The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019179	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 chromosome, complete genome	4842582	1118072	1183845	4842582	plate,integrase,lysis,tail,portal,head,terminase,tRNA,transposase,capsid	Salmonella_phage(85.37%)	64	1102448:1102466	1146768:1146786
1102448:1102466	attL	TGGCAATAACGTATTGTTT	NA	NA	NA	NA
WP_089113803.1|1118072_1119183_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
WP_000445376.1|1119979_1120783_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_001574821.1|1122033_1123059_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	99.1	9.2e-201
WP_000052559.1|1123062_1123695_-	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.1e-66
WP_000102104.1|1123811_1124051_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_000957775.1|1124604_1124838_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000166366.1|1124785_1125244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963195.1|1125463_1125805_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_001244234.1|1125872_1126106_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000785509.1|1126105_1126333_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_000104186.1|1126329_1127187_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	99.6	1.5e-164
WP_000017509.1|1127183_1129580_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.9	0.0e+00
WP_001154444.1|1129735_1129924_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_000790439.1|1129992_1130292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000190536.1|1130402_1131281_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	4.0e-51
WP_001675485.1|1131701_1132856_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000389024.1|1132860_1133640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520369.1|1133636_1134668_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.3	5.9e-171
WP_001574814.1|1134667_1136434_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_000216232.1|1136576_1137410_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	5.9e-121
WP_000742505.1|1137426_1138485_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	4.9e-181
WP_000059191.1|1138488_1139139_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673520.1|1139234_1139699_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000868175.1|1139698_1139902_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1139905_1140121_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069909.1|1140101_1140614_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727849.1|1140615_1140993_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	5.1e-16
WP_001574811.1|1140989_1141418_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	1.3e-47
WP_001039937.1|1141513_1141945_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
WP_000829151.1|1141937_1142384_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	3.1e-60
WP_000192047.1|1142410_1143277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993756.1|1143372_1143951_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.8e-92
WP_000177484.1|1143947_1144307_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	91.5	3.5e-54
WP_000268273.1|1144293_1145202_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.0	7.2e-157
WP_001086804.1|1145194_1145800_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_001274650.1|1145796_1147482_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	50.6	3.5e-128
1146768:1146786	attR	TGGCAATAACGTATTGTTT	NA	NA	NA	NA
WP_000680167.1|1147484_1148012_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_000046103.1|1148142_1149315_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
WP_001207653.1|1149324_1149840_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280967.1|1149894_1150197_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_000763317.1|1150211_1150331_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_001282767.1|1150323_1153131_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.0	0.0e+00
WP_000980409.1|1153127_1153613_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_001102266.1|1153609_1154710_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	9.0e-194
WP_000980498.1|1154778_1154997_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_012543392.1|1155548_1156712_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001675488.1|1156719_1158333_-	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.6e-19
WP_001675489.1|1158364_1158895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533843.1|1158891_1160301_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237697.1|1160365_1171585_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1172199_1172682_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1172831_1173308_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1173297_1173588_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1173753_1174092_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880975.1|1174240_1175902_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059151.1|1175987_1176866_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1176989_1177580_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287926.1|1177614_1178220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1178340_1179627_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1179646_1180438_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1180603_1181965_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1182217_1182466_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1182484_1183033_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1183077_1183845_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP019179	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 chromosome, complete genome	4842582	1689535	1698706	4842582	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1689535_1690483_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1690466_1691198_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1691178_1691286_-	protein YohO	NA	NA	NA	NA	NA
WP_001240419.1|1691345_1692077_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	2.2e-100
