The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019445	Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 chromosome, complete genome	4646998	939348	965502	4646998	plate,integrase,tRNA,tail	Erwinia_phage(25.81%)	35	924090:924104	956311:956325
924090:924104	attL	AAACCGCCTTCGTTC	NA	NA	NA	NA
WP_054804225.1|939348_940419_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0B6VT43	Edwardsiella_phage	52.0	4.8e-91
WP_054804226.1|940601_941945_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_054804227.1|942005_942473_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_076769062.1|942646_943696_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	71.6	8.4e-149
WP_076769063.1|943702_944548_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	60.0	3.1e-93
WP_042713132.1|944663_945032_+	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	68.6	4.2e-39
WP_054804228.1|945070_945409_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	67.6	8.1e-37
WP_054804229.1|945475_945703_+	DUF2732 family protein	NA	A0A0M3UL87	Salmonella_phage	44.0	2.6e-07
WP_023480592.1|945702_945924_+	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	Q6K1F5	Salmonella_virus	69.0	4.5e-20
WP_083699320.1|945924_947964_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	66.1	3.3e-250
WP_023480627.1|948053_948239_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	75.4	2.3e-17
WP_054804230.1|948436_948640_+|tail	tail protein X	tail	Q858W3	Yersinia_virus	72.7	5.4e-20
WP_023480641.1|948630_948852_+	membrane protein	NA	A0A218M4L5	Erwinia_phage	39.7	1.1e-10
WP_054804231.1|948835_949345_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	73.8	1.3e-65
WP_054804232.1|949341_949773_+	protein lysB	NA	Q858W0	Yersinia_virus	52.2	9.7e-27
WP_054804233.1|949747_949906_+	hypothetical protein	NA	A0A0F7LCN5	Escherichia_phage	69.2	1.4e-12
WP_054804234.1|949868_950336_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	58.8	1.5e-44
WP_054804235.1|950430_951066_+|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	79.6	1.1e-92
WP_023480652.1|951062_951410_+	lysozyme family protein	NA	A0A0F7LDQ1	Escherichia_phage	72.2	6.6e-42
WP_076769064.1|951414_952323_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	80.1	1.4e-131
WP_042713141.1|952315_952927_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	76.9	3.2e-84
WP_054804236.1|953068_954061_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	62.1	1.5e-115
WP_076769065.1|954212_955271_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	45.5	5.9e-102
WP_054804237.1|955270_955867_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	59.9	6.2e-64
WP_076769066.1|957701_958130_+	hypothetical protein	NA	A0A1S6KZY8	Salmonella_phage	35.8	4.1e-09
956311:956325	attR	GAACGAAGGCGGTTT	NA	NA	NA	NA
WP_054804239.1|958259_959441_+|tail	phage tail sheath protein	tail	U5N3V0	Enterobacteria_phage	86.1	1.9e-197
WP_023480575.1|959452_959971_+|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	87.8	8.5e-86
WP_042713148.1|960033_960315_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	7.9e-30
WP_034813568.1|960347_960467_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	87.2	2.8e-13
WP_076769067.1|960459_962322_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	44.6	9.7e-07
WP_076769068.1|962318_962768_+|tail	phage tail protein	tail	O64315	Escherichia_phage	64.5	1.4e-52
WP_076769069.1|962767_963907_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	49.9	6.4e-102
WP_054804241.1|963988_964183_+	late control protein B	NA	Q37973	Salmonella_virus	68.8	1.8e-20
WP_006178051.1|964342_964690_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_023480607.1|964731_965502_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP019445	Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 chromosome, complete genome	4646998	3343621	3352677	4646998		Escherichia_phage(66.67%)	10	NA	NA
WP_054803892.1|3343621_3344233_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.5	1.8e-26
WP_076769798.1|3344297_3345155_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	33.9	3.2e-21
WP_023481292.1|3345156_3345774_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	5.2e-74
WP_076769799.1|3345784_3348223_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.0	1.5e-217
WP_023481755.1|3348374_3348656_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_076769800.1|3348838_3349558_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_023481559.1|3349577_3350138_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_054803885.1|3350188_3350527_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_042715656.1|3350661_3350988_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.9	1.0e-20
WP_054803887.1|3351213_3352677_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.4	1.7e-46
>prophage 3
NZ_CP019445	Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 chromosome, complete genome	4646998	3603540	3648791	4646998	holin,tail,head	Cronobacter_phage(32.61%)	58	NA	NA
WP_076769894.1|3603540_3605697_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	56.5	4.8e-215
WP_076769895.1|3605753_3608213_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	57.6	2.6e-281
WP_076769896.1|3608160_3608592_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	55.6	1.1e-38
WP_054803773.1|3608595_3609066_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	57.5	3.2e-47
WP_076769897.1|3609065_3609560_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	63.2	1.8e-53
