The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024442	Corynebacterium pseudotuberculosis strain MB154 chromosome, complete genome	2371210	690791	764522	2371210	protease,bacteriocin,integrase	Tupanvirus(11.11%)	59	716692:716719	722602:722629
WP_032802571.1|690791_691091_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_013242516.1|691185_691722_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_014367517.1|691808_692627_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_014367516.1|692700_693594_+	glutamate racemase	NA	NA	NA	NA	NA
WP_014523555.1|693666_694434_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032802570.1|694472_695207_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_014367514.1|695203_695827_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_014367513.1|695895_696255_-	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_014367512.1|696342_696789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367511.1|697381_698047_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014524035.1|698545_699304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367509.1|699485_700517_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_014367508.1|700560_701187_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014655722.1|701183_702299_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014523551.1|702459_702765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013242501.1|712215_712605_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_013242500.1|712617_713271_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013242499.1|713308_713788_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242498.1|713876_714152_+	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_014800825.1|714273_714618_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014655718.1|714626_715181_-	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014367502.1|715380_716379_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
716692:716719	attL	GTGCGCCATCAGGGACTTGAACCCCGAA	NA	NA	NA	NA
WP_014367498.1|717422_717980_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.2	4.0e-33
WP_052399380.1|719433_719871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032802512.1|719867_720872_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_075140840.1|721321_721663_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_050494099.1|721776_722454_-	hypothetical protein	NA	A0A1X9SFC1	Mycobacterium_phage	34.0	5.1e-22
WP_014523549.1|723072_724263_+	L,D-transpeptidase	NA	NA	NA	NA	NA
722602:722629	attR	GTGCGCCATCAGGGACTTGAACCCCGAA	NA	NA	NA	NA
WP_014367495.1|724316_725144_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523548.1|725323_725983_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014523547.1|726048_726852_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_100086564.1|726978_727977_-	oxidoreductase	NA	NA	NA	NA	NA
WP_014367490.1|728252_730079_+	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	6.8e-29
WP_014367489.1|730419_730620_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014367486.1|733515_735561_+	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014367485.1|735651_736575_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_014367484.1|736571_737330_+	permease	NA	NA	NA	NA	NA
WP_014733038.1|737351_738803_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367482.1|738876_739047_-|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_100086565.1|739085_740066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367480.1|740062_741076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367479.1|741075_743679_-	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014523541.1|743675_745154_-	nitroreductase	NA	NA	NA	NA	NA
WP_014367477.1|745180_746719_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367476.1|746715_748470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367473.1|748998_749559_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_013242474.1|751624_752053_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_013242473.1|752058_752667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100086566.1|752670_753567_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014367472.1|753578_753971_-	globin	NA	NA	NA	NA	NA
WP_014523536.1|754089_754668_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367469.1|755089_757705_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_014367467.1|758038_758659_+	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_013242465.1|758725_759199_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367466.1|759316_760327_+	pirin family protein	NA	NA	NA	NA	NA
WP_014523535.1|760413_761190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014300878.1|761326_761569_-	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014524025.1|762359_763712_+	trigger factor	NA	NA	NA	NA	NA
WP_013242460.1|763922_764522_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
>prophage 2
NZ_CP024442	Corynebacterium pseudotuberculosis strain MB154 chromosome, complete genome	2371210	1423821	1432288	2371210	holin	Pandoravirus(33.33%)	11	NA	NA
WP_014300955.1|1423821_1424403_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
WP_088428658.1|1424447_1426403_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.6e-111
WP_014367628.1|1426395_1426959_+	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_100086585.1|1426960_1427743_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	31.3	4.6e-19
WP_014655799.1|1427729_1428071_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014367625.1|1428072_1428528_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_013242641.1|1428524_1428971_+	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014367624.1|1428981_1429497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367623.1|1429493_1429880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100086586.1|1429887_1430556_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_100086587.1|1430533_1432288_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.9	1.3e-56
