_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.5	4.0e-51
WP_076932964.1|2169622_2172091_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	40.4	1.0e-160
WP_114683004.1|2172166_2172307_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_076932965.1|2172248_2172584_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_170876608.1|2172689_2173214_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.4	4.7e-68
WP_076932967.1|2173210_2174638_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	77.6	1.8e-215
WP_076932968.1|2174627_2174894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076932969.1|2174893_2175358_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	51.0	2.6e-38
WP_076932970.1|2175357_2175804_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	1.6e-32
WP_076932971.1|2175805_2176162_-	DUF2190 family protein	NA	Q6QIB4	Burkholderia_phage	53.9	3.4e-17
WP_076932972.1|2176172_2177126_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	45.0	1.8e-65
WP_076932973.1|2177139_2178237_-	peptidase	NA	A4JWJ9	Burkholderia_virus	49.6	1.9e-95
WP_057069301.1|2178441_2178909_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	41.7	2.6e-25
WP_076932974.1|2178911_2179733_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	60.1	1.9e-95
WP_076932975.1|2179713_2181210_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	60.3	1.1e-170
WP_076932976.1|2181209_2182733_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	61.0	4.1e-181
WP_076932977.1|2182729_2183275_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	68.7	5.5e-59
WP_076932978.1|2183274_2183586_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	2.1e-31
WP_076932979.1|2183578_2183911_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	46.7	7.0e-17
WP_076932980.1|2183907_2184558_-	hypothetical protein	NA	Q5ZQY9	Pseudomonas_phage	30.9	6.8e-08
WP_076933600.1|2184541_2185270_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.2	1.7e-63
WP_076932981.1|2185284_2185635_-|holin	putative holin	holin	A4JWP3	Burkholderia_virus	51.3	4.5e-22
WP_076932982.1|2185773_2186322_-	hypothetical protein	NA	Q6QID0	Burkholderia_phage	61.9	1.4e-51
WP_076932983.1|2186728_2187499_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	66.5	5.3e-100
2186949:2186966	attL	AGTTTGTCCGCCAGTTCA	NA	NA	NA	NA
WP_076932984.1|2187537_2187972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076932985.1|2187995_2188532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139386933.1|2188545_2188962_-	helix-turn-helix domain-containing protein	NA	Q5ZQZ8	Pseudomonas_phage	51.6	4.5e-13
WP_054830067.1|2189054_2189243_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.3e-16
WP_059347720.1|2189298_2189604_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	1.6e-23
WP_076932986.1|2189613_2190522_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	54.7	6.9e-75
WP_076932987.1|2190525_2192295_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	67.5	6.9e-228
WP_076932988.1|2192305_2193463_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.9	9.0e-120
2193133:2193150	attR	TGAACTGGCGGACAAACT	NA	NA	NA	NA
WP_076932989.1|2193465_2193735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076932990.1|2193752_2194364_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.0	1.0e-74
WP_076932991.1|2194441_2194630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076932992.1|2194796_2195000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076932993.1|2195003_2195690_+	hypothetical protein	NA	A0A2H4FNA7	Salmonella_phage	31.3	3.3e-13
WP_076932994.1|2195676_2196369_+	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	33.8	2.2e-25
WP_076932996.1|2196573_2196999_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	47.4	4.7e-26
WP_076932997.1|2196995_2197385_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	52.5	4.9e-30
>prophage 5
NZ_CP019403	Salmonella enterica subsp. enterica serovar Apapa str. SA20060561 chromosome, complete genome	4801658	2263050	2272221	4801658	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195334.1|2263050_2265084_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_076933013.1|2265324_2265783_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	1.1e-52
WP_001197951.1|2265954_2266485_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2266541_2267009_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2267055_2267775_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2267771_2269457_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2269679_2270411_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2270470_2270578_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2270558_2271290_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_076933014.1|2271273_2272221_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 6
NZ_CP019403	Salmonella enterica subsp. enterica serovar Apapa str. SA20060561 chromosome, complete genome	4801658	2749532	2884439	4801658	transposase,integrase,portal,tail,terminase,holin,plate,lysis,tRNA,head,capsid	Salmonella_phage(80.21%)	138	2842324:2842368	2878185:2878229
WP_020899102.1|2749532_2750270_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2750399_2751734_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000365859.1|2751751_2752651_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_076933087.1|2752753_2753341_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2753402_2753786_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2754104_2754794_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2754909_2755947_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2756157_2756577_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183647.1|2756649_2757330_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_076933088.1|2757383_2760044_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2760158_2761514_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_023138101.1|2761558_2761882_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_076933089.1|2761878_2763180_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	3.4e-43
