The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019116	Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 chromosome, complete genome	4648086	575027	638490	4648086	portal,protease,terminase,tRNA,holin,capsid,integrase,tail,plate	Vibrio_phage(32.56%)	79	593744:593789	635533:635578
WP_052907323.1|575027_576113_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000815601.1|576208_577276_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000098736.1|577272_577782_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212284.1|577899_578622_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_076165753.1|578624_579119_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_031602063.1|579291_580677_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
WP_001529075.1|580720_581545_-	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_001038577.1|581541_581979_-	STM0539 family protein	NA	NA	NA	NA	NA
WP_001143505.1|581971_582517_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190278.1|582644_582857_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729165.1|582858_583725_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
WP_000681026.1|584271_584829_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000619614.1|584903_585437_+	type 1 fimbrial protein subunit FimI	NA	NA	NA	NA	NA
WP_001531073.1|585480_586173_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_076165756.1|586203_588816_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000708678.1|588830_589838_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000603409.1|589847_590366_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000801271.1|590411_591044_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001258113.1|591647_592370_-	fimbria biosynthesis regulator FimY	NA	NA	NA	NA	NA
WP_000226498.1|592388_592700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000948629.1|592861_593458_-	fimbria biosynthesis transcriptional regulator FimW	NA	NA	NA	NA	NA
593744:593789	attL	CCTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCA	NA	NA	NA	NA
WP_000235761.1|593860_594052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844551.1|594418_594880_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	52.6	3.9e-42
WP_020844550.1|594876_595089_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	74.3	5.4e-23
WP_000687973.1|595085_595310_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	69.4	1.3e-19
WP_170908756.1|595306_595561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076165759.1|595869_596619_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	92.3	1.4e-129
WP_020844547.1|596630_597038_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	83.6	2.0e-61
WP_076165761.1|597027_597264_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	65.7	1.5e-21
WP_078054847.1|597263_597641_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	54.8	1.9e-26
WP_076165767.1|597603_597813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076165770.1|598000_598186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228516.1|598369_598687_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	51.0	3.0e-17
WP_000497764.1|598865_599561_-	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	67.5	7.4e-85
WP_023237655.1|599673_599928_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	52.9	5.7e-11
WP_076165773.1|600608_602237_+	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	84.5	1.6e-276
WP_076165775.1|602233_603199_+	toprim domain-containing protein	NA	A0A1B5FPA8	Escherichia_phage	96.6	3.8e-180
WP_076165778.1|603198_604059_+	helix-turn-helix domain containing protein	NA	A0A1B5FPA6	Escherichia_phage	83.2	1.1e-133
WP_076165779.1|604055_604871_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	73.4	1.2e-113
WP_024143313.1|605075_605441_+	hypothetical protein	NA	R9TR46	Vibrio_phage	59.8	1.8e-18
WP_000658039.1|605718_605907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294873.1|605996_606386_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_000226307.1|606372_606654_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_023195402.1|606653_607268_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.2	1.6e-107
WP_061377737.1|607264_607807_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_061377738.1|607909_608413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061377788.1|608658_608841_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_021000639.1|608924_609461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024143310.1|609819_610536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844528.1|611045_611636_+	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	53.7	1.4e-36
WP_076165782.1|611635_612181_+	hypothetical protein	NA	A0A067ZIZ9	Vibrio_phage	37.7	5.2e-17
WP_021000636.1|612186_614046_+|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	64.0	8.8e-234
WP_021000634.1|614293_615856_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	64.7	1.5e-189
WP_076165785.1|615848_616913_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	51.1	9.9e-81
WP_021000632.1|616923_617310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076165788.1|617325_618369_+|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	44.6	7.0e-71
WP_076165791.1|618369_618825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844520.1|618831_619176_+	hypothetical protein	NA	A0A067ZJA6	Vibrio_phage	44.9	1.2e-19
WP_061377741.1|619172_619658_+	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	36.7	6.4e-19
WP_061377742.1|619657_619957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061377743.1|619956_621426_+	hypothetical protein	NA	A0A059WKP9	Vibrio_phage	54.3	2.9e-147
WP_001623391.1|621438_621960_+|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	53.2	1.2e-47
WP_076165794.1|621969_622251_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_076165796.1|622405_624862_+|tail	phage tail tape measure protein	tail	A0A097I4X9	Vibrio_phage	26.5	2.9e-43
WP_021000622.1|624854_625073_+|tail	tail protein X	tail	A0A0C5AEF4	Bacteriophage	50.0	1.4e-10
WP_001623396.1|625062_626064_+	phage late control D	NA	A0A0C5AJ59	Bacteriophage	36.3	1.8e-55
WP_001623397.1|626064_626685_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	55.9	1.3e-32
WP_024145350.1|626681_627149_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_021000619.1|627145_627469_+	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	41.3	6.0e-13