WP_000272850.1|1692299_1693985_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1693981_1694701_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950411.1|1694747_1695215_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	8.8e-74
WP_001197951.1|1695271_1695802_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703135.1|1695973_1696432_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.2	7.1e-52
WP_000195332.1|1696672_1698706_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP019179	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 chromosome, complete genome	4842582	1765902	1776409	4842582		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144951.1|1765902_1767306_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1767483_1768377_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1768753_1769839_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1769838_1770738_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1770785_1771664_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1771664_1772216_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018217.1|1772221_1773196_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1773211_1773985_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565910.1|1773989_1775069_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000126349.1|1775095_1776409_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP019179	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 chromosome, complete genome	4842582	1883338	1935478	4842582	plate,transposase,holin,integrase,portal,head,terminase,tail,capsid	Salmonella_phage(83.33%)	63	1887238:1887252	1907558:1907572
WP_001127942.1|1883338_1885177_+|tail	tail fiber protein	tail	I1TR70	Cronobacter_phage	49.0	1.0e-32
WP_000028416.1|1885750_1886632_-	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	42.0	3.3e-29
WP_000072672.1|1887042_1887606_+	hypothetical protein	NA	NA	NA	NA	NA
1887238:1887252	attL	TTATCAATGACATCT	NA	NA	NA	NA
WP_001084817.1|1887967_1888465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042271.1|1888943_1889195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001675745.1|1889266_1890541_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.1	8.2e-74
WP_000598920.1|1890896_1891694_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532846.1|1891985_1892975_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	99.7	4.3e-195
WP_001527041.1|1892976_1893204_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061369.1|1893243_1893813_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	91.0	5.8e-104
WP_000208093.1|1893809_1894559_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	83.6	1.1e-46
WP_000082797.1|1894562_1895036_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.3	5.0e-69
WP_001017850.1|1895035_1895773_-	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	86.3	1.8e-52
WP_000008351.1|1895843_1896383_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080407.1|1896519_1897347_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	97.8	7.1e-151
WP_000997190.1|1897404_1897776_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001752499.1|1898475_1898772_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	98.0	1.1e-50
WP_001574551.1|1898752_1899004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024132396.1|1898931_1899117_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_001675744.1|1899321_1900017_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.1	6.6e-126
WP_001191666.1|1900114_1900339_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509727.1|1900367_1900922_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	5.9e-101
WP_001087407.1|1900918_1902061_+	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	87.4	4.8e-182
WP_000620702.1|1902057_1902282_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000096530.1|1902278_1903253_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	98.1	1.2e-165
WP_000054229.1|1903249_1903723_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	93.8	6.6e-53
WP_000200163.1|1903719_1904601_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	1.1e-170
WP_000779148.1|1904609_1904999_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061462.1|1905015_1905876_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	2.7e-161
WP_024132394.1|1905883_1906873_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	3.0e-188
WP_001047086.1|1906886_1907639_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	2.4e-134
1907558:1907572	attR	AGATGTCATTGATAA	NA	NA	NA	NA
WP_024132393.1|1907927_1908170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162273053.1|1908307_1908655_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	88.7	7.7e-51
WP_001148532.1|1908658_1909135_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.8	1.7e-85
WP_001574547.1|1909118_1909511_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	92.3	1.6e-57
WP_033868734.1|1910036_1910471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135209.1|1910598_1910949_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	8.0e-64
WP_000929191.1|1911075_1911570_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_000088185.1|1911566_1913300_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
WP_000605609.1|1913311_1913494_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466260.1|1913493_1914735_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	3.8e-241
WP_000257528.1|1915377_1916583_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_000601353.1|1916633_1916834_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000927378.1|1916836_1917160_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702409.1|1917156_1917561_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	99.3	5.4e-72
WP_001135697.1|1917532_1918045_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000779217.1|1918041_1918602_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	99.5	8.8e-105
WP_000497739.1|1918605_1918770_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007995.1|1918759_1920256_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.8	6.1e-278
WP_000515952.1|1920255_1920612_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1920608_1920935_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785386.1|1921019_1922948_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.7	0.0e+00
