The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019172	Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 chromosome, complete genome	4777591	1597436	1627038	4777591	protease,holin,tail	Salmonella_phage(38.46%)	32	NA	NA
WP_021000536.1|1597436_1597931_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1598344_1598836_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1598825_1599089_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1599085_1601572_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1601578_1602274_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1602260_1603130_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1603245_1603695_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1603704_1604307_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1604327_1604945_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990039.1|1604941_1605601_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001674491.1|1605652_1606390_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074113.1|1606386_1606599_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053607.1|1606595_1607075_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_076033842.1|1607071_1609003_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1608999_1609557_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238332.1|1609553_1610597_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1610640_1611288_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1612017_1612581_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1612772_1612976_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1613278_1614070_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1614366_1614570_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1614738_1617105_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1617433_1618423_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1618437_1618806_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1618834_1620166_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1620462_1620792_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1621384_1622626_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215678.1|1622628_1623156_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	5.3e-11
WP_000022213.1|1623533_1623977_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1624030_1625860_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1626216_1626507_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1626534_1627038_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 2
NZ_CP019172	Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 chromosome, complete genome	4777591	1699119	1708290	4777591	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1699119_1700067_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1700050_1700782_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1700762_1700870_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1700929_1701661_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1701883_1703569_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1703565_1704285_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1704331_1704799_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1704855_1705386_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1705557_1706016_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195343.1|1706256_1708290_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 3
NZ_CP019172	Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 chromosome, complete genome	4777591	1776598	1787104	4777591		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111840.1|1776598_1778002_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	2.3e-21
WP_000981471.1|1778179_1779073_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_023206013.1|1779449_1780535_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	7.2e-103
WP_001023662.1|1780534_1781434_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1781481_1782360_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1782360_1782912_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1782917_1783910_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1783906_1784680_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1784684_1785764_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1785790_1787104_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP019172	Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 chromosome, complete genome	4777591	1876446	1883682	4777591		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1876446_1876866_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1876868_1878137_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1878591_1878804_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1878814_1879003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080668.1|1879263_1880442_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	6.6e-110
WP_000107430.1|1881091_1881391_+	membrane protein	NA	NA	NA	NA	NA
WP_000377042.1|1881482_1882178_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157301.1|1882251_1883682_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP019172	Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 chromosome, complete genome	4777591	1986917	1993726	4777591	integrase,tail	Salmonella_phage(33.33%)	11	1989127:1989149	1998842:1998864
WP_000856224.1|1986917_1987148_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1987285_1987660_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|1987660_1988536_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1988552_1988906_+	YebY family protein	NA	NA	NA	NA	NA
1989127:1989149	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|1989279_1990134_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|1990193_1990688_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|1990877_1991108_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|1991161_1991695_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|1991951_1992119_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|1992183_1992372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|1992844_1993726_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
1998842:1998864	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP019172	Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 chromosome, complete genome	4777591	2780341	2869443	4777591	head,tail,capsid,tRNA,portal,lysis,protease,terminase,holin	Salmonella_phage(45.45%)	94	NA	NA
WP_000938191.1|2780341_2781022_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2781642_2782302_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2782388_2782718_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2782714_2782996_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2783044_2783824_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859419.1|2783849_2784398_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2784612_2785824_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2785881_2786199_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2786243_2786657_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2786830_2787493_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2787587_2788046_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420517.1|2788081_2790136_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2790259_2790706_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950875.1|2790724_2792878_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2792864_2793470_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2793686_2794196_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2794552_2795605_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2795676_2796129_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2796314_2798075_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2798143_2798662_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2798761_2798929_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2799184_2799748_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2799744_2801385_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2801389_2802643_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2802657_2804565_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2804577_2806686_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2806784_2807894_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2807890_2808433_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2808598_2809609_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_023137761.1|2809816_2812429_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497440.1|2812855_2813062_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_001536069.1|2813537_2814338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010835411.1|2814905_2816396_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	98.6	1.6e-254