WP_020844514.1|627465_628590_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	44.7	9.4e-90
WP_023220967.1|628582_629164_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	34.1	7.7e-19
WP_149867647.1|630112_631243_+|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	74.3	1.8e-168
WP_078054848.1|631212_631830_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	87.7	2.7e-99
WP_076165802.1|631833_632367_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	83.7	3.2e-80
WP_076167015.1|633537_634089_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	91.7	2.3e-89
WP_076165804.1|634167_635388_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.6	5.0e-36
WP_023230867.1|635942_636044_+	hypothetical protein	NA	NA	NA	NA	NA
635533:635578	attR	CCTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCA	NA	NA	NA	NA
WP_000339628.1|636094_636949_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000195934.1|637164_638490_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.5	2.3e-103
>prophage 2
NZ_CP019116	Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 chromosome, complete genome	4648086	1215203	1223494	4648086		Escherichia_phage(42.86%)	9	NA	NA
WP_000444508.1|1215203_1216454_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_000917280.1|1216900_1218025_+	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000275698.1|1219074_1219488_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
WP_000733630.1|1219504_1220233_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.6e-61
WP_000158843.1|1220425_1220968_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001277616.1|1221115_1221493_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_076167026.1|1221565_1222375_-	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	4.6e-62
WP_001036547.1|1222872_1223037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497451.1|1223254_1223494_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
>prophage 3
NZ_CP019116	Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 chromosome, complete genome	4648086	1885065	1938884	4648086	terminase,holin,lysis,integrase,tail,head,plate	Edwardsiella_phage(16.98%)	69	1894081:1894096	1938962:1938977
WP_001633683.1|1885065_1885599_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	42.4	1.6e-10
WP_023892808.1|1887435_1888266_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_023892807.1|1888300_1888534_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	47.7	4.3e-13
WP_031249986.1|1888530_1889373_+	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	49.8	4.0e-69
WP_000276802.1|1889360_1889540_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	62.1	4.3e-13
WP_023892805.1|1889633_1889891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023892804.1|1889887_1891969_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.1	1.8e-198
WP_022630509.1|1891965_1892382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001575998.1|1892454_1892733_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_022742740.1|1892707_1893787_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
1894081:1894096	attL	TTCGGACAAATTTCGG	NA	NA	NA	NA
WP_076166106.1|1894705_1895848_+	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_000282062.1|1895979_1896759_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_076166109.1|1897003_1897579_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.0	5.0e-95
WP_076166112.1|1897578_1899030_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	72.3	1.7e-43
WP_076166114.1|1899019_1899622_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	7.7e-30
WP_023257605.1|1899623_1900865_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_023257604.1|1900861_1901218_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	9.5e-20
WP_023257603.1|1901230_1901908_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
WP_000122818.1|1901888_1902758_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000890115.1|1902754_1903057_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000010346.1|1903056_1903767_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	8.5e-28
WP_058215126.1|1903763_1905935_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_000228831.1|1905918_1906101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023234167.1|1906142_1906547_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	8.2e-20
WP_000016414.1|1906546_1906993_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_076166117.1|1906993_1908478_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	3.1e-96
WP_000094504.1|1908458_1909004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076166120.1|1908988_1909354_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	1.8e-21
WP_001748491.1|1909350_1909935_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
WP_001748492.1|1909928_1910384_-	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
WP_076166123.1|1910390_1910738_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	8.7e-10
WP_001031913.1|1910741_1911770_-	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_001525451.1|1911769_1912252_-	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
WP_023139349.1|1912253_1913600_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
WP_000552017.1|1913596_1914286_-|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_076166126.1|1914326_1915847_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.1	6.3e-105
WP_022742723.1|1915846_1917268_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.8e-186
WP_076166129.1|1917233_1917986_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	75.6	5.3e-12
WP_001113128.1|1918056_1918239_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001534346.1|1918464_1918929_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	82.4	1.3e-56
WP_001208105.1|1919029_1919569_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.2	5.7e-77
WP_001525456.1|1919546_1919849_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_023139353.1|1920361_1921291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139354.1|1921839_1922181_-	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.1e-54
WP_050942040.1|1922530_1922812_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	84.8	1.2e-38
WP_021000145.1|1922808_1923003_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_022742730.1|1922999_1923599_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