WP_000863818.1|1922981_1924322_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_001675739.1|1924318_1925383_+	hypothetical protein	NA	Q8HAC0	Salmonella_phage	95.1	4.2e-188
WP_001273649.1|1925375_1925909_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605050.1|1925913_1926327_+	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_000785580.1|1926319_1927399_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
WP_001207832.1|1927401_1927989_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_015701331.1|1929507_1930107_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000492926.1|1930391_1931399_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1931611_1931833_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_001176778.1|1933175_1933994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028173.1|1934455_1935478_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP019179	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 chromosome, complete genome	4842582	2623881	2722186	4842582	holin,integrase,lysis,protease,portal,terminase,tRNA,tail	Enterobacteria_phage(24.0%)	102	2674637:2674696	2722187:2722351
WP_001221017.1|2623881_2624577_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128807.1|2624634_2626545_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_000029550.1|2626675_2627020_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457328.1|2627025_2627205_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000978451.1|2627285_2628650_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.5	3.6e-43
WP_000381548.1|2628653_2629232_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624273.1|2629495_2630860_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001192535.1|2630997_2632599_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000421815.1|2632620_2634180_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
WP_000150523.1|2634652_2635621_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406920.1|2635673_2636474_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001518647.1|2636486_2637338_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156283.1|2637396_2637855_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001518359.1|2638263_2638830_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010923.1|2638826_2639636_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_000730323.1|2639701_2641447_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|2641666_2641876_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001675517.1|2641888_2642032_-	YobF family protein	NA	NA	NA	NA	NA
WP_001000659.1|2642680_2642968_-	YebO family protein	NA	NA	NA	NA	NA
WP_000847421.1|2643038_2643182_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001236777.1|2643339_2643579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262195.1|2643790_2644582_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_000416139.1|2644757_2646131_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984498.1|2646178_2647060_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|2647252_2649301_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2649320_2650007_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|2650104_2650602_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2650730_2652014_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001574233.1|2651982_2654616_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001531515.1|2654693_2656133_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2656250_2656487_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|2656597_2656789_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986173.1|2656807_2657458_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_045716530.1|2657681_2657801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182072.1|2658129_2658852_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_001752424.1|2659535_2659877_+	DUF1398 family protein	NA	NA	NA	NA	NA
WP_000030946.1|2660258_2660735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354407.1|2661107_2661527_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001752421.1|2661896_2662166_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_001617922.1|2662331_2662472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000480735.1|2666647_2666806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848073.1|2666815_2667430_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_001574229.1|2668577_2668703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001751604.1|2669270_2669471_+	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_049796172.1|2670026_2670452_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	93.0	1.7e-55
WP_001034751.1|2670924_2671116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2671180_2671348_+	lytic enzyme	NA	NA	NA	NA	NA
WP_000055326.1|2671604_2672138_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	3.2e-11
WP_001013468.1|2672134_2672422_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.9	1.6e-38
WP_000087644.1|2673556_2674636_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.1e-98
2674637:2674696	attL	TACTCCAATTTTCGTTGTGAAATAAATGTTAAATTTAATTTGATTGTGATATAACCAAAA	NA	NA	NA	NA
WP_001536069.1|2675589_2676390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001675653.1|2676869_2677589_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143180.1|2677790_2678360_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	3.4e-96
WP_000178848.1|2680610_2680853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072100756.1|2680891_2681755_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001576012.1|2684315_2685020_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606352.1|2684923_2685655_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	1.0e-113
WP_001152416.1|2685664_2686360_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2686449_2686983_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725268.1|2687099_2687597_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.9	1.4e-16
WP_000978295.1|2687695_2688028_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_077906652.1|2688024_2691012_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	2.8e-266