WP_076769898.1|3609569_3613034_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	44.4	1.6e-167
WP_076769899.1|3613097_3613367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076769900.1|3613409_3614120_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.7	3.9e-73
WP_054803774.1|3614170_3614917_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	70.9	2.5e-91
WP_054803775.1|3614975_3615359_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	55.1	6.6e-35
WP_076769901.1|3615355_3615781_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	53.2	4.0e-33
WP_054803776.1|3615783_3616131_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	6.4e-37
WP_050595166.1|3616130_3616799_-	GIY-YIG nuclease family protein	NA	A0A292GBW5	Xanthomonas_phage	54.5	7.3e-05
WP_054803777.1|3616903_3617074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054803778.1|3617073_3617454_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	57.3	4.4e-31
WP_054803779.1|3617456_3617822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054803780.1|3617831_3618929_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	76.4	1.9e-159
WP_054803781.1|3618938_3619373_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	75.0	5.1e-52
WP_076769902.1|3619376_3620780_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	55.4	1.9e-135
WP_076769903.1|3620837_3621215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083699406.1|3621328_3622225_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	65.5	2.3e-110
WP_076769905.1|3622256_3623702_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	76.6	6.7e-205
WP_054803784.1|3623713_3625186_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	83.1	1.2e-249
WP_076769907.1|3627465_3627918_-	Rz lytic protein	NA	NA	NA	NA	NA
WP_054803787.1|3627914_3628352_-	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	65.5	8.3e-50
WP_054803812.1|3628335_3628686_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_076769908.1|3629235_3629736_-	antiterminator	NA	G8C7V7	Escherichia_phage	72.6	7.2e-66
WP_156884922.1|3629732_3629900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054803789.1|3629896_3630262_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	78.0	5.8e-49
WP_054803790.1|3630258_3630549_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	90.6	1.1e-45
WP_076769909.1|3630541_3630709_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	4.7e-14
WP_076769910.1|3630708_3631164_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	72.2	2.4e-60
WP_054803791.1|3631376_3631658_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	79.3	3.9e-37
WP_076769911.1|3631659_3632433_-	hypothetical protein	NA	A0A1I9KFE6	Aeromonas_phage	84.9	2.4e-20
WP_054803793.1|3632432_3632636_-	hypothetical protein	NA	A0A1U9ZAD0	Proteus_phage	44.1	3.4e-06
WP_076769912.1|3632638_3633187_-	hypothetical protein	NA	A0A291LBK8	Klebsiella_phage	58.3	3.1e-09
WP_054803796.1|3633183_3633477_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	68.8	6.3e-30
WP_076769913.1|3633476_3634913_-	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	82.6	8.6e-229
WP_076769914.1|3634902_3635799_-	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	68.1	4.0e-107
WP_054803797.1|3635916_3636735_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	69.1	7.6e-97
WP_054803813.1|3636820_3637042_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_054803798.1|3637081_3637309_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	5.8e-23
WP_076770330.1|3637420_3638125_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	78.6	2.3e-102
WP_156884923.1|3638694_3638901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167552471.1|3639043_3639211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054803801.1|3639207_3639417_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	76.8	5.2e-26
WP_054803802.1|3639487_3640600_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	71.1	1.3e-35
WP_054803803.1|3640607_3640892_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	60.6	3.4e-28
WP_054803804.1|3640901_3641816_+	DNA recombinase	NA	G8C7T0	Escherichia_phage	91.1	1.1e-157
WP_054803805.1|3641812_3642295_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	93.1	6.3e-75
WP_167552472.1|3642606_3642771_+	hypothetical protein	NA	G8C7S7	Escherichia_phage	64.2	6.7e-13
WP_054803806.1|3642767_3644717_+	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	56.8	8.3e-150
WP_045343381.1|3644713_3644932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076769916.1|3644928_3646221_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	28.6	1.0e-34
WP_054803807.1|3646492_3646711_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	65.2	6.0e-17
WP_054803808.1|3646816_3647071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054803809.1|3647224_3647473_+	excisionase family protein	NA	S4TND0	Salmonella_phage	54.3	4.0e-17
WP_076769917.1|3647504_3648791_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	55.6	3.0e-132
>prophage 4
NZ_CP019445	Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 chromosome, complete genome	4646998	3924045	4009226	4646998	integrase,holin,tRNA,terminase,tail,protease	Enterobacteria_phage(20.83%)	90	3955208:3955235	4007000:4007027
WP_054803646.1|3924045_3924741_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_076770012.1|3924799_3926710_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	3.8e-91
