The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019390	Brucella sp. 09RB8910 chromosome 1, complete sequence	2280827	86022	100601	2280827	portal,terminase	Stenotrophomonas_phage(28.57%)	17	NA	NA
WP_076770498.1|86022_86346_-	DUF2190 family protein	NA	A0A2I7S8N5	Vibrio_phage	35.5	4.1e-06
WP_076770499.1|86414_88055_-	hypothetical protein	NA	B7SYD7	Stenotrophomonas_phage	29.6	6.7e-36
WP_076770500.1|88153_88807_-	hypothetical protein	NA	B7SYD7	Stenotrophomonas_phage	44.6	1.4e-32
WP_076770501.1|88793_90326_-|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	37.9	2.1e-79
WP_041545160.1|90325_90520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076770502.1|90522_92340_-|terminase	phage terminase large subunit family protein	terminase	D6PFE7	uncultured_phage	32.7	3.9e-69
WP_076770503.1|92254_93283_-|terminase	phage terminase large subunit family protein	terminase	B7SYD3	Stenotrophomonas_phage	30.4	7.2e-28
WP_076770504.1|93257_93977_-|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_076770505.1|94176_94746_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	44.7	3.0e-28
WP_083699574.1|95124_95781_-	hypothetical protein	NA	A0A068C9G5	Rhizobium_phage	25.9	4.5e-07
WP_076770507.1|95767_96922_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	32.1	9.6e-05
WP_076770508.1|96918_97578_-	hypothetical protein	NA	A0A291AUT5	Sinorhizobium_phage	62.4	1.7e-70
WP_083699576.1|97574_98090_-	hypothetical protein	NA	A0A291AUJ2	Sinorhizobium_phage	57.3	1.0e-19
WP_076770510.1|98086_98434_-	DUF4406 domain-containing protein	NA	W6E9N4	Rhizobium_phage	59.6	1.5e-25
WP_076770511.1|98433_99750_-	ParB N-terminal domain-containing protein	NA	A0A0M3LPV8	Mannheimia_phage	38.3	6.8e-23
WP_076770512.1|99861_100128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076770513.1|100124_100601_-	hypothetical protein	NA	A0A291AUS4	Sinorhizobium_phage	50.0	2.5e-31
>prophage 2
NZ_CP019390	Brucella sp. 09RB8910 chromosome 1, complete sequence	2280827	116259	128177	2280827	tRNA	uncultured_Mediterranean_phage(90.0%)	12	NA	NA
WP_076770534.1|116259_118587_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|118705_119047_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_076770535.1|119206_120073_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_076770536.1|120121_121420_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_004683704.1|121800_122469_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|122465_123233_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_076771750.1|123381_124665_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.4	4.1e-105
WP_002964014.1|124741_125566_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_076771752.1|125562_126132_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|126243_126462_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_076770537.1|126607_127333_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	8.6e-44
WP_076770538.1|127325_128177_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.9	2.0e-31
>prophage 3
NZ_CP019390	Brucella sp. 09RB8910 chromosome 1, complete sequence	2280827	390079	436805	2280827	tail,integrase,protease,head	Rhodobacter_phage(37.5%)	42	380829:380844	391021:391036
380829:380844	attL	ACCGCTTCGCACTTTT	NA	NA	NA	NA
WP_076770700.1|390079_391006_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	36.4	3.8e-28
WP_076770701.1|391529_392663_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
391021:391036	attR	AAAAGTGCGAAGCGGT	NA	NA	NA	NA
WP_076771786.1|392680_393055_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_076770702.1|393099_393750_-	antifreeze protein	NA	NA	NA	NA	NA
WP_076771788.1|394523_395177_+	YitT family protein	NA	NA	NA	NA	NA
WP_004683353.1|395235_395493_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_076770703.1|395762_396002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|395998_396346_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_009364522.1|396404_397115_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_008508600.1|397473_397641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008508597.1|397681_399184_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_154144614.1|399359_400328_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_009364526.1|400604_402296_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_009364527.1|402684_403557_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_076770705.1|403715_404972_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|404976_405936_-	DMT family transporter	NA	NA	NA	NA	NA
