The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015382	Klebsiella pneumoniae strain CN1 chromosome, complete genome	5237856	604110	711462	5237856	holin,transposase,terminase,tail,capsid,plate,portal,tRNA,integrase,lysis,head	Escherichia_phage(25.93%)	110	642491:642507	699423:699439
WP_002917917.1|604110_604509_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002917916.1|604511_604817_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_004144860.1|604862_605231_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_072196900.1|605380_605758_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_002917909.1|605766_606429_-	DedA family protein	NA	NA	NA	NA	NA
WP_002917907.1|606770_607547_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_002917905.1|607674_608976_-	MFS transporter	NA	NA	NA	NA	NA
WP_002917899.1|609456_610869_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_002917898.1|610887_612375_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_002917897.1|612504_613059_+	YgjV family protein	NA	NA	NA	NA	NA
WP_002917895.1|613074_614322_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_004144845.1|614588_615560_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	1.5e-35
WP_004181399.1|615831_616821_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_032433604.1|616894_617395_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_023158296.1|617414_618017_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002917889.1|618060_618768_+	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_002917887.1|618853_619984_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_038435067.1|620092_622114_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_004210520.1|622295_623894_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_032433599.1|623931_624903_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_002917730.1|625121_626609_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	28.7	1.3e-09
WP_002917729.1|626605_627640_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_002917727.1|627640_628639_+	histidine kinase	NA	NA	NA	NA	NA
WP_002917725.1|628640_629642_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_002917724.1|629653_630541_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_004181386.1|630537_630834_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_038435066.1|630880_632260_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.7	1.2e-30
WP_002917718.1|632517_633072_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004144829.1|633309_634086_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_004185760.1|634241_635891_-	glycerone kinase	NA	NA	NA	NA	NA
WP_023328340.1|635966_637388_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_004181378.1|637398_638031_-	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_002917682.1|638041_639112_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_031593445.1|639267_639453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002917681.1|639722_640820_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_002917680.1|640921_642847_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
642491:642507	attL	GACGATGACGCGCTGGC	NA	NA	NA	NA
WP_019704946.1|642824_643355_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_002917678.1|643355_643709_-	glycerol dehydratase reactivase beta/small subunit family protein	NA	NA	NA	NA	NA
WP_023328341.1|643729_644893_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_015875176.1|644914_645343_-	heme-binding protein	NA	NA	NA	NA	NA
WP_002917676.1|645756_647424_+	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_002917672.1|647436_648021_+	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_023328342.1|648023_648449_+	glycerol dehydratase small subunit DhaB3	NA	NA	NA	NA	NA
WP_002917661.1|648461_650285_+	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_002917658.1|650338_651142_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
WP_002917655.1|651194_651500_-	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_002917651.1|651526_652102_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_072196897.1|652342_653005_+	YfdX family protein	NA	NA	NA	NA	NA
WP_023328343.1|653095_656338_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.9	1.1e-34
WP_004174237.1|656342_656957_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_029602352.1|657258_657624_+	hdeB family protein	NA	NA	NA	NA	NA
WP_023328345.1|657692_657965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152391.1|658429_660145_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|660254_663284_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|663390_664416_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|664412_665192_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|665479_666361_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|666610_667930_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	NA	NA	NA	NA
WP_032433591.1|668309_669557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032433590.1|669579_670578_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	4.5e-192
WP_032433588.1|670577_671153_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.2	1.2e-59
WP_001630878.1|671282_671546_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_032433586.1|671576_672086_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	95.9	6.4e-86
WP_023343330.1|672093_672294_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	8.1e-29
WP_032433585.1|672257_672596_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
WP_032433580.1|672663_672891_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	97.3	2.9e-30
WP_032433578.1|672890_673112_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	95.9	5.5e-34
WP_072198081.1|673260_675330_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.4	0.0e+00
WP_004178082.1|675792_677280_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_048292468.1|677357_677798_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	95.6	3.4e-67
WP_162897204.1|678226_678382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071557792.1|678418_678727_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.1	2.4e-11
WP_032433573.1|678704_679655_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	37.7	8.7e-36
WP_032433571.1|679793_680225_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	93.7	2.9e-71
WP_032433569.1|680223_680418_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	64.1	4.7e-13
WP_032433567.1|680930_681974_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	4.4e-166
WP_009309687.1|681973_683743_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	6.3e-306
WP_032433566.1|683908_684763_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	9.6e-127
WP_025710540.1|684836_685895_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	4.9e-165
WP_072196895.1|685922_686642_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	78.2	3.1e-94
WP_009309691.1|686738_687245_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_019725382.1|687244_687448_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_032433564.1|687452_687743_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	80.6	2.2e-35