WP_023480033.1|3926822_3927167_+	RidA family protein	NA	NA	NA	NA	NA
WP_023480153.1|3927167_3927356_-	YoaH family protein	NA	NA	NA	NA	NA
WP_054803645.1|3927440_3928790_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	42.6	1.2e-43
WP_042714448.1|3928793_3929372_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_076770013.1|3929547_3930912_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_076770014.1|3931077_3932691_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_054803643.1|3932672_3934232_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	43.1	4.3e-40
WP_054803642.1|3934675_3935650_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_054803641.1|3935713_3936514_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_023480044.1|3936526_3937378_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_076770015.1|3937437_3937896_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_076770016.1|3938273_3938840_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_076770017.1|3938836_3939652_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|3939794_3940004_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_076770018.1|3940669_3941659_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_076770019.1|3941677_3941968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023480134.1|3942042_3942186_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_054803640.1|3942348_3942588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042715774.1|3942636_3943428_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_054803639.1|3943696_3944578_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_054803638.1|3944776_3946825_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.6	4.1e-83
WP_054803637.1|3947635_3948133_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_076770021.1|3948264_3949548_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_076770022.1|3949516_3952150_+	PqiB family protein	NA	NA	NA	NA	NA
WP_076770023.1|3952185_3953667_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_023480127.1|3953781_3954021_+	YebV family protein	NA	NA	NA	NA	NA
WP_023480173.1|3954126_3954318_+	YebW family protein	NA	NA	NA	NA	NA
WP_054803636.1|3954318_3954963_-	protein-serine/threonine phosphatase	NA	K7P6H8	Enterobacteria_phage	53.5	4.0e-61
3955208:3955235	attL	ATAAAAAAAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_054803665.1|3955890_3957669_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_076770024.1|3957842_3958217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038886220.1|3958647_3959073_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.9	7.5e-48
WP_076770025.1|3959085_3960375_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	69.7	2.1e-165
WP_076770026.1|3960419_3960740_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.6	1.2e-21
WP_076770027.1|3961301_3961475_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_076770028.1|3961951_3962182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054803322.1|3962817_3963204_-	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	54.3	3.6e-33
WP_054803320.1|3963647_3964973_-	hypothetical protein	NA	K7P6I4	Enterobacteria_phage	50.8	6.3e-117
WP_054803319.1|3965124_3965376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076770029.1|3965381_3966335_-	hypothetical protein	NA	A0A2P1CKS0	Pantoea_phage	39.7	9.2e-54
WP_076770030.1|3966334_3970117_-	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	72.6	0.0e+00
WP_054803316.1|3970172_3970772_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	93.0	3.8e-98
WP_076770031.1|3970759_3971491_-	C40 family peptidase	NA	G8C7R2	Escherichia_phage	93.0	3.3e-144
WP_054803315.1|3971503_3972277_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	87.8	5.3e-132
WP_054803314.1|3972285_3972636_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	82.8	4.7e-48
WP_076770032.1|3972716_3976433_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	55.0	7.3e-272
WP_083699419.1|3976432_3976747_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	65.7	2.9e-20
WP_076770034.1|3976743_3977055_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	70.9	2.0e-37
WP_054803309.1|3977107_3977785_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	69.3	1.0e-78
WP_054803308.1|3977838_3978249_-	hypothetical protein	NA	A0A2H4J130	uncultured_Caudovirales_phage	36.4	1.1e-16
WP_054803307.1|3978220_3978829_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	57.3	7.0e-55
WP_054803306.1|3978830_3979181_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	59.5	2.1e-35
WP_054803305.1|3979182_3979665_-	hypothetical protein	NA	A0A1U9HYQ2	Salmonella_phage	39.7	2.7e-09
WP_167552483.1|3979702_3980059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076770035.1|3979983_3980937_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	2.9e-132
WP_076770036.1|3980949_3981720_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	61.3	3.3e-70
WP_054803302.1|3982869_3984276_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	52.0	9.3e-127
WP_076770037.1|3984277_3985588_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.9	8.6e-151
WP_076770038.1|3985562_3986570_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.9	8.9e-39
WP_054803299.1|3986647_3986890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054803298.1|3986938_3987139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054803297.1|3987735_3988188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054803296.1|3988184_3988622_-	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	64.1	1.6e-48