WP_076770706.1|406161_408813_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_076770707.1|409203_411555_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_076770708.1|411829_413941_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_076770709.1|413970_416922_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_025199586.1|417040_418447_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002963761.1|418443_419151_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_076770710.1|419244_420786_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_059242733.1|420927_421404_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_076770711.1|421400_423392_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_076770712.1|423411_423909_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_076770713.1|423905_425045_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_076770714.1|425145_425598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076770715.1|425691_427002_-	histidine kinase	NA	NA	NA	NA	NA
WP_076770716.1|427076_427766_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|427844_428141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008508561.1|428302_428509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076770717.1|428573_432437_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0K1LL82	Rhodobacter_phage	38.5	7.2e-214
WP_076770718.1|432440_432875_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_076770719.1|432871_433747_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	37.9	2.9e-46
WP_076770720.1|433743_434376_-	TIGR02217 family protein	NA	A0A0K1Y6G4	Rhodobacter_phage	50.9	1.7e-48
WP_076770721.1|434378_434924_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	1.7e-07
WP_070997847.1|435143_435485_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_008935501.1|435481_435895_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_076770722.1|435935_436343_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_004688128.1|436302_436470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004688127.1|436466_436805_-|head	phage head closure protein	head	NA	NA	NA	NA
>prophage 4
NZ_CP019390	Brucella sp. 09RB8910 chromosome 1, complete sequence	2280827	1520986	1528235	2280827	plate	Ochrobactrum_phage(42.86%)	9	NA	NA
WP_076771236.1|1520986_1521796_-	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	76.7	4.4e-121
WP_179947171.1|1521928_1522360_-	hypothetical protein	NA	A0A219VHA6	Ochrobactrum_phage	73.1	1.5e-35
WP_076771237.1|1522368_1522842_-	hypothetical protein	NA	A0A219VHA5	Ochrobactrum_phage	64.4	3.0e-29
WP_076771238.1|1522853_1524227_-	DUF2793 domain-containing protein	NA	R9U0V1	Rhizobium_phage	48.3	4.4e-57
WP_076771239.1|1524228_1524822_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_076771240.1|1524818_1525961_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	28.7	2.6e-18
WP_076771241.1|1525960_1526416_-	phage GP46 family protein	NA	NA	NA	NA	NA
WP_076771242.1|1526478_1526994_-|plate	phage baseplate assembly protein	plate	R9TP58	Rhizobium_phage	39.3	5.4e-16
WP_076771243.1|1527002_1528235_-	Mu P family protein	NA	A0A2P9JZK3	Alteromonadaceae_phage	27.3	1.9e-27
>prophage 5
NZ_CP019390	Brucella sp. 09RB8910 chromosome 1, complete sequence	2280827	1611906	1647321	2280827	portal,capsid,terminase,tail,integrase,head	Rhizobium_phage(40.0%)	49	1595782:1595798	1633188:1633204
1595782:1595798	attL	GCCATGGCTGTTTCTCC	NA	NA	NA	NA
WP_083699655.1|1611906_1613103_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_179947174.1|1613071_1613263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076771292.1|1613265_1613514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076771293.1|1613510_1613723_-	hypothetical protein	NA	X2CXR7	Brucella_phage	55.4	2.1e-11
