The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019406	Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 chromosome, complete genome	4693979	935015	942328	4693979	integrase,protease	Dickeya_phage(16.67%)	7	923753:923767	942546:942560
923753:923767	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|935015_936134_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|936130_938077_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|938206_938428_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|938751_939072_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|939102_941379_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|941591_941789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|941950_942328_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942546:942560	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP019406	Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 chromosome, complete genome	4693979	992787	1092650	4693979	portal,integrase,protease,terminase,lysis,capsid,tail,tRNA,head	Salmonella_phage(39.66%)	103	988412:988427	1018356:1018371
988412:988427	attL	CGGAAAAAGACGCGGT	NA	NA	NA	NA
WP_001154025.1|992787_993591_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|993583_994906_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|994886_995591_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572746.1|995590_1000057_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925870.1|1000401_1002252_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1002511_1003060_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1003087_1003735_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_058106851.1|1003796_1004987_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977709.1|1005171_1006263_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117867.1|1006856_1008257_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000762342.1|1008457_1008919_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544855.1|1009236_1010451_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893200.1|1010696_1012133_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191404.1|1012210_1013413_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262311.1|1013607_1014900_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.3e-252
WP_000065276.1|1014944_1015193_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1015233_1015473_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1015515_1016673_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_051124479.1|1016635_1019563_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	98.8	0.0e+00
1018356:1018371	attR	ACCGCGTCTTTTTCCG	NA	NA	NA	NA
WP_022742800.1|1019689_1020040_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_000917563.1|1020061_1020220_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_038988958.1|1020848_1021220_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	1.5e-31
WP_023226317.1|1021197_1022259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015406390.1|1022328_1022724_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_051124477.1|1022828_1023065_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	71.8	2.6e-26
WP_010835408.1|1023030_1023405_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_072208318.1|1023496_1023685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077946708.1|1023699_1024755_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	53.2	4.9e-40
WP_076734505.1|1024757_1025507_+	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	99.6	3.3e-139
WP_000113626.1|1025517_1025865_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
WP_000065089.1|1025861_1026182_+	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
WP_000974174.1|1026181_1026427_+	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
WP_000132543.1|1026737_1027955_+	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
WP_107251218.1|1027935_1028004_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_000802853.1|1028097_1028424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1028671_1028905_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1029021_1029270_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1029304_1029907_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_051124475.1|1030115_1030727_+	protein ninG	NA	A0A0M4RU10	Salmonella_phage	96.6	7.9e-91
WP_000801757.1|1030723_1030864_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_051124474.1|1030860_1031541_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	1.4e-59
WP_001534381.1|1031850_1032039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526513.1|1032241_1032544_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024798992.1|1032521_1033010_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	1.0e-56
WP_099800562.1|1033030_1033471_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.0	6.2e-53
WP_000867564.1|1033939_1034485_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_021000150.1|1034456_1036391_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	66.1	7.0e-258
WP_000224407.1|1036374_1036578_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	80.0	1.0e-18
WP_000820305.1|1036574_1038161_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	6.4e-185
WP_023233092.1|1038150_1039665_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	51.8	2.1e-100
WP_000143301.1|1039664_1040012_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	4.6e-19
WP_058106856.1|1040066_1041095_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	58.1	9.2e-108
WP_000448213.1|1041158_1041533_+	DNA breaking-rejoining protein	NA	A0A2R9YJP4	Escherichia_phage	34.9	4.8e-06
WP_000083787.1|1041543_1041900_+|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	58.5	1.8e-31
WP_000053601.1|1041909_1042509_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	68.7	8.3e-69
WP_001032919.1|1042508_1042910_+	hypothetical protein	NA	A0A291AWY2	Escherichia_phage	59.8	8.1e-44
WP_000126419.1|1042922_1043675_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	70.0	1.9e-94
WP_000478854.1|1043723_1044113_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	58.9	1.5e-31
WP_001175132.1|1044133_1044436_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	58.6	2.8e-25
WP_000978295.1|1045550_1045883_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000725267.1|1045981_1046479_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1046595_1047129_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1047218_1047914_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1047923_1048661_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1048558_1049263_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000178849.1|1052723_1052966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144693.1|1053019_1055458_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.3	8.3e-91