WP_032433563.1|687729_688227_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	84.8	4.8e-78
WP_032433560.1|688223_688655_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	1.1e-41
WP_032427129.1|688629_688788_+	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	74.0	3.8e-13
WP_032433558.1|688750_689218_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	9.1e-63
WP_032433555.1|689210_689660_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	4.7e-48
WP_045326985.1|689988_691032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015959011.1|691374_692016_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	2.0e-92
WP_014343405.1|692012_692360_+	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_032433553.1|692364_693273_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	5.2e-115
WP_076026137.1|693280_693868_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	56.8	4.1e-52
WP_125116968.1|693803_696134_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	40.8	7.2e-108
WP_032433551.1|696139_696868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032433550.1|696879_697959_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	43.3	4.7e-30
WP_019724797.1|698068_699250_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	7.9e-196
WP_032433549.1|699263_699779_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.0	1.2e-68
699423:699439	attR	GACGATGACGCGCTGGC	NA	NA	NA	NA
WP_004195711.1|699839_700115_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_014343413.1|700147_700267_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_032433547.1|700259_702698_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.8	2.1e-299
WP_023343304.1|702714_703194_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	80.9	1.3e-69
WP_032433545.1|703193_704354_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.6	8.3e-174
WP_032433542.1|704394_704802_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.3	1.2e-26
WP_023343301.1|704895_705114_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_002917636.1|705472_705979_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|706078_707920_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917631.1|708138_709884_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|709995_710211_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002916879.1|710448_711462_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 2
NZ_CP015382	Klebsiella pneumoniae strain CN1 chromosome, complete genome	5237856	1980175	2036735	5237856	plate,protease,transposase	Staphylococcus_phage(20.0%)	58	NA	NA
WP_002910830.1|1980175_1980922_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_032433236.1|1981361_1982342_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032433235.1|1982334_1983135_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004145488.1|1983172_1983295_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_004219597.1|1983592_1983736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|1983912_1984854_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|1984947_1985937_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|1985961_1987293_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|1987320_1988529_+	propionate kinase	NA	NA	NA	NA	NA
WP_021466440.1|1988557_1990852_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	3.9e-159
WP_004225356.1|1990902_1991049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189329.1|1991338_1992397_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|1992506_1993421_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004148804.1|1993430_1994717_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004200318.1|1994713_1995589_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004175491.1|1995585_1996305_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|1996310_1997204_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004148802.1|1997487_1999131_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|1999180_1999657_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|1999755_2000682_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175494.1|2000985_2002281_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_004145468.1|2002292_2003102_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|2003076_2003976_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2004085_2004568_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004899029.1|2004758_2005457_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|2005482_2006022_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2006136_2006466_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_032433232.1|2007034_2008375_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_032433231.1|2008371_2009025_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032433229.1|2009028_2010726_+	OmpA family protein	NA	NA	NA	NA	NA
WP_076026141.1|2011184_2013671_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_032433225.1|2013694_2015050_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_002910593.1|2015050_2015560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032433223.1|2015556_2016063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2016157_2016310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032433221.1|2016299_2016809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004175505.1|2017102_2018458_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_004200304.1|2018458_2018968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032433219.1|2018964_2019492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076026151.1|2019951_2020980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032427478.1|2021003_2021309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171970156.1|2021450_2021684_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_161271915.1|2021647_2022220_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	33.6	1.5e-06
WP_004217423.1|2022265_2022382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907365.1|2022403_2023297_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	26.8	6.3e-12
WP_032433213.1|2023472_2024366_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	26.8	3.7e-12
WP_038435084.1|2024391_2024520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955172.1|2025241_2026449_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_076026143.1|2026918_2027146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032433211.1|2027283_2027442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093174.1|2027524_2027710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004175522.1|2028007_2028274_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032433208.1|2028277_2029435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032433206.1|2029418_2032829_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_032433205.1|2032962_2034726_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_076026152.1|2034755_2035772_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_077255940.1|2035752_2036289_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004175538.1|2036291_2036735_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP015382	Klebsiella pneumoniae strain CN1 chromosome, complete genome	5237856	2110235	2160752	5237856	holin,terminase,tRNA,integrase,coat,head	Cronobacter_phage(23.08%)	70	2110044:2110065	2156241:2156262