WP_076771295.1|1613897_1614179_-	hypothetical protein	NA	A0A1X9HWB1	Ruegeria_phage	65.9	5.4e-10
WP_076771296.1|1614175_1614598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076771297.1|1614594_1615065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154144880.1|1615061_1615199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154144882.1|1615195_1615978_-	hypothetical protein	NA	A0A240F4V0	Ochrobactrum_phage	50.6	6.5e-21
WP_076771299.1|1616170_1616431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076771300.1|1616590_1616815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154146644.1|1616811_1617138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076771302.1|1617139_1617406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076771303.1|1617560_1618175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179947175.1|1618134_1618584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076771304.1|1619277_1619580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076771305.1|1619579_1620431_+	hypothetical protein	NA	B4UTW2	Rhizobium_phage	27.2	8.1e-09
WP_154144888.1|1620427_1620604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076771306.1|1620588_1620795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179947176.1|1620934_1621756_+	AAA family ATPase	NA	B4UTW5	Rhizobium_phage	37.6	5.9e-41
WP_076771988.1|1622142_1622367_+	HNH endonuclease	NA	B4UTX2	Rhizobium_phage	55.6	1.1e-18
WP_076771307.1|1622398_1622962_+	DUF669 domain-containing protein	NA	A0A1J0GWE4	Alteromonas_phage	31.4	1.9e-06
WP_076771308.1|1623022_1624060_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	43.7	2.3e-74
WP_156884116.1|1624026_1624242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179947177.1|1624238_1624769_+	HNH endonuclease	NA	A0A2H4FNF1	Salmonella_phage	42.9	1.7e-36
WP_076771310.1|1624768_1625710_+	oxidoreductase	NA	B4UTX3	Rhizobium_phage	71.4	2.6e-133
WP_076771311.1|1625709_1627455_+	DEAD/DEAH box helicase family protein	NA	A0A1J0GWD7	Alteromonas_phage	34.7	2.0e-91
WP_076771312.1|1627547_1628288_+	hypothetical protein	NA	B4UTX9	Rhizobium_phage	55.2	2.5e-59
WP_154144892.1|1628284_1628485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076771313.1|1629040_1630423_+	helicase	NA	F8TUW6	EBPR_podovirus	50.3	5.7e-121
WP_076771314.1|1630419_1631364_+	site-specific DNA-methyltransferase	NA	A0A0F7L417	uncultured_marine_virus	48.0	2.6e-77
WP_076771315.1|1631353_1631674_+	hypothetical protein	NA	B4UTY6	Rhizobium_phage	47.5	3.9e-17
WP_076771316.1|1631681_1632728_+	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	61.1	2.4e-111
WP_025091060.1|1632693_1632903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076771317.1|1633003_1633192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076771318.1|1633219_1633789_+	hypothetical protein	NA	NA	NA	NA	NA
1633188:1633204	attR	GCCATGGCTGTTTCTCC	NA	NA	NA	NA
WP_076771319.1|1633785_1636149_+	bifunctional DNA primase/polymerase	NA	B4UTY9	Rhizobium_phage	45.7	6.9e-66
WP_076771320.1|1636545_1637043_+	VRR-NUC domain-containing protein	NA	B4UTZ1	Rhizobium_phage	54.8	5.5e-34
WP_076771321.1|1637039_1637957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076771990.1|1638521_1638725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076771322.1|1638711_1639011_+	HNH endonuclease	NA	M4QRD8	Tetraselmis_viridis_virus	41.8	2.4e-16
WP_076771323.1|1639120_1639507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076771324.1|1639508_1641362_+|terminase	terminase	terminase	A0A0U2C138	Paracoccus_phage	54.7	5.4e-175
WP_076771991.1|1641370_1642609_+|portal	phage portal protein	portal	Q9XJT5	Pseudomonas_phage	38.9	2.7e-69
WP_076771325.1|1642618_1643737_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	36.4	3.2e-37
WP_076771326.1|1643751_1644969_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	58.3	3.7e-108
WP_076771328.1|1645268_1645601_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_076771331.1|1646491_1646857_+|head,tail	head-tail adaptor protein	head,tail	B4UTP9	Rhizobium_phage	33.6	1.6e-09
WP_076771332.1|1646856_1647321_+	HK97 gp10 family phage protein	NA	A0A141GEW6	Brucella_phage	40.8	1.8e-18
