The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022003	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051873 chromosome, complete genome	4679123	1119774	1186599	4679123	lysis,portal,integrase,head,tRNA,capsid,tail,terminase,transposase,plate	Salmonella_phage(91.3%)	64	1120058:1120072	1156022:1156036
WP_089113803.1|1119774_1120885_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
1120058:1120072	attL	TGAGCTGGTCACTCA	NA	NA	NA	NA
WP_000445376.1|1121681_1122485_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_001142974.1|1122883_1123477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000360326.1|1123738_1124401_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_000218402.1|1124953_1125970_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000932273.1|1125972_1126605_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000102105.1|1126726_1126969_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460848.1|1127002_1127512_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000956190.1|1127519_1127720_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000963474.1|1127683_1128025_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_001244219.1|1128092_1128326_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000752613.1|1128325_1128553_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104187.1|1128549_1129407_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000017507.1|1129403_1131818_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_001154433.1|1131970_1132159_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217571.1|1132169_1132403_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001673609.1|1132516_1133194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284991.1|1133507_1135172_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001542203.1|1135275_1136316_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001098395.1|1136315_1138082_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_000216276.1|1138224_1139058_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730760.1|1139074_1140136_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.7	6.0e-195
WP_000059173.1|1140139_1140790_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000673537.1|1140883_1141348_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000868184.1|1141347_1141551_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1141554_1141770_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069923.1|1141750_1142266_+	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000196199.1|1142262_1142691_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001039958.1|1142786_1143218_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000343949.1|1143210_1143657_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_000958562.1|1143658_1144510_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_001672413.1|1144587_1145166_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000189373.1|1145162_1145522_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_000268332.1|1145508_1146417_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_001086804.1|1146409_1147015_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_001274649.1|1147011_1148865_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_000143187.1|1148864_1149440_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_000974843.1|1150309_1150534_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000046107.1|1150636_1151809_+|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	99.7	5.7e-223
WP_001207651.1|1151818_1152334_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_001280963.1|1152388_1152691_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_000763316.1|1152705_1152825_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001282768.1|1152817_1155625_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000980411.1|1155621_1156107_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
1156022:1156036	attR	TGAGTGACCAGCTCA	NA	NA	NA	NA
WP_001102269.1|1156103_1157204_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980500.1|1157272_1157491_+	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_012543392.1|1158042_1159206_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196151.1|1159213_1161394_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533863.1|1161390_1162800_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237694.1|1162864_1174339_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1174953_1175436_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1175585_1176062_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1176051_1176342_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1176507_1176846_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1176994_1178656_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059151.1|1178741_1179620_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1179743_1180334_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287926.1|1180368_1180974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1181094_1182381_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1182400_1183192_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1183357_1184719_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1184971_1185220_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1185238_1185787_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1185831_1186599_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP022003	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051873 chromosome, complete genome	4679123	1691600	1700771	4679123	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1691600_1692548_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1692531_1693263_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1693243_1693351_-	protein YohO	NA	NA	NA	NA	NA
WP_001240421.1|1693410_1694142_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272845.1|1694364_1696050_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1696046_1696766_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1696812_1697280_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1697336_1697867_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1698038_1698497_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1698737_1700771_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP022003	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051873 chromosome, complete genome	4679123	1767967	1778474	4679123		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1767967_1769371_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1769548_1770442_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697848.1|1770818_1771904_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1771903_1772803_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1772850_1773729_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1773729_1774281_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1774286_1775261_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1775276_1776050_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1776054_1777134_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1777160_1778474_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP022003	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051873 chromosome, complete genome	4679123	2430481	2446425	4679123	tRNA,holin	Escherichia_phage(62.5%)	21	NA	NA
WP_001082296.1|2430481_2430916_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2430965_2431304_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000802786.1|2432149_2432695_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2432691_2432973_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2432962_2433151_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2433072_2433468_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2435638_2436175_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2436171_2436462_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2436461_2437061_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|2437584_2437797_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556389.1|2438166_2439099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2439095_2439650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2439811_2440141_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2440413_2440881_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2441265_2441421_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2441528_2442050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|2442487_2442709_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2442793_2443111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2443138_2443756_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2444072_2445008_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2445051_2446425_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 5
NZ_CP022003	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051873 chromosome, complete genome	4679123	2670398	2686513	4679123	tail,lysis,integrase,holin	Salmonella_phage(30.77%)	16	2667028:2667057	2686649:2686678
2667028:2667057	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|2670398_2671262_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|2673902_2674598_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2674687_2675221_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2676115_2676595_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2676612_2677065_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2677048_2677378_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2677653_2678340_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2678700_2679150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2679523_2680048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2680144_2680834_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2680963_2681191_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2681187_2681787_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|2681850_2682156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2682787_2684767_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2685180_2685459_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2685433_2686513_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2686649:2686678	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 6
NZ_CP022003	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051873 chromosome, complete genome	4679123	2858905	2899603	4679123	tail,protease	Salmonella_phage(28.57%)	40	NA	NA
WP_000938186.1|2858905_2859586_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2860204_2860864_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2860950_2861280_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2861276_2861558_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2861606_2862386_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2862411_2862960_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2863174_2864386_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2864443_2864761_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|2864805_2865222_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2865392_2866055_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2866149_2866608_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2866643_2868698_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2868821_2869268_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2869286_2871440_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2871426_2872032_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2872248_2872758_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2873114_2874167_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2874238_2874691_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2874876_2876637_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2876705_2877224_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2877323_2877491_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2877746_2878310_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2878306_2879947_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2879951_2881205_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2881219_2883127_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2883139_2885248_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2885346_2886456_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2886452_2886995_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2887160_2888171_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2888378_2890991_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2891417_2891609_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2891879_2892566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2892925_2893552_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2894199_2895168_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2895393_2895642_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2895645_2896227_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2896226_2897936_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2897932_2898559_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2898542_2899172_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|2899192_2899603_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 7
NZ_CP022003	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051873 chromosome, complete genome	4679123	2970882	2978195	4679123	integrase,protease	Ralstonia_phage(16.67%)	7	2965679:2965693	2976931:2976945
2965679:2965693	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2970882_2971260_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2971421_2971619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076915254.1|2971831_2974108_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.4e-164
WP_000520789.1|2974138_2974459_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2974782_2975004_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2975133_2977080_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2976931:2976945	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2977076_2978195_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP022004	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051873 plasmid pCFSAN051873, complete sequence	59371	12208	19116	59371	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001541564.1|12208_12625_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|12808_13144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176303.1|13200_13806_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_076915270.1|13802_14744_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	6.1e-74
WP_000427676.1|15158_16364_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_077681951.1|16360_17338_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000457542.1|17419_18694_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000925628.1|18693_19116_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