WP_000985653.1|2763283_2763739_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235092.1|2769832_2772406_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992639.1|2772535_2773267_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_023216379.1|2773263_2774244_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2774375_2775113_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2775384_2775723_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2775826_2775874_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200080.1|2775973_2777134_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_076933091.1|2777094_2778003_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2778060_2779182_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_076933092.1|2779191_2780262_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	5.3e-90
WP_076933093.1|2780701_2781220_+	YfiR family protein	NA	NA	NA	NA	NA
WP_076933094.1|2781212_2782433_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001749811.1|2782689_2783739_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	100.0	8.8e-207
WP_001749810.1|2783761_2784100_-	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	100.0	3.1e-60
WP_001749809.1|2784108_2784969_-	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	100.0	1.4e-165
WP_001749808.1|2785090_2785462_+	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	100.0	4.7e-62
WP_076933095.1|2785494_2786004_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	99.4	3.6e-89
WP_001749807.1|2786011_2786239_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	100.0	6.4e-38
WP_024139157.1|2786225_2786426_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	100.0	2.3e-31
WP_001246237.1|2786495_2786723_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
WP_076933096.1|2786722_2786944_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	98.6	1.2e-33
WP_076933097.1|2786944_2787223_+	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	100.0	1.2e-46
WP_076933098.1|2787226_2788057_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	100.0	6.2e-163
WP_076933099.1|2788053_2790276_+	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	99.5	0.0e+00
WP_000232650.1|2790393_2790576_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
WP_001222153.1|2790579_2790813_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	100.0	2.1e-36
WP_000517959.1|2791820_2792867_-|portal	phage portal protein	portal	A0A0M4S6E8	Salmonella_phage	100.0	4.0e-191
WP_076933100.1|2792866_2794636_-|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	99.8	0.0e+00
WP_076933101.1|2794801_2795656_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	98.9	2.3e-157
WP_001247243.1|2795732_2796800_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
WP_000203472.1|2796803_2797553_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	98.4	1.5e-128
WP_000214255.1|2797646_2798153_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_058671907.1|2798152_2798356_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	98.5	4.0e-31
WP_076933102.1|2798359_2798656_+|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	98.0	2.4e-45
WP_001144116.1|2798642_2799140_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_000866102.1|2799136_2799550_+|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	100.0	2.6e-45
WP_001394645.1|2799521_2799695_+	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_001169074.1|2799657_2800125_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_076933103.1|2800117_2800567_+	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	98.0	2.7e-72
WP_076933104.1|2800635_2801277_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	99.5	2.4e-114
WP_000127148.1|2801273_2801621_+	GPW/gp25 family protein	NA	S4TRW8	Salmonella_phage	100.0	2.5e-57
WP_000246677.1|2801627_2802536_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	100.0	2.6e-162
WP_010835760.1|2802528_2803059_+|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	100.0	3.5e-103
WP_076933105.1|2803069_2804746_+|tail	tail fiber protein	tail	A0A1S6KZZ8	Salmonella_phage	62.2	3.7e-183
WP_076933106.1|2804748_2805282_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	96.0	1.4e-91
WP_076933107.1|2805416_2806595_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	99.0	1.1e-221
WP_076933108.1|2806610_2807129_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	98.8	1.2e-92
WP_001029726.1|2807191_2807527_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	100.0	1.4e-52
WP_085984508.1|2807523_2807679_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_023888556.1|2807671_2810116_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	99.9	0.0e+00
WP_001749785.1|2810130_2810616_+|tail	phage tail protein	tail	A0A0M4RCP0	Salmonella_phage	100.0	3.6e-86
WP_023888554.1|2810612_2811782_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	100.0	3.4e-215
WP_000972010.1|2811857_2812076_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