WP_000143167.1|1055457_1056039_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_076734507.1|1056514_1057483_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	98.8	7.4e-192
WP_000334547.1|1058010_1058637_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1058705_1059005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1058989_1059676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1059946_1060138_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|1060564_1063177_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000291723.1|1063384_1064395_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001574119.1|1064560_1065103_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224079.1|1065099_1066209_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1066307_1068416_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1068428_1070336_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333139.1|1070350_1071604_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1071608_1073249_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1073245_1073809_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1074064_1074232_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1074331_1074850_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|1074918_1076679_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1076864_1077317_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1077388_1078441_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288733.1|1078797_1079307_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_058106751.1|1079523_1080129_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950876.1|1080115_1082269_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1082287_1082734_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1082857_1084912_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1084947_1085406_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1085500_1086163_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975204.1|1086333_1086750_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1086794_1087112_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140478.1|1087169_1088381_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1088595_1089144_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548080.1|1089169_1089949_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1089997_1090279_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904449.1|1090275_1090605_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_076933795.1|1090691_1091351_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938186.1|1091969_1092650_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
>prophage 3
NZ_CP019406	Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 chromosome, complete genome	4693979	1264905	1281020	4693979	integrase,lysis,holin,tail	Salmonella_phage(30.77%)	16	1264741:1264770	1284362:1284391
1264741:1264770	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|1264905_1265985_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|1265959_1266238_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|1266651_1268631_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000972675.1|1269262_1269568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106734.1|1269631_1270231_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.4	1.4e-95
WP_000784710.1|1270227_1270455_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|1270584_1271274_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|1271370_1271895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|1272268_1272718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|1273078_1273765_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|1274040_1274370_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1274353_1274806_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1274823_1275303_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|1276197_1276731_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1276820_1277516_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_072100756.1|1280156_1281020_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
1284362:1284391	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 4
NZ_CP019406	Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 chromosome, complete genome	4693979	1505438	1516226	4693979	tRNA	Escherichia_phage(72.73%)	15	NA	NA
WP_000123686.1|1505438_1506812_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156217.1|1506855_1507791_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|1508107_1508725_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|1508752_1509070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|1509154_1509376_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|1509813_1510335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085981757.1|1510442_1510598_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|1510983_1511451_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|1511723_1512053_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|1512214_1512769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556389.1|1512765_1513698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|1514067_1514280_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000940751.1|1514803_1515403_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|1515402_1515693_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|1515689_1516226_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
>prophage 5
NZ_CP019406	Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 chromosome, complete genome	4693979	1849121	1893667	4693979	portal,integrase,holin,capsid,terminase,lysis,plate,tail,tRNA,head	Enterobacteria_phage(62.16%)	54	1848054:1848078	1886356:1886380
1848054:1848078	attL	AAAGAAAAAAGGCCGCAATGCGGCC	NA	NA	NA	NA
WP_058106647.1|1849121_1850075_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	48.6	2.0e-77
WP_058106648.1|1850164_1850476_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	48.5	5.4e-19
WP_058343723.1|1850570_1850849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106649.1|1851008_1851407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844112.1|1851727_1851931_+	LapA family protein	NA	NA	NA	NA	NA
WP_023170322.1|1851900_1852092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106650.1|1852167_1852608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106651.1|1852604_1852862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106652.1|1852849_1853383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106653.1|1853379_1853619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048590829.1|1853615_1854581_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B2IH14	Erwinia_phage	42.4	3.1e-57
