The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021982	Corynebacterium pseudotuberculosis strain MB302 chromosome, complete genome	2368811	1758257	1830374	2368811	protease,integrase,bacteriocin	Agrobacterium_phage(15.38%)	58	1805121:1805148	1811034:1811061
WP_014367461.1|1758257_1759544_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.8e-132
WP_014523534.1|1759704_1762509_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1762585_1763215_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1763230_1763830_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014367463.1|1764040_1765393_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1766181_1766424_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1766560_1767337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1767423_1768434_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1768551_1769025_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1769091_1769712_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014367469.1|1770045_1772661_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_151899125.1|1772797_1773103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014523536.1|1773081_1773660_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1773778_1774171_+	globin	NA	NA	NA	NA	NA
WP_088428654.1|1774182_1775079_+	DMT family transporter	NA	NA	NA	NA	NA
WP_013242473.1|1775082_1775691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1775696_1776125_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1776332_1778003_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014367473.1|1778192_1778753_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_014367476.1|1779280_1781035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1781031_1782570_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367478.1|1782596_1784075_+	nitroreductase	NA	NA	NA	NA	NA
WP_014367479.1|1784071_1786675_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1786674_1787688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1787684_1788665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367482.1|1788703_1788874_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014733038.1|1788947_1790399_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1790420_1791179_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1791175_1792099_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_014367486.1|1792189_1794235_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014367488.1|1794827_1797113_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014367489.1|1797132_1797333_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014367490.1|1797673_1799500_-	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	6.8e-29
WP_014733040.1|1799775_1800771_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014523547.1|1800897_1801701_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1801766_1802426_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014367495.1|1802605_1803433_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1803486_1804677_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1805121:1805148	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_050494099.1|1805295_1805973_+	hypothetical protein	NA	A0A1X9SFC1	Mycobacterium_phage	34.0	5.1e-22
WP_080713377.1|1805915_1806428_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032802512.1|1806879_1807884_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_050494101.1|1807880_1808690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367498.1|1809771_1810329_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.2	4.0e-33
WP_032802513.1|1810679_1810904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367502.1|1811373_1812372_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1811034:1811061	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_013242496.1|1812511_1813126_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	7.6e-17
WP_014800825.1|1813134_1813479_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_013242498.1|1813600_1813876_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1813964_1814444_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1814481_1815135_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013242501.1|1815147_1815537_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014367505.1|1815667_1824766_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1824990_1825296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367507.1|1825456_1826572_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014367508.1|1826568_1827195_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014367509.1|1827238_1828270_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_014524035.1|1828451_1829210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367511.1|1829708_1830374_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP021982	Corynebacterium pseudotuberculosis strain MB302 chromosome, complete genome	2368811	1984902	1993363	2368811	holin	Pandoravirus(33.33%)	11	NA	NA
WP_014367621.1|1984902_1986651_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.5	4.9e-61
WP_014367622.1|1986628_1987297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367623.1|1987304_1987691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367624.1|1987687_1988203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242641.1|1988213_1988660_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014367625.1|1988656_1989112_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_014655799.1|1989113_1989455_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014523608.1|1989441_1990224_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014367628.1|1990225_1990789_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_088428658.1|1990781_1992737_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.6e-111
WP_014300955.1|1992781_1993363_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