WP_023139356.1|1923662_1923911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024150652.1|1924160_1924313_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_023139357.1|1924519_1924792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742732.1|1924788_1925184_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	6.4e-17
WP_157872077.1|1925196_1925739_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_076166135.1|1925650_1926658_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	3.4e-123
WP_078054855.1|1926701_1927196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033911.1|1927182_1927437_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001224472.1|1927533_1927959_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
WP_076166137.1|1928268_1928424_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	3.6e-08
WP_000613374.1|1928805_1929090_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_000799629.1|1929164_1929500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076166140.1|1929640_1932331_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	3.7e-116
WP_076166142.1|1932323_1933154_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	1.0e-104
WP_076166144.1|1933189_1933510_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	60.6	6.1e-34
WP_047598971.1|1933502_1933835_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	74.2	3.8e-15
WP_000276802.1|1934445_1934625_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	62.1	4.3e-13
WP_063390535.1|1934718_1934976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053445486.1|1934972_1937066_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.6	5.7e-197
WP_022630509.1|1937062_1937479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038390080.1|1937551_1937824_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	4.0e-10
WP_038390082.1|1937804_1938884_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	1.5e-100
1938962:1938977	attR	TTCGGACAAATTTCGG	NA	NA	NA	NA
>prophage 4
NZ_CP019116	Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 chromosome, complete genome	4648086	2043933	2051186	4648086		Morganella_phage(33.33%)	8	NA	NA
WP_001655552.1|2043933_2045364_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377042.1|2045437_2046133_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2046224_2046524_-	membrane protein	NA	NA	NA	NA	NA
WP_023214915.1|2047172_2048369_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.9	1.5e-109
WP_024131109.1|2048629_2048818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031602267.1|2048828_2049041_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	68.6	3.3e-20
WP_076166166.1|2049495_2050764_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	2.7e-226
WP_023229693.1|2050766_2051186_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.7	5.5e-35
>prophage 5
NZ_CP019116	Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 chromosome, complete genome	4648086	2204188	2213360	4648086	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195335.1|2204188_2206222_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703136.1|2206463_2206922_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_069721497.1|2207093_2207624_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_076166251.1|2207680_2208148_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	2.0e-73
WP_000598637.1|2208194_2208914_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2208910_2210596_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_076166254.1|2210818_2211550_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2211609_2211717_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2211697_2212429_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_052942727.1|2212412_2213360_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.0	3.7e-10
>prophage 6
NZ_CP019116	Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 chromosome, complete genome	4648086	2232767	2340150	4648086	portal,protease,terminase,holin,lysis,capsid,integrase,tail,head,plate	Salmonella_phage(57.14%)	117	2319838:2319855	2331342:2331359
WP_000989296.1|2232767_2233463_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001528350.1|2233616_2234501_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2234677_2235397_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2235393_2235639_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136412.1|2235843_2237085_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956092.1|2237078_2238314_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2238388_2239399_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535914.1|2239414_2240935_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036937.1|2241068_2242067_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628634.1|2242565_2243588_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001528497.1|2243737_2244880_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2244894_2245563_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425496.1|2245892_2246750_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2246738_2247128_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_076166257.1|2247132_2248500_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001606321.1|2248716_2249604_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_076166261.1|2249636_2250959_+	MFS transporter	NA	NA	NA	NA	NA
WP_024148570.1|2251002_2252994_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000534999.1|2253338_2254808_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|2254997_2255861_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|2255981_2257031_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873912.1|2257109_2257967_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	1.7e-22
WP_000854488.1|2258031_2259720_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2259736_2260675_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487284.1|2260674_2261805_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551934.1|2262174_2263356_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001645254.1|2263420_2264086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519564.1|2264087_2264210_-	membrane protein	NA	NA	NA	NA	NA
