The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015615	Acinetobacter schindleri strain ACE chromosome, complete genome	3001209	1008648	1015459	3001209		Acinetobacter_phage(71.43%)	8	NA	NA
WP_076753287.1|1008648_1010052_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.8	3.0e-16
WP_076753288.1|1010053_1010617_-	DUF4385 domain-containing protein	NA	A0A222YVL1	Synechococcus_phage	47.2	2.2e-31
WP_076753289.1|1010872_1011232_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_171249847.1|1011327_1011876_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	96.7	8.1e-95
WP_005221425.1|1011969_1012653_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	73.8	3.3e-85
WP_076753290.1|1013003_1013810_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	83.6	3.6e-123
WP_034424202.1|1013830_1014877_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	81.7	9.2e-156
WP_171261614.1|1014883_1015459_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	94.8	5.3e-105
>prophage 2
NZ_CP015615	Acinetobacter schindleri strain ACE chromosome, complete genome	3001209	1106046	1155922	3001209	holin,protease,transposase,tRNA	Catovirus(18.18%)	44	NA	NA
WP_004809604.1|1106046_1106517_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_008306679.1|1106464_1106860_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_076753339.1|1107600_1109328_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_076753340.1|1109822_1110527_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.5	9.3e-19
WP_076753341.1|1110772_1110964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004812282.1|1111387_1112041_+	YitT family protein	NA	NA	NA	NA	NA
WP_076753342.1|1113031_1115269_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_076753343.1|1115576_1116617_+	metallophosphoesterase	NA	A0A2I7QJ44	Vibrio_phage	38.2	1.1e-07
WP_076753344.1|1116696_1117119_-	OsmC family protein	NA	NA	NA	NA	NA
WP_004894131.1|1117266_1117971_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_076753345.1|1118152_1119202_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_004812293.1|1119452_1122032_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	33.2	2.3e-123
WP_076753346.1|1122182_1124387_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_008306560.1|1124634_1124961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004812299.1|1125183_1126200_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_076753347.1|1126210_1127449_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_076753348.1|1127633_1129127_+	OmpA family protein	NA	G3M9Z1	Bacillus_virus	37.8	1.5e-05
WP_076753349.1|1129253_1130033_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_076753350.1|1130170_1131784_+|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	29.6	4.1e-54
WP_076753351.1|1131826_1133254_+	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_076753352.1|1133420_1134137_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_076753353.1|1134295_1135741_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	63.3	9.4e-167
WP_004812313.1|1135959_1136571_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_076753354.1|1137021_1138131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076753355.1|1138187_1138970_-	thiazole synthase	NA	NA	NA	NA	NA
WP_004812315.1|1138984_1139182_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_076753356.1|1139210_1139576_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004894167.1|1139694_1140564_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.1	1.2e-44
WP_076753357.1|1140705_1140954_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_004280099.1|1141322_1141538_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	50.0	2.0e-12
WP_076753358.1|1141636_1142788_+	ATP-dependent RNA helicase RhlB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.7	1.5e-50
WP_076753359.1|1142845_1143226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048882061.1|1143484_1144066_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004812326.1|1144094_1145168_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_004894181.1|1145246_1145702_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_076753360.1|1145731_1146871_+	general secretion pathway protein GspL	NA	NA	NA	NA	NA
WP_071320483.1|1146870_1147350_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_048882065.1|1147440_1148442_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_004812336.1|1148447_1149029_+	CvpA family protein	NA	NA	NA	NA	NA
WP_076753361.1|1149053_1150589_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	1.9e-85
WP_171261599.1|1150677_1152567_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_076753363.1|1152767_1153418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076753364.1|1153424_1154393_+	D-glycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.8	1.1e-25
WP_076753365.1|1154518_1155922_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP015615	Acinetobacter schindleri strain ACE chromosome, complete genome	3001209	1229351	1240036	3001209		Organic_Lake_phycodnavirus(16.67%)	9	NA	NA
WP_076753413.1|1229351_1231490_+	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	8.8e-20
WP_004894337.1|1231486_1232674_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004812586.1|1232781_1233381_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	37.5	2.4e-23
WP_171261617.1|1233397_1233994_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	52.4	2.3e-10
WP_004812590.1|1234181_1235024_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	32.5	2.3e-32
WP_004812592.1|1235225_1235891_-	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	38.7	3.2e-29
WP_004812593.1|1236023_1236737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004812595.1|1236876_1237200_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_076753415.1|1237402_1240036_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.9	3.6e-39