2110044:2110065	attL	TTTTGTATGTGCTCTTTCGTGC	NA	NA	NA	NA
WP_023342699.1|2110235_2111459_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	59.0	4.3e-136
WP_038435006.1|2111641_2111866_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	48.6	4.7e-09
WP_004146321.1|2111867_2112086_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.1e-09
WP_032432674.1|2112082_2113159_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	69.5	4.7e-147
WP_032432677.1|2113155_2113812_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.0	2.1e-113
WP_038435005.1|2113808_2114237_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.0	5.8e-64
WP_032432679.1|2114233_2114914_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.5	6.7e-123
WP_032432680.1|2114910_2115756_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.5e-68
WP_016529276.1|2115771_2116056_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_045326713.1|2116126_2116561_-	hypothetical protein	NA	G0YQE7	Erwinia_phage	55.1	3.1e-41
WP_071888999.1|2116550_2116775_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	90.9	4.1e-29
WP_074403789.1|2116767_2116893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039110713.1|2117306_2117903_-	helix-turn-helix transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	9.0e-07
WP_038435003.1|2118011_2118224_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038435002.1|2118244_2118529_+	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	56.2	1.3e-19
WP_004151298.1|2118563_2118710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073545955.1|2118750_2119602_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	56.3	6.9e-85
WP_074181083.1|2119606_2121022_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.3	8.3e-184
WP_038434999.1|2121021_2121324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032432690.1|2121320_2121746_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	34.4	6.9e-09
WP_004178825.1|2121742_2121949_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	98.5	3.6e-32
WP_032432691.1|2122615_2122903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029497179.1|2122902_2123196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032432693.1|2123965_2124163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032432696.1|2124740_2124998_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	75.3	1.7e-26
WP_032432698.1|2125199_2125667_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	2.9e-32
WP_032432700.1|2125647_2125818_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	63.6	2.1e-09
WP_004141687.1|2125810_2126101_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	5.3e-45
WP_038434997.1|2126097_2126460_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	81.5	4.7e-51
WP_004884232.1|2126456_2126597_+	YlcG family protein	NA	NA	NA	NA	NA
WP_032432705.1|2126593_2127283_+	antiterminator	NA	I6PDF8	Cronobacter_phage	56.7	2.1e-63
WP_071814206.1|2127717_2127924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038434996.1|2127930_2128122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032432706.1|2128422_2128746_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	81.9	1.4e-41
WP_086372055.1|2128726_2129179_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	81.9	2.2e-66
WP_045326719.1|2129175_2129562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032432709.1|2130092_2130743_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	88.9	1.8e-101
WP_038434995.1|2130739_2132308_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	91.2	5.4e-301
WP_016529585.1|2132319_2133768_+	hypothetical protein	NA	F1C5D7	Cronobacter_phage	51.2	1.9e-119
WP_087744833.1|2133685_2134696_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.0	1.8e-111
WP_130166094.1|2134798_2135566_+	hypothetical protein	NA	A0A2I7S4B6	Vibrio_phage	32.9	1.7e-34
WP_039110712.1|2135815_2137171_+	hypothetical protein	NA	F1C5D9	Cronobacter_phage	53.1	3.0e-130
WP_016529582.1|2137170_2137632_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_038434992.1|2137628_2138684_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.0	1.5e-100
WP_038434991.1|2138716_2138956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038434989.1|2138958_2139339_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	3.1e-29
WP_038434988.1|2139338_2139512_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_038434987.1|2139511_2139874_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	50.0	4.8e-27
WP_032431569.1|2139876_2140245_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	1.0e-48
WP_023339086.1|2140241_2140625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032419302.1|2140627_2140849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038434986.1|2140908_2141673_+	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.4	6.1e-40
WP_038434985.1|2141740_2142445_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	2.8e-63
WP_038434984.1|2142625_2143156_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	85.8	2.6e-82
WP_071888997.1|2143241_2143574_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	54.5	2.3e-28
WP_038434983.1|2143635_2146287_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	41.5	3.5e-103
WP_038434982.1|2146329_2146806_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	5.1e-37
WP_023301685.1|2146805_2147276_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.6e-27
WP_023328737.1|2147272_2147668_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	55.6	1.2e-36
WP_038434981.1|2147654_2150132_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	1.6e-198
WP_039110706.1|2150220_2154057_+	hypothetical protein	NA	A0A2H5BNP5	Klebsiella_phage	69.5	0.0e+00
WP_038435080.1|2154219_2155227_+	acyltransferase	NA	NA	NA	NA	NA
WP_038434979.1|2155368_2155608_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	49.4	1.4e-14
WP_023339729.1|2155607_2155925_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.5	8.1e-23
WP_002910026.1|2156290_2158219_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
2156241:2156262	attR	TTTTGTATGTGCTCTTTCGTGC	NA	NA	NA	NA
WP_004189469.1|2158222_2158765_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_001124225.1|2158857_2159055_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2159105_2159462_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2159585_2159630_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002909105.1|2159768_2160752_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
>prophage 4
NZ_CP015382	Klebsiella pneumoniae strain CN1 chromosome, complete genome	5237856	2699074	2709961	5237856		Escherichia_phage(87.5%)	9	NA	NA