WP_076734534.1|1854559_1855078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106655.1|1855074_1856094_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	67.8	1.0e-127
WP_058106656.1|1856090_1858595_+	replication protein	NA	A0A0M4RTM8	Salmonella_phage	47.4	6.0e-177
WP_048590832.1|1858587_1859001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106657.1|1859100_1859364_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_153302029.1|1860216_1861932_-	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	54.4	6.4e-138
WP_058106659.1|1862981_1864031_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.9	5.6e-153
WP_045900644.1|1864030_1865764_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	75.1	1.7e-263
WP_058106660.1|1865920_1866757_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.8	7.5e-100
WP_058106661.1|1866780_1867866_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.4	3.8e-136
WP_058106662.1|1867912_1868743_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	65.5	1.1e-90
WP_045900648.1|1868845_1869340_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	60.1	2.2e-51
WP_001658929.1|1869339_1869540_+	Tail component protein	NA	A0A0A7NV57	Enterobacteria_phage	80.3	1.9e-22
WP_001658928.1|1869569_1869908_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_050154612.1|1869904_1870348_+	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.2	8.1e-45
WP_058106664.1|1870354_1870846_+|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	56.9	2.7e-33
WP_058106665.1|1870832_1871279_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.1	2.5e-33
WP_048590845.1|1871275_1871911_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	59.8	1.0e-64
WP_058106666.1|1871907_1872498_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.6	2.4e-68
WP_001658912.1|1872494_1872863_+|plate	phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	71.3	6.5e-40
WP_045900654.1|1872849_1873746_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	69.1	1.5e-106
WP_058106667.1|1873738_1874266_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	60.6	4.2e-56
WP_076734536.1|1874271_1876320_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	89.8	2.2e-217
WP_078057117.1|1876289_1876907_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	86.7	3.0e-98
WP_076734537.1|1876910_1877444_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.9	6.7e-78
WP_058106670.1|1877446_1878313_-	hypothetical protein	NA	A0A1S6KZZ8	Salmonella_phage	91.7	2.2e-147
WP_000980424.1|1878464_1878953_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	79.5	1.5e-71
WP_076734538.1|1878966_1881927_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.7	3.4e-256
WP_001627826.1|1881913_1882072_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	79.6	2.4e-15
WP_078057118.1|1882077_1882434_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	52.6	3.4e-17
WP_000115856.1|1882476_1882989_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.0	7.6e-63
WP_045900664.1|1882989_1884177_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	81.7	4.8e-185
WP_076734539.1|1884334_1885456_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	74.5	1.1e-149
WP_024143245.1|1885510_1885771_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_023229131.1|1886004_1886145_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	71.7	3.1e-11
WP_001229266.1|1886500_1886800_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1886356:1886380	attR	AAAGAAAAAAGGCCGCAATGCGGCC	NA	NA	NA	NA
WP_000672408.1|1886804_1889192_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018570.1|1889207_1890191_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|1890327_1890372_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|1890492_1890849_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1890899_1891097_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001574431.1|1891192_1891735_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001144217.1|1891738_1893667_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	5.5e-130
>prophage 6
NZ_CP019406	Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 chromosome, complete genome	4693979	2185006	2195513	4693979		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2185006_2186320_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565913.1|2186346_2187426_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648783.1|2187430_2188204_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|2188219_2189194_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|2189199_2189751_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_058106732.1|2189751_2190630_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.7e-108
WP_001023658.1|2190677_2191577_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697846.1|2191576_2192662_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2193038_2193932_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144951.1|2194109_2195513_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 7
NZ_CP019406	Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 chromosome, complete genome	4693979	2262711	2271882	4693979	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|2262711_2264745_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|2264985_2265444_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|2265615_2266146_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|2266202_2266670_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|2266716_2267436_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2267432_2269118_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240421.1|2269340_2270072_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_001261696.1|2270131_2270239_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2270219_2270951_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|2270934_2271882_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 8
NZ_CP019406	Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 chromosome, complete genome	4693979	2508317	2514370	4693979		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|2508317_2509259_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|2510501_2510891_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|2510859_2511114_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|2511131_2513054_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|2514043_2514187_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_105789229.1|2514202_2514370_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