>prophage 4
NZ_CP015615	Acinetobacter schindleri strain ACE chromosome, complete genome	3001209	1305054	1364060	3001209	transposase,protease,tRNA	uncultured_virus(23.08%)	57	NA	NA
WP_071320538.1|1305054_1306782_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.5	5.7e-187
WP_076753453.1|1306930_1307842_+	bestrophin	NA	NA	NA	NA	NA
WP_076753454.1|1307875_1308445_-	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_008305254.1|1308753_1308978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076753455.1|1309220_1310303_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_076753456.1|1310481_1314234_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004812716.1|1314352_1314850_+	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_076753457.1|1314905_1316420_-	sodium/proline symporter PutP	NA	A0A219Y9P9	Aeromonas_phage	24.4	2.1e-07
WP_076753458.1|1316829_1318281_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_076753459.1|1318411_1318771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076753460.1|1318893_1322352_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_076753461.1|1322593_1323028_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_076753462.1|1323086_1324640_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A218MLZ2	uncultured_virus	39.9	7.1e-27
WP_004812732.1|1324710_1325049_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_076753463.1|1325064_1326924_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	40.3	5.5e-103
WP_004812736.1|1326964_1327480_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_004812739.1|1327615_1327936_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	8.8e-25
WP_004812740.1|1327977_1328364_-	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	79.8	4.6e-52
WP_004812743.1|1328467_1329685_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	29.2	1.3e-28
WP_004812744.1|1329686_1330160_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_071320528.1|1330275_1330920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076753464.1|1331123_1331603_+	phasin family protein	NA	NA	NA	NA	NA
WP_004279807.1|1331760_1332033_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	58.4	1.9e-20
WP_076753465.1|1332164_1334030_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_076753466.1|1334226_1335099_-	DUF2797 domain-containing protein	NA	NA	NA	NA	NA
WP_004894508.1|1335133_1335604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076753467.1|1335706_1336399_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_076753468.1|1336459_1337080_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_008305220.1|1337100_1337409_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_076753469.1|1337423_1338428_-	adenosine kinase	NA	NA	NA	NA	NA
WP_004812759.1|1338703_1339153_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_076753470.1|1339318_1342258_+	insulinase family protein	NA	NA	NA	NA	NA
WP_005221819.1|1342277_1343426_+	phospholipase A	NA	NA	NA	NA	NA
WP_076753471.1|1343484_1344822_-	potassium transporter TrkH	NA	NA	NA	NA	NA
WP_004812766.1|1344818_1345475_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_004812768.1|1345664_1347203_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_004894532.1|1347307_1347979_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_071320524.1|1348119_1348806_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_076753472.1|1348835_1349306_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_071320558.1|1349253_1349649_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_076753473.1|1349863_1350130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171261618.1|1350263_1351319_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_048881650.1|1351394_1352144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048881649.1|1352163_1352577_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.4	1.2e-13
WP_008304701.1|1352586_1354863_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.3	1.3e-165
WP_076753475.1|1354965_1355319_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.8	3.0e-26
WP_005221845.1|1355337_1355814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076753476.1|1356153_1357446_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.4	1.0e-39
WP_004812788.1|1357499_1358420_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_048881644.1|1358530_1359184_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004810717.1|1359416_1360301_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_076753477.1|1360305_1361448_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_171249849.1|1361543_1362161_-	aminotransferase	NA	NA	NA	NA	NA
WP_076753478.1|1362196_1362679_-	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.4	2.8e-30
WP_004809153.1|1362931_1363162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048881099.1|1363246_1363717_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_076753479.1|1363664_1364060_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015615	Acinetobacter schindleri strain ACE chromosome, complete genome	3001209	2287153	2299666	3001209		uncultured_Caudovirales_phage(37.5%)	9	NA	NA
WP_076754093.1|2287153_2288821_-	sensor histidine kinase BfmS	NA	B5LWN0	Feldmannia_species_virus	29.2	8.1e-13
WP_004891693.1|2288863_2289580_-	response regulator transcription factor BfmR	NA	W8CYM9	Bacillus_phage	37.2	1.2e-37
WP_076754095.1|2290135_2292970_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	44.9	7.0e-174
WP_076754098.1|2293450_2294734_+	ribonucleotide-diphosphate reductase subunit beta	NA	S4VT34	Pandoravirus	32.3	6.2e-37
WP_076754100.1|2294840_2295269_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	64.5	3.0e-44
WP_076754102.1|2295352_2295670_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.8	1.0e-25