WP_001528509.1|2264597_2264852_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2265176_2265749_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_076166263.1|2265960_2266947_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178091.1|2266976_2267696_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2268109_2268682_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957762.1|2269007_2270564_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_023201575.1|2270670_2272476_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2272485_2273580_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137748.1|2273579_2274605_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203607.1|2274606_2276196_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	3.2e-19
WP_001094639.1|2276199_2276544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076166266.1|2276934_2278125_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	7.1e-19
WP_001234836.1|2278152_2278848_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578115.1|2278999_2280760_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	3.2e-100
WP_000494192.1|2280884_2281169_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050806.1|2281289_2282297_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2282476_2282704_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256159.1|2282735_2284496_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_076166268.1|2284919_2285591_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.0e-78
WP_076166271.1|2285616_2286048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076166273.1|2286132_2287401_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.9	5.6e-232
WP_000394200.1|2287403_2287823_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.8	3.8e-36
WP_076167038.1|2287994_2288552_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	89.1	5.7e-88
WP_076166277.1|2288580_2289702_+|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	75.1	3.2e-170
WP_078054858.1|2289671_2290289_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	93.8	1.0e-106
WP_076166283.1|2290292_2290826_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	83.7	1.4e-80
WP_076166285.1|2290828_2292214_-	hypothetical protein	NA	Q6K1H2	Salmonella_virus	56.8	7.5e-121
WP_076166288.1|2292200_2292788_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	98.5	1.2e-112
WP_076166291.1|2292790_2293870_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	98.9	4.7e-203
WP_000605051.1|2293862_2294276_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_076166294.1|2294280_2294814_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	99.4	3.2e-96
WP_076166297.1|2294813_2295872_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.4	1.9e-201
WP_076166300.1|2295868_2297209_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.3	1.1e-249
WP_023233177.1|2297242_2299171_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.7	0.0e+00
WP_000588851.1|2299255_2299582_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	98.1	3.3e-51
WP_000515952.1|2299578_2299935_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_047590468.1|2299934_2301431_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	99.8	6.1e-278
WP_000497739.1|2301420_2301585_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_076166303.1|2301588_2302149_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	97.8	9.8e-104
WP_001822325.1|2302145_2302658_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	99.4	1.0e-91
WP_000702410.1|2302629_2303034_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2303030_2303354_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2303356_2303557_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_023231285.1|2303607_2304813_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	99.8	1.2e-223
WP_001193639.1|2304827_2305478_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2305455_2306697_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2306696_2306879_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_076166306.1|2306890_2308624_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.7	0.0e+00
WP_000929191.1|2308620_2309115_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_076166309.1|2309238_2309589_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	1.7e-61
WP_046376798.1|2309641_2309836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024148265.1|2310366_2310759_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	84.6	1.3e-51
WP_023219694.1|2310748_2311219_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.8	8.5e-85
WP_023219695.1|2311222_2311558_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	95.5	7.7e-56
WP_076166312.1|2311854_2313186_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	1.6e-19
WP_078054859.1|2313214_2313583_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	80.8	9.7e-52
WP_076167040.1|2313597_2314587_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.2	1.3e-191
WP_023195407.1|2314594_2315455_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_076166329.1|2316751_2317234_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	1.8e-85
WP_076166332.1|2317235_2318195_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	9.1e-118
WP_071587914.1|2318184_2318364_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	9.2e-16
WP_046093492.1|2318527_2319082_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	7.6e-101
WP_076166335.1|2319125_2319326_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	81.5	3.3e-22
WP_001749159.1|2319414_2320089_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	86.9	1.7e-115
2319838:2319855	attL	GAGTATCGACCCGGCGAT	NA	NA	NA	NA
WP_023262052.1|2320263_2320572_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	5.0e-09
WP_071586821.1|2320509_2320848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_188318149.1|2321340_2321484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076166341.1|2321526_2321736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023233250.1|2321738_2322917_+|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	29.8	2.6e-29
WP_023233249.1|2323125_2323935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110923.1|2324520_2324724_+	DinI-like family protein	NA	NA	NA	NA	NA