WP_010989009.1|2691091_2691421_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478858.1|2691417_2691816_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132757.1|2691861_2692611_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	4.8e-90
WP_000196703.1|2692622_2693024_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000453192.1|2693020_2693587_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000774239.1|2693567_2693867_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2693859_2694183_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2694273_2696355_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009211.1|2696278_2697826_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	7.0e-176
WP_000196190.1|2697822_2698029_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2698025_2700164_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2700120_2700654_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2700861_2701341_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2701358_2701811_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2701794_2702124_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2702399_2703086_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2703446_2703896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2704269_2704794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2704890_2705580_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2705709_2705937_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2705933_2706533_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000911593.1|2706596_2706845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2707533_2709513_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000529512.1|2709909_2711040_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000089417.1|2711326_2711722_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
WP_158000546.1|2711734_2712277_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.5	4.1e-67
WP_000729536.1|2712188_2713187_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.1e-121
WP_001574210.1|2713233_2713728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033912.1|2713714_2713969_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001574209.1|2714067_2714466_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_071591195.1|2714907_2715222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103933.1|2715483_2715759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|2715762_2715969_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000799627.1|2716044_2716380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023733.1|2716520_2719211_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	72.8	4.0e-118
WP_001126030.1|2719203_2720034_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	2.5e-103
WP_000280163.1|2720080_2720266_+	DUF1187 family protein	NA	NA	NA	NA	NA
WP_000743301.1|2720364_2720793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001675651.1|2720853_2721132_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.8e-10
WP_076031669.1|2721106_2722186_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.2	5.7e-100
2722187:2722351	attR	TACTCCAATTTTCGTTGTGAAATAAATGTTAAATTTAATTTGATTGTGATATAACCAAAAAGACCGGAATACAGAAATTCGGAAAAATTTCGGAAAATTTCGGAAAACGGATCGTAAGCGACTGTTTTATAAGAAAAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 6
NZ_CP019179	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 chromosome, complete genome	4842582	2956012	3016559	4842582	plate,holin,protease,terminase,tail	Salmonella_phage(48.78%)	63	NA	NA
WP_001262311.1|2956012_2957305_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.3e-252
WP_000065276.1|2957349_2957598_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|2957638_2957878_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000394220.1|2959042_2962231_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	74.1	0.0e+00
WP_000917690.1|2962371_2962542_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	51.0	3.9e-08
WP_001009036.1|2962940_2963345_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000869364.1|2963474_2963711_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|2963676_2964051_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|2964135_2965119_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|2965121_2965871_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|2965881_2966229_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|2966225_2966750_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445793.1|2966749_2967223_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	4.7e-67
WP_000208074.1|2967226_2967799_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_001217670.1|2968314_2968554_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000929791.1|2968887_2969490_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096561.1|2969698_2970310_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	1.3e-90
WP_001617856.1|2970306_2970453_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047633.1|2970442_2971240_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.4e-150
WP_162096904.1|2971644_2971986_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_001005899.1|2971988_2972603_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	1.2e-107
WP_001050813.1|2972599_2973151_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000403520.1|2973140_2973554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118137.1|2973615_2974590_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	37.3	1.6e-29
WP_000179870.1|2974579_2975851_+	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.3	1.1e-83
WP_001675525.1|2975850_2977281_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	3.4e-92
WP_001084016.1|2977252_2978128_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.5	1.5e-55
WP_001099363.1|2978128_2979703_+	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	2.2e-20
WP_001574105.1|2979723_2980596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110971.1|2980613_2981645_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.2	2.5e-73
WP_000780866.1|2981709_2982195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114360.1|2982207_2982633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031617308.1|2982650_2983061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139602.1|2983044_2983983_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.9	2.9e-52