>prophage 6
NZ_CP019390	Brucella sp. 09RB8910 chromosome 1, complete sequence	2280827	1662246	1672021	2280827		Sinorhizobium_phage(33.33%)	16	NA	NA
WP_076771349.1|1662246_1663110_+	chitinase	NA	A0A291AUN6	Sinorhizobium_phage	54.6	6.2e-81
WP_076771350.1|1663106_1663298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076771351.1|1663294_1663531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076771352.1|1663968_1664304_+	hypothetical protein	NA	B4UTS1	Rhizobium_phage	40.4	4.7e-13
WP_076771353.1|1664419_1665709_+	hypothetical protein	NA	A0A0K0PVN1	Roseobacter_phage	38.0	4.1e-73
WP_076771354.1|1665714_1665921_+	hypothetical protein	NA	A0A0F6SJ45	Sinorhizobium_phage	85.1	6.4e-29
WP_154144917.1|1666235_1666844_+	phosphohydrolase	NA	B4UTT6	Rhizobium_phage	63.7	3.2e-60
WP_076771356.1|1667079_1667412_+	hypothetical protein	NA	B4UTT8	Rhizobium_phage	44.4	6.3e-18
WP_076771358.1|1667885_1668134_-	DUF982 domain-containing protein	NA	NA	NA	NA	NA
WP_076771359.1|1668279_1668474_-	hypothetical protein	NA	A0A141GEZ2	Brucella_phage	47.5	1.5e-08
WP_076771360.1|1668484_1669162_-	SOS response-associated peptidase	NA	A0A291AUP1	Sinorhizobium_phage	47.3	6.1e-52
WP_076771363.1|1669626_1669926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076771364.1|1669922_1670120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029926951.1|1670289_1670526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029926953.1|1670525_1670711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076772003.1|1671238_1672021_+	glycosyltransferase family 25 protein	NA	A0A1S5NQ44	Burkholderia_phage	27.3	3.6e-11
>prophage 1
NZ_CP019391	Brucella sp. 09RB8910 chromosome 2, complete sequence	1312151	645148	652062	1312151	transposase	Ochrobactrum_phage(77.78%)	12	NA	NA
WP_099686906.1|645148_645905_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.4	5.3e-20
WP_076772830.1|646042_646885_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_076773855.1|647268_647517_-	helix-turn-helix transcriptional regulator	NA	A0A0U4JEE2	Pseudomonas_phage	44.7	5.0e-12
WP_076772832.1|648170_648473_+	helix-turn-helix domain-containing protein	NA	A0A219VHB8	Ochrobactrum_phage	38.4	8.6e-06
WP_076772834.1|648521_648737_+	hypothetical protein	NA	A0A219VHE3	Ochrobactrum_phage	88.7	1.5e-28
WP_076773857.1|648736_648964_+	TraR/DksA C4-type zinc finger protein	NA	A0A219VHE0	Ochrobactrum_phage	69.4	8.7e-19
WP_083699691.1|648963_649281_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_076772836.1|649283_649589_+	hypothetical protein	NA	A0A219VHE1	Ochrobactrum_phage	46.1	2.5e-13
WP_156884125.1|649595_650195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076771237.1|650206_650680_+	hypothetical protein	NA	A0A219VHA5	Ochrobactrum_phage	64.4	3.0e-29
WP_179947171.1|650688_651120_+	hypothetical protein	NA	A0A219VHA6	Ochrobactrum_phage	73.1	1.5e-35
WP_076771236.1|651252_652062_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	76.7	4.4e-121
>prophage 2
NZ_CP019391	Brucella sp. 09RB8910 chromosome 2, complete sequence	1312151	918955	925147	1312151	integrase,terminase	Pseudomonas_phage(16.67%)	9	911533:911553	930108:930128
911533:911553	attL	TAGAGCATTTCCAGCAAAAGT	NA	NA	NA	NA
WP_076773149.1|918955_919318_-	hypothetical protein	NA	A0A2H4GY26	Pseudomonas_phage	39.8	6.9e-10
WP_076773151.1|919901_920141_-|terminase	terminase small subunit	terminase	E5AGA2	Erwinia_phage	65.4	4.6e-10
WP_076773881.1|920176_920830_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_076773153.1|920854_921112_-	twin-arginine translocation signal domain-containing protein	NA	A0A141GF40	Brucella_phage	53.8	9.9e-11
WP_154144825.1|921096_921267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076773882.1|921580_922291_-	porin family protein	NA	O11861	Bartonella_henselae_phage	37.5	5.1e-41
WP_076773155.1|922501_923425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083699695.1|923411_924038_+|integrase	tyrosine-type recombinase/integrase	integrase	G8DH71	Emiliania_huxleyi_virus	33.2	3.8e-16
WP_076773160.1|924427_925147_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.7	2.1e-10
930108:930128	attR	ACTTTTGCTGGAAATGCTCTA	NA	NA	NA	NA