WP_000143168.1|2817225_2817807_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.3e-94
WP_023193196.1|2817806_2820302_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	E5G6P0	Salmonella_phage	76.1	7.3e-159
WP_000178849.1|2820355_2820598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514902.1|2820636_2823999_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.5	0.0e+00
WP_001750110.1|2824060_2824708_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.6e-89
WP_000662738.1|2824605_2825343_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.2	9.8e-128
WP_001152686.1|2825349_2826048_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	1.6e-103
WP_000447370.1|2826057_2826387_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_000372075.1|2826389_2829485_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.7	4.8e-277
WP_010989052.1|2829456_2829795_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2829791_2830187_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971953.1|2830237_2830984_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2830991_2831393_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000677089.1|2831389_2831968_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|2831954_2832332_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201485.1|2832342_2832708_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|2832765_2833794_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2833848_2834196_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189498.1|2834208_2835705_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
WP_000831821.1|2835694_2837275_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2837271_2837475_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623092.1|2837458_2839390_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_001102153.1|2839361_2839907_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_001750111.1|2840192_2840594_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001252721.1|2840850_2841354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031607240.1|2841682_2842132_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	6.1e-64
WP_000984583.1|2842149_2842602_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	4.6e-80
WP_001574216.1|2842585_2842915_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000798705.1|2844237_2844687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2844822_2844948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047630.1|2845346_2846144_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_001617856.1|2846133_2846280_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096547.1|2846276_2846888_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001750112.1|2847096_2847699_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2847733_2847982_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2848098_2848332_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000802853.1|2848579_2848906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107251218.1|2848999_2849068_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_000132543.1|2849048_2850266_-	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
WP_000974174.1|2850576_2850822_-	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
WP_000065089.1|2850821_2851142_-	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
WP_000113626.1|2851138_2851486_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
WP_001750113.1|2851496_2852246_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	99.2	7.3e-139
WP_001540689.1|2852248_2853232_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_010835408.1|2853316_2853691_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000992434.1|2853656_2853893_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_001230956.1|2853997_2854393_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_001750114.1|2854498_2855440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001750115.1|2855466_2855673_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	4.3e-17
WP_000551857.1|2856069_2856240_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	49.0	9.7e-07
WP_001750116.1|2856261_2856612_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	96.6	3.2e-60
WP_001750117.1|2856738_2859666_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.8	0.0e+00
WP_010835407.1|2859628_2860786_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2860828_2861068_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2861108_2861357_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2861401_2862694_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000191399.1|2862888_2864091_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2864168_2865605_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2865849_2867064_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2867380_2867842_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2868042_2869443_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
>prophage 7
NZ_CP019172	Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 chromosome, complete genome	4777591	3546487	3591982	4777591	transposase,portal,lysis,integrase,protease,terminase,holin,coat	Salmonella_phage(47.69%)	66	3539115:3539129	3599153:3599167
3539115:3539129	attL	TGTATGATTTTGCGC	NA	NA	NA	NA
WP_000915528.1|3546487_3546850_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3546846_3547779_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3547768_3549226_+	glucosyltransferase domain-containing protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_076033849.1|3549284_3551288_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	99.7	0.0e+00
WP_000532177.1|3551423_3551672_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3551692_3551986_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3552124_3554101_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_171970098.1|3554100_3555435_-	phage DNA ejection protein	NA	A0A220NR03	Salmonella_phage	99.8	1.0e-244
WP_006819472.1|3555444_3556134_-	hypothetical protein	NA	I1TEJ4	Salmonella_phage	100.0	3.9e-94
WP_000627703.1|3556136_3556592_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_000774919.1|3556591_3557230_-	hypothetical protein	NA	A8CGD2	Salmonella_phage	100.0	6.3e-91
WP_006819470.1|3557233_3558652_-	packaged DNA stabilization protein gp10	NA	A0A220NQZ5	Salmonella_phage	100.0	4.9e-277
WP_001166093.1|3558611_3559112_-	packaged DNA stabilization protein p27	NA	E7C9U0	Salmonella_phage	100.0	2.5e-90
WP_000538674.1|3559095_3559656_-	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_001196937.1|3559696_3560989_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_006831698.1|3560988_3561900_-	scaffolding protein	NA	Q5C834	Enterobacteria_phage	100.0	1.7e-161
WP_000774652.1|3561913_3564091_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_076033850.1|3564090_3565590_-|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	99.8	1.1e-306
WP_000729923.1|3565567_3566056_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_076033851.1|3566059_3566464_-	Decoration protein	NA	Q76H26	Enterobacteria_phage	100.0	1.8e-67
WP_001140562.1|3566463_3566853_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3566856_3567099_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_015995148.1|3567321_3567852_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	100.0	1.3e-94