WP_001018952.1|2983987_2985382_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.0	1.2e-70
WP_001133547.1|2985385_2985823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000268742.1|2985822_2986410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729222.1|2986533_2988588_+	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	36.3	7.7e-21
WP_000011140.1|2988587_2989085_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.0	8.9e-24
WP_000100901.1|2989300_2989576_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	33.3	1.6e-06
WP_001271127.1|2989575_2990628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000055864.1|2990624_2991341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261467.1|2991337_2991670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281708.1|2991666_2992893_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	63.6	3.2e-147
WP_000729406.1|2992876_2993503_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000583381.1|2993499_2995209_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000143167.1|2995208_2995790_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001574112.1|2996267_2997236_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	3.3e-192
WP_000334547.1|2997883_2998510_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|2998869_2999556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497439.1|2999826_3000018_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	93.7	1.8e-25
WP_000193790.1|3000444_3003057_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000291723.1|3003264_3004275_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001574119.1|3004440_3004983_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224079.1|3004979_3006089_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|3006187_3008296_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|3008308_3010216_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|3010230_3011484_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|3011488_3013129_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759134.1|3013125_3013689_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|3013944_3014112_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|3014211_3014730_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|3014798_3016559_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP019179	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 chromosome, complete genome	4842582	3068979	3076292	4842582	integrase,protease	Ralstonia_phage(16.67%)	7	3064035:3064049	3075028:3075042
3064035:3064049	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|3068979_3069357_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|3069518_3069716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3069928_3072205_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3072235_3072556_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3072879_3073101_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_001675419.1|3073230_3075177_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-39
3075028:3075042	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201752.1|3075173_3076292_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	8.1e-09
>prophage 8
NZ_CP019179	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 chromosome, complete genome	4842582	3413907	3459544	4842582	holin,lysis,integrase,protease,coat,portal,terminase	Salmonella_phage(69.35%)	63	3413574:3413614	3459562:3459602
3413574:3413614	attL	GCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
WP_000915523.1|3413907_3414270_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_000703618.1|3414266_3415193_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	96.7	1.4e-168
WP_001575778.1|3415173_3416826_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	38.0	1.5e-83
WP_000915528.1|3418309_3418672_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3418668_3419601_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671499.1|3419590_3421048_+	glucosyltransferase domain-containing protein	NA	E7C9N7	Salmonella_phage	99.8	1.7e-240
WP_000129929.1|3421106_3423110_-	endorhamnosidase	NA	E7C9U9	Salmonella_phage	99.9	0.0e+00
WP_000532175.1|3423245_3423497_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
WP_001085430.1|3423596_3423776_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000757527.1|3423789_3424155_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_000889769.1|3424185_3424515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262317.1|3424532_3426446_-	hypothetical protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
WP_000246968.1|3426445_3427750_-	DNA transfer protein	NA	E7C9U5	Salmonella_phage	96.3	7.8e-213
WP_000964898.1|3427760_3428450_-	hypothetical protein	NA	E7C9U4	Salmonella_phage	99.6	1.2e-108
WP_000627695.1|3428452_3428908_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
WP_000774923.1|3428907_3429609_-	hypothetical protein	NA	B8K1I3	Salmonella_phage	98.3	8.8e-70
WP_001122418.1|3429612_3431031_-	packaged DNA stabilization protein gp10	NA	I1TEJ1	Salmonella_phage	98.1	9.6e-273
WP_001166101.1|3430990_3431491_-	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
WP_000538677.1|3431474_3432035_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.9	1.4e-102
WP_001196933.1|3432075_3433368_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.8	1.1e-243
WP_000433856.1|3433367_3434279_-	scaffold protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
WP_000774659.1|3434292_3436470_-|portal	portal protein	portal	I6R968	Salmonella_phage	98.3	0.0e+00
WP_000417865.1|3436469_3437969_-|terminase	terminase large subunit	terminase	A8CGE0	Salmonella_phage	99.8	6.9e-306
WP_000729924.1|3437946_3438435_-	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_000013072.1|3438438_3438843_-	hypothetical protein	NA	C6ZR73	Salmonella_phage	100.0	5.3e-67
WP_001140560.1|3438842_3439232_-	hypothetical protein	NA	C6ZR72	Salmonella_phage	99.2	1.5e-74
WP_000807788.1|3439235_3439478_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000877030.1|3439736_3440267_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	4.0e-91