WP_000281866.1|2324916_2325480_-	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001115500.1|2326298_2326946_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_076166343.1|2326989_2328033_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_000828299.1|2328029_2328587_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_076166345.1|2328583_2330515_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001522164.1|2330511_2330991_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000074110.1|2330987_2331200_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_031571853.1|2331196_2331934_-	heme ABC transporter permease	NA	NA	NA	NA	NA
2331342:2331359	attR	ATCGCCGGGTCGATACTC	NA	NA	NA	NA
WP_000990033.1|2331985_2332645_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_023225949.1|2332641_2333259_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	6.9e-10
WP_000431778.1|2333279_2333882_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835182.1|2333891_2334341_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_076166348.1|2334456_2335326_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091679.1|2335312_2336008_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778097.1|2336014_2338501_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_001260058.1|2338497_2338761_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000228062.1|2338750_2339242_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_076167042.1|2339655_2340150_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 7
NZ_CP019116	Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 chromosome, complete genome	4648086	3329831	3387132	4648086	protease,transposase	Enterobacteria_phage(10.53%)	58	NA	NA
WP_149867645.1|3329831_3331087_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
WP_000272678.1|3331285_3331618_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000071171.1|3331840_3333178_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_000764711.1|3333170_3334019_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.3	1.4e-21
WP_001107481.1|3334123_3336058_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.3	9.2e-117
WP_000145974.1|3336161_3336788_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_001592995.1|3336914_3337208_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_001148008.1|3337363_3337840_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_001212689.1|3338087_3339521_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_000673556.1|3339651_3340824_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_000813052.1|3340839_3341805_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000940593.1|3341934_3342192_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_000271398.1|3342211_3342523_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_001047353.1|3342780_3343752_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	7.8e-08
WP_000444168.1|3343984_3344272_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.7	3.5e-17
WP_000357288.1|3344329_3345589_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001518349.1|3345642_3345897_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_076166646.1|3346084_3346381_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_000476475.1|3346380_3347016_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_001193591.1|3347034_3347586_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_000925786.1|3347590_3348373_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_000531566.1|3348380_3349193_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	9.7e-20
WP_000922742.1|3349405_3350383_+	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.9	1.5e-06
WP_000018613.1|3350396_3351383_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	1.1e-38
WP_000030029.1|3351403_3351970_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.3	3.6e-53
WP_000047845.1|3351966_3352542_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669770.1|3352510_3353065_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224104.1|3353071_3353797_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.1e-22
WP_000809020.1|3353844_3355278_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176589.1|3355300_3355588_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_000609332.1|3355705_3356197_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243749.1|3356242_3357097_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_000216797.1|3357093_3357366_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000576801.1|3357612_3358245_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_001646420.1|3358319_3359048_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719815.1|3359044_3359698_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809807.1|3359924_3362261_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	6.0e-38
WP_023214003.1|3362354_3363284_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_076166649.1|3363955_3368416_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_023204559.1|3368425_3369844_+	glutamate synthase subunit GltD	NA	NA	NA	NA	NA
WP_181964962.1|3370047_3371253_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	87.4	1.3e-166
WP_071055695.1|3371311_3371716_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.4	8.5e-33
WP_076166657.1|3371869_3372973_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.1	1.9e-74
WP_000076263.1|3373088_3374342_+	cytosine permease	NA	NA	NA	NA	NA
WP_001180671.1|3374328_3375609_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_000979901.1|3375690_3376158_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000208981.1|3376154_3377030_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054444.1|3377026_3377716_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108071.1|3377762_3379253_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	21.9	2.7e-07
WP_001029667.1|3379368_3380262_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000382926.1|3380396_3381188_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366112.1|3381296_3381797_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
WP_000257298.1|3381802_3382441_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829815.1|3382754_3383147_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|3383162_3383591_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_076166660.1|3383892_3385017_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001519074.1|3385209_3385608_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_000716690.1|3385764_3387132_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.3	2.7e-22