WP_054803326.1|3988605_3988956_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_156884928.1|3989067_3989229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076770040.1|3989723_3990527_-	antitermination protein	NA	F1C595	Cronobacter_phage	74.5	4.6e-107
WP_076770041.1|3990523_3991135_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	68.0	8.8e-58
WP_054803293.1|3991137_3991338_-	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	74.2	7.9e-24
WP_076770042.1|3991342_3991939_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	87.8	1.2e-96
WP_083699479.1|3991973_3992213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076770044.1|3993157_3993964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054803290.1|3994608_3994953_-	hypothetical protein	NA	F1C5B6	Cronobacter_phage	58.2	3.6e-08
WP_076770045.1|3994949_3995279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054803288.1|3995275_3995962_-	phage replication protein	NA	G8C7U6	Escherichia_phage	60.7	2.1e-79
WP_076770046.1|3995958_3996876_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	68.1	7.2e-112
WP_054803287.1|3996960_3997512_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	51.0	7.5e-32
WP_076770047.1|3997514_3997742_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	74.3	3.3e-26
WP_054803286.1|3997847_3998234_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	78.2	3.1e-48
WP_083699483.1|3998353_3999772_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_076770049.1|4000601_4003997_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	53.6	3.3e-303
WP_054803284.1|4004008_4005085_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	59.6	3.9e-117
WP_167552474.1|4005119_4005296_+	hypothetical protein	NA	G8C7S7	Escherichia_phage	58.8	3.3e-10
WP_054803283.1|4005292_4005535_+	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	66.7	6.0e-18
WP_054803282.1|4005600_4005870_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	65.6	1.4e-28
WP_076770050.1|4005841_4006924_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	65.1	8.4e-136
WP_054803281.1|4007250_4007595_-	YebY family protein	NA	NA	NA	NA	NA
4007000:4007027	attR	ATAAAAAAAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_054803280.1|4007613_4008483_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_054803279.1|4008484_4008859_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_034813210.1|4008995_4009226_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.7e-15
>prophage 5
NZ_CP019445	Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 chromosome, complete genome	4646998	4214190	4223686	4646998		Enterobacteria_phage(37.5%)	10	NA	NA
WP_076770124.1|4214190_4215297_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	31.4	2.0e-47
WP_054803219.1|4215298_4215757_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_054803220.1|4215731_4216151_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_076770125.1|4216147_4216702_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	52.6	2.7e-45
WP_054803221.1|4216704_4217583_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.7e-107
WP_054803236.1|4217630_4218530_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	32.9	3.5e-26
WP_054803222.1|4218532_4219615_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.0e-100
WP_076770126.1|4220014_4220908_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.5	4.8e-44
WP_076770127.1|4221107_4222103_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2C9DTC1	Eastern_grey_kangaroopox_virus	28.4	2.8e-08
WP_076770128.1|4222270_4223686_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.4e-20
>prophage 6
NZ_CP019445	Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 chromosome, complete genome	4646998	4304176	4312541	4646998	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_076770344.1|4304176_4306207_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.7	8.0e-55
WP_023479721.1|4306297_4306753_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	46.7	2.6e-30
WP_023479843.1|4306845_4307316_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	80.8	2.6e-65
WP_023479755.1|4307368_4308088_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_076770152.1|4308081_4309770_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	83.8	3.9e-257
WP_054804169.1|4309989_4310724_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	62.1	6.9e-65
WP_023479821.1|4310784_4310898_+	protein YohO	NA	NA	NA	NA	NA
WP_054804170.1|4310872_4311610_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_076770153.1|4311593_4312541_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.0	1.8e-09
>prophage 1
NZ_CP019446	Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-1, complete sequence	113443	88076	95919	113443		Escherichia_phage(33.33%)	6	NA	NA
WP_054804286.1|88076_89048_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	45.7	4.7e-69
WP_054804287.1|89281_89725_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.1	7.9e-32
WP_054804288.1|89712_90987_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	62.3	1.6e-146
WP_054804289.1|91967_92945_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	57.5	1.6e-93
WP_076770396.1|92952_94152_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	78.6	4.3e-181
WP_076770408.1|94938_95919_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	63.8	6.7e-100