WP_094915213.1|3567997_3569253_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
WP_076033852.1|3569379_3569850_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	85.8	1.2e-59
WP_001167374.1|3569846_3570284_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_000738703.1|3570267_3570594_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_058113761.1|3570972_3571461_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	86.4	6.8e-77
WP_000219140.1|3571457_3571637_-	hypothetical protein	NA	E7C9S6	Salmonella_phage	98.3	1.2e-23
WP_072101147.1|3571617_3571821_-	protein ninH	NA	A0A1R3Y5V4	Salmonella_virus	97.0	1.0e-31
WP_076033853.1|3571817_3572423_-	recombination protein NinG	NA	G9L693	Escherichia_phage	95.5	1.1e-92
WP_072156831.1|3572725_3572929_-	protein ninF	NA	I6S668	Salmonella_phage	89.5	2.3e-23
WP_023259232.1|3572921_3573323_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	84.2	1.0e-62
WP_029394717.1|3573325_3573502_-	NinE family protein	NA	K7P7K5	Enterobacteria_phage	98.3	2.7e-28
WP_058113764.1|3573498_3574344_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	57.0	1.4e-90
WP_058113765.1|3574340_3574787_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	98.6	6.0e-80
WP_058113766.1|3574743_3575040_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	95.9	3.7e-46
WP_052929403.1|3575042_3575291_-	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	97.6	4.4e-40
WP_001227831.1|3575302_3575497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076033854.1|3575573_3577010_-	AAA family ATPase	NA	E7C9R5	Salmonella_phage	99.0	7.4e-273
WP_000065657.1|3576999_3577899_-	hypothetical protein	NA	E7C9R4	Salmonella_phage	99.0	5.1e-155
WP_001125981.1|3577891_3578038_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3578072_3578354_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000067726.1|3578464_3578680_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_023177700.1|3578798_3579461_+	LexA family transcriptional regulator	NA	Q37946	Enterobacteria_phage	100.0	6.3e-126
WP_076033856.1|3579815_3580118_+	regulator	NA	B8K1E6	Salmonella_phage	96.0	2.4e-48
WP_053876321.1|3580130_3580718_-	super-infection exclusion protein B	NA	B8K1E5	Salmonella_phage	99.0	1.0e-87
WP_076033857.1|3580931_3581132_+	restriction endonuclease	NA	A0A1R3Y5S4	Salmonella_virus	95.5	5.6e-30
WP_022630926.1|3581159_3581402_+	hypothetical protein	NA	U5PUY0	Salmonella_phage	58.4	7.8e-18
WP_024144163.1|3581433_3581724_+	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	73.3	1.1e-31
WP_015995137.1|3582047_3582200_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	B8K1E2	Salmonella_phage	100.0	3.2e-25
WP_001749553.1|3582180_3582369_+	DUF5444 family protein	NA	B8K1E1	Salmonella_phage	100.0	1.6e-31
WP_000902087.1|3582358_3582502_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	100.0	2.4e-19
WP_001046981.1|3582498_3583206_+	recombinase	NA	A0A1R3Y600	Salmonella_virus	100.0	4.1e-139
WP_058113676.1|3583536_3583830_+	DUF2856 family protein	NA	A0A192Y654	Salmonella_phage	96.9	3.0e-48
WP_072156825.1|3583840_3584011_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	98.2	6.7e-24
WP_058113675.1|3584007_3584463_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	94.5	9.8e-62
WP_058113674.1|3584459_3584969_+	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	68.7	5.9e-39
WP_000360281.1|3584970_3585168_+	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	87.7	5.9e-32
WP_058113673.1|3585178_3585745_+	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	81.1	4.6e-69
WP_000509169.1|3585821_3586088_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
WP_058113672.1|3586332_3586683_+	hypothetical protein	NA	I6R980	Salmonella_phage	98.3	1.2e-59
WP_000051898.1|3586912_3588076_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	100.0	6.3e-230
WP_000893231.1|3588281_3589532_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3589543_3590647_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043663.1|3590929_3591982_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	1.1e-113
3599153:3599167	attR	TGTATGATTTTGCGC	NA	NA	NA	NA
>prophage 8
NZ_CP019172	Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 chromosome, complete genome	4777591	4363187	4410791	4777591	plate,tRNA,tail	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182230.1|4363187_4364186_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|4364273_4365584_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4365830_4366346_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4366444_4366654_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4366675_4366789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4366785_4368111_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4368289_4368898_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4369006_4369375_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4369545_4371966_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4372064_4372937_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4372950_4373448_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4373628_4374546_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4374709_4376068_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4376156_4377266_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4377627_4378818_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4378949_4380494_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4380508_4381399_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4381564_4381975_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4382117_4384214_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4384213_4384951_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4384947_4385616_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4385649_4385892_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4386335_4387985_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4388329_4389679_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4389811_4390159_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4390734_4391022_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4391024_4391630_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4391642_4391957_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4392116_4392572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4392568_4392766_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4392755_4394183_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_023137586.1|4394182_4394707_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	3.6e-68
WP_001003639.1|4394758_4395076_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4395035_4395164_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023137585.1|4395260_4397615_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.2	7.3e-68
WP_023137584.1|4397614_4398568_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	51.5	1.0e-36
WP_001269716.1|4398567_4398777_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023137583.1|4398764_4399808_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679390.1|4399817_4400540_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|4400863_4401226_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_023137582.1|4401222_4402152_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_023137581.1|4402151_4403699_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	5.5e-48
WP_001093501.1|4403862_4404222_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951737.1|4404212_4405328_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.0	2.0e-100
WP_000359509.1|4405320_4405953_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000368193.1|4405955_4407614_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_001151758.1|4407620_4408235_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084336.1|4408231_4408687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024133214.1|4409067_4409484_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000587740.1|4410062_4410791_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	7.3e-35