WP_000979454.1|3440479_3440950_-|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	87.2	1.2e-62
WP_001167374.1|3440946_3441384_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_000738703.1|3441367_3441694_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_000027545.1|3442073_3442562_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
WP_000176947.1|3442631_3442835_-	phage NinH family protein	NA	A0A075B8J4	Enterobacteria_phage	94.0	5.7e-30
WP_001008211.1|3442831_3443227_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	96.9	2.9e-70
WP_000566852.1|3443482_3443659_-	protein ninF	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.8e-27
WP_000113760.1|3443655_3443838_-	NinE family protein	NA	Q716C5	Shigella_phage	96.7	1.8e-27
WP_000679699.1|3443804_3443978_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
WP_001573980.1|3443974_3444847_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
WP_000736920.1|3444843_3445284_-	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	2.9e-79
WP_001248409.1|3445357_3446734_-	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
WP_001125981.1|3447542_3447689_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3447723_3448005_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3448115_3448331_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3448441_3449131_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000248006.1|3449219_3450143_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	100.0	1.5e-181
WP_000786969.1|3450178_3450388_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	5.5e-28
WP_000216172.1|3450751_3451084_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	100.0	2.2e-55
WP_000246164.1|3451162_3451363_+	antirestriction Ral family protein	NA	A0A1R3Y5S4	Salmonella_virus	100.0	1.0e-31
WP_001751411.1|3451402_3451702_+	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	99.0	3.3e-50
WP_001200016.1|3452025_3452166_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	2.0e-18
WP_000361564.1|3452158_3452272_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_000365270.1|3452465_3453173_+	recombinase	NA	E7C9Q0	Salmonella_phage	89.8	9.7e-125
WP_000168282.1|3453173_3453680_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	3.8e-91
WP_001016182.1|3453688_3454237_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
WP_001111323.1|3454252_3454546_+	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	100.0	5.5e-50
WP_001214770.1|3454556_3454727_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_000665849.1|3454723_3455305_+	hypothetical protein	NA	A0A0N6WGF1	Salmonella_phage	71.5	5.2e-68
WP_000267992.1|3455689_3455983_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	99.0	4.2e-50
WP_000208077.1|3455979_3457062_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.2	6.5e-80
WP_000002089.1|3457054_3457336_+	hypothetical protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	5.9e-49
WP_001447403.1|3457429_3457729_+	hypothetical protein	NA	G9L655	Escherichia_phage	99.0	7.1e-53
WP_001281201.1|3457806_3458151_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	97.4	1.1e-57
WP_001573970.1|3458380_3459544_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	97.1	1.0e-219
3459562:3459602	attR	GCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
>prophage 1
NZ_CP019180	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence	74560	0	1066	74560		Clostridium_virus(100.0%)	1	NA	NA
WP_001281416.1|580_1066_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.0	6.4e-11
>prophage 2
NZ_CP019180	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence	74560	22667	23418	74560		Rhodobacter_phage(50.0%)	2	NA	NA
WP_001181909.1|22667_22991_-	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	45.1	2.7e-13
WP_000220560.1|23136_23418_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
>prophage 3
NZ_CP019180	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence	74560	27627	31173	74560		Vibrio_virus(50.0%)	4	NA	NA
WP_000864788.1|27627_28248_-	ParA family protein	NA	A2I303	Vibrio_virus	33.8	6.3e-19
WP_001541562.1|29614_30181_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|30237_30573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|30756_31173_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
>prophage 4
NZ_CP019180	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence	74560	34722	35283	74560		Ralstonia_phage(100.0%)	1	NA	NA
WP_001240330.1|34722_35283_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
>prophage 5
NZ_CP019180	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence	74560	40788	40953	74560		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|40788_40953_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 6
NZ_CP019180	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence	74560	45898	49926	74560	integrase,transposase	Helicobacter_phage(33.33%)	6	37069:37083	53287:53301
37069:37083	attL	GAAGCGGTAAAACCG	NA	NA	NA	NA
WP_000064919.1|45898_46324_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
WP_001675600.1|46380_46740_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	76.7	3.0e-42
WP_000900095.1|46806_47367_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_001541544.1|47908_48418_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000545756.1|48421_49135_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000082169.1|49143_49926_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
53287:53301	attR	GAAGCGGTAAAACCG	NA	NA	NA	NA
>prophage 7
NZ_CP019180	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence	74560	61870	62396	74560	transposase	Stx2-converting_phage(100.0%)	2	NA	NA
WP_001675602.1|61870_62068_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	86.8	1.8e-25
WP_001675604.1|62222_62396_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.6	1.1e-16
>prophage 8
NZ_CP019180	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence	74560	67042	67783	74560		Xanthomonas_phage(100.0%)	1	NA	NA
WP_000177628.1|67042_67783_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.3	6.2e-05
>prophage 9
NZ_CP019180	Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence	74560	72132	72777	74560		Clostridioides_phage(100.0%)	1	NA	NA
WP_000203397.1|72132_72777_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	27.8	7.5e-07