WP_076754105.1|2295680_2296721_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_076754107.1|2296725_2297430_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.2	5.7e-93
WP_076754109.1|2297539_2299666_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	46.1	2.3e-81
>prophage 6
NZ_CP015615	Acinetobacter schindleri strain ACE chromosome, complete genome	3001209	2903733	2910412	3001209		Escherichia_phage(50.0%)	6	NA	NA
WP_076754716.1|2903733_2904312_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.4	6.6e-47
WP_076754718.1|2904333_2905236_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	66.2	1.6e-108
WP_076754720.1|2905236_2906142_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.5	1.5e-29
WP_076754950.1|2906151_2907207_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	53.0	1.2e-99
WP_076754722.1|2907338_2909186_-	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	25.0	7.6e-20
WP_076754724.1|2909224_2910412_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L0G1	Tupanvirus	47.1	3.4e-98
>prophage 1
NZ_CP015616	Acinetobacter schindleri strain ACE plasmid p1AsACE, complete sequence	179461	109252	172975	179461	transposase,integrase	Tupanvirus(15.38%)	56	109201:109221	164388:164408
109201:109221	attL	ATAGGTTTGTGCAACAAAGCC	NA	NA	NA	NA
WP_076755075.1|109252_110458_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	35.0	1.3e-57
WP_004281821.1|111764_112115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076755078.1|113442_115077_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_048881938.1|115149_116424_+	MFS transporter	NA	NA	NA	NA	NA
WP_076755080.1|116480_116966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076755082.1|118196_118835_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_076755085.1|118851_119871_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004281836.1|120015_120624_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001087973.1|120735_120966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048881942.1|121049_122177_-	alkene reductase	NA	NA	NA	NA	NA
WP_004915316.1|122380_123058_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_076755087.1|123133_124291_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000920558.1|124895_125198_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004682262.1|125531_126362_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004682263.1|126590_127703_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.3	1.2e-31
WP_001133624.1|127724_128000_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_076755089.1|128467_129463_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_076755091.1|129452_130469_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_076755093.1|130483_131383_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004915298.1|131518_132259_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	26.0	1.1e-06
WP_076755096.1|132332_133331_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_076755098.1|133350_133635_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_076755100.1|133794_134727_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	43.3	9.6e-64
WP_045795875.1|135017_135620_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.9	7.9e-43
WP_076755103.1|135745_136534_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_076755106.1|136530_137742_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_076755108.1|137842_138736_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_076755110.1|138845_139418_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_076755112.1|139393_139891_+	chalcone isomerase family protein	NA	NA	NA	NA	NA
WP_076755114.1|139902_140589_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	4.8e-28
WP_076755116.1|140594_141929_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_076755119.1|141968_143018_-	class I SAM-dependent methyltransferase	NA	A0A2K9L0U7	Tupanvirus	25.1	3.2e-15
WP_048881861.1|143026_143806_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_076755121.1|143831_145028_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_076755123.1|145024_145819_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_048881864.1|145818_147111_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_048881865.1|147107_148094_-	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	27.9	7.4e-22
WP_048881866.1|148229_148778_-	lipocalin family protein	NA	A0A2K9L662	Tupanvirus	37.6	4.1e-22
WP_076755125.1|148947_149715_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_076755128.1|150105_151629_+	cryptochrome/photolyase family protein	NA	A0A1V0S9A0	Catovirus	29.1	1.0e-46
WP_076755130.1|151632_151785_+	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
WP_004976999.1|151781_152036_-	TIGR03643 family protein	NA	NA	NA	NA	NA
WP_076755132.1|154014_155247_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_076755134.1|155797_157453_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_076755136.1|158235_163284_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005105953.1|163280_163952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076755138.1|164520_167187_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.9	7.3e-157
164388:164408	attR	ATAGGTTTGTGCAACAAAGCC	NA	NA	NA	NA
WP_155768697.1|167229_167388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004647831.1|167481_168459_-	oxidoreductase	NA	NA	NA	NA	NA
WP_076755140.1|168540_169185_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_076755142.1|169526_170426_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034706843.1|170527_170971_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_076755144.1|170973_171657_+	LrgB family protein	NA	NA	NA	NA	NA
WP_076755148.1|172086_172353_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	64.0	2.7e-19
WP_081409108.1|172349_172697_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.2	3.9e-26
WP_004647840.1|172774_172975_+|transposase	transposase	transposase	NA	NA	NA	NA