WP_000065257.1|2812220_2812568_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469813.1|2812608_2813376_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2813420_2813969_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2813987_2814236_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_001518348.1|2814397_2815117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460052.1|2815252_2816614_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2816779_2817571_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2817590_2818877_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_076933109.1|2818997_2819603_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_001518875.1|2819637_2820228_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2820351_2821230_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2821315_2822977_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2823125_2823464_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2823629_2823920_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2823909_2824386_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2824535_2825018_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_076933110.1|2825637_2837112_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533865.1|2837176_2838586_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_076933111.1|2838582_2840763_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_072101394.1|2840770_2841934_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
2842324:2842368	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
WP_000980503.1|2842484_2842700_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.8	3.6e-22
WP_076933112.1|2842767_2843871_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.4	3.3e-180
WP_076933113.1|2843867_2844353_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	87.6	3.8e-72
WP_076933114.1|2844349_2847157_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.0	0.0e+00
WP_000763316.1|2847149_2847269_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280962.1|2847283_2847586_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_001207652.1|2847640_2848156_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_076933115.1|2848165_2849338_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.7e-222
WP_001165558.1|2849440_2849998_-	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.4	5.5e-99
WP_023262362.1|2850027_2851017_+	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	95.7	4.3e-187
WP_077908642.1|2850986_2851604_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	98.5	1.4e-111
WP_076933116.1|2851607_2852147_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	97.8	2.1e-95
WP_188318321.1|2852149_2853001_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	98.6	5.4e-162
WP_023138919.1|2853801_2854407_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	99.0	5.8e-118
WP_023138920.1|2854399_2855308_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	99.3	2.2e-158
WP_000177408.1|2855294_2855654_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_001672413.1|2855650_2856229_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_024148874.1|2856302_2856947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023138922.1|2856948_2858040_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	31.2	1.4e-18
WP_023138923.1|2858058_2858505_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	80.4	1.5e-59
WP_001039961.1|2858497_2858929_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_024133383.1|2859024_2859453_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	98.6	1.5e-67
WP_000731036.1|2859449_2859827_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	100.0	8.1e-62
WP_001069919.1|2859831_2860341_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
WP_023138924.1|2860321_2860537_-|holin	holin family protein	holin	E5G6N0	Salmonella_phage	98.6	1.3e-32
WP_023138925.1|2860540_2860744_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	2.5e-33
WP_000673535.1|2860743_2861208_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	4.2e-84
WP_076933117.1|2861301_2861952_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	99.1	2.4e-114
WP_023138927.1|2861955_2863020_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	99.4	2.7e-195
WP_023171079.1|2863036_2863870_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	100.0	9.3e-135
WP_076933118.1|2864011_2865778_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.8	0.0e+00
WP_078058946.1|2865777_2866809_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	95.0	6.0e-192
WP_076933120.1|2866835_2867813_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	32.7	1.2e-24
WP_014344393.1|2867802_2868285_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_130548645.1|2868776_2869061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130548646.1|2869121_2869376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076933122.1|2869372_2869837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064035045.1|2870159_2870348_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	93.5	6.7e-25
WP_076933123.1|2870503_2872915_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.0	0.0e+00
WP_001749757.1|2872905_2873763_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
WP_000785509.1|2873759_2873987_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_001244234.1|2873986_2874220_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000963195.1|2874287_2874629_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_000166366.1|2874848_2875307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957775.1|2875254_2875488_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_001749756.1|2875495_2876005_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	3.5e-84
WP_023225961.1|2876037_2876286_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	70.7	8.9e-25
WP_076933124.1|2876405_2877038_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	56.2	2.1e-62
WP_001585446.1|2877041_2878067_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.9	4.0e-196
WP_076933125.1|2881758_2882907_-	hypothetical protein	NA	NA	NA	NA	NA
2878185:2878229	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
WP_149866938.1|2883329_2884439_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	4.9e-06