WP_032433071.1|2699074_2702182_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2702236_2703502_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2703532_2704621_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2704707_2704968_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|2705265_2706126_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2706146_2706908_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2707168_2708071_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|2708082_2709348_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|2709340_2709961_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP015382	Klebsiella pneumoniae strain CN1 chromosome, complete genome	5237856	3371435	3380900	5237856	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_032432850.1|3371435_3373157_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3373201_3373903_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3374256_3374475_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3374596_3376876_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3376906_3377224_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3377549_3377771_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004209695.1|3377847_3379788_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3379784_3380900_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 6
NZ_CP015382	Klebsiella pneumoniae strain CN1 chromosome, complete genome	5237856	4863252	4870981	5237856	transposase	Escherichia_phage(33.33%)	6	NA	NA
WP_000780222.1|4863252_4863534_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|4863514_4863844_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	43.1	3.1e-17
WP_076026135.1|4864167_4865136_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	7.9e-186
WP_032433760.1|4865674_4867255_+	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
WP_004151744.1|4867379_4867904_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
WP_004146620.1|4868155_4870981_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
>prophage 1
NZ_CP015383	Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence	182846	1101	42455	182846	transposase,integrase	Escherichia_phage(62.5%)	35	1037:1096	42461:43282
1037:1096	attL	TCGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|1101_1806_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000046891.1|2931_3267_-	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
WP_001515734.1|3509_4073_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001348195.1|4137_4512_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001097412.1|4535_5099_+	chlorite dismutase family protein	NA	NA	NA	NA	NA
WP_004186977.1|6446_7151_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
WP_001067855.1|9895_10600_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072094655.1|10948_12352_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|12385_13600_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|13860_14625_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|14767_15034_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|15254_15728_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|15883_16897_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|17110_17815_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014386481.1|18595_19240_-	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_001067855.1|23919_24624_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011977766.1|25644_25980_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|26152_26434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|26487_27099_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_011977825.1|27095_27257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145103.1|27283_28276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|28620_29325_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|30518_31061_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|31073_31934_-	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_001067855.1|32040_32745_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|33375_34206_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|34336_34891_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|35034_35739_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|35849_36092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000164043.1|36123_36774_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|36879_38079_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|38110_38995_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|39132_39540_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000509965.1|40301_40907_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001067855.1|41750_42455_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
42461:43282	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGATCTGGCGACTGGATCGTCTGAGCCGTTCCCTGAAAGACTTGATTGAAATGGTTAAACATCTGGAGTCGAAAGGTATCGGTTTAAAAAGCCTTCAGGAATCCATCGACACAACCTCCAGTTCCGGAATGCTGATATTTCATCTTTTTGGGGCACTGGCAGAATTTGAACGCAACCTGACAAGAGAGAGAACTCAGGCCGGGCTTCAGGCAGCACGAGCCAGAGGACGTAAGGGCGGCAGGCCGAAAACACTGAGTAAGGATAAACAGGCCCTTGCTGTTCAACTCTATAACGAGAAAAAACATACAGTTGCGCAGATTTGTGTGTTGATGGGGATATCGAGGCCAACGCTGTACAAATACATAGAGTCAGCCAGGTTGTTCAAGAAATGAACTTAGCGTACGTTTTCGTACGGTTGGGCTTCAAACCCCTCAGTCAATGACGCGGGAAGAGTATCTTTCTCTCTTCGCCAATGAAGCCGATCGAAATATTGCCTACGACCCGGAACCCATCGGTCGCTATAACGTCGCCCCGGGTACCAGGGTGTTACTTCTGAGCGAACGCGACGAACAGCTGCAGCTCGATCCGGTTCACTGGGGTTACGCACCAGGGTGGTGGGATAAACCGCCATTGATTAATGCCCGGGTTGAGACCGCAGCCAGCAGCAGGATGTTTAAACCTCTTTGGCAGCACGGTCGGGCGATCTGCTTTGCTGATGGCTGGTTTGAATGGAAGCGTGAAGGAGACAAGAAGCAGCCCTATTTC	NA	NA	NA	NA
>prophage 2
NZ_CP015383	Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence	182846	83611	133034	182846	transposase,holin,integrase	Macacine_betaherpesvirus(25.0%)	37	82914:82930	119396:119412
82914:82930	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_085955172.1|83611_84818_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|85858_87856_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_004152070.1|87918_89196_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_080895248.1|90178_91615_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004197688.1|92234_92492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814619.1|93164_94133_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
WP_071527918.1|94152_94464_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_039109834.1|94490_95438_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	2.3e-12
WP_001515717.1|96581_97322_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004182030.1|98039_99050_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_004182032.1|99801_100968_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	4.0e-224
WP_004182039.1|100967_101939_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_004182042.1|106538_107819_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000037308.1|107815_109768_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_004182043.1|110012_110264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004182047.1|111614_112040_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_024623221.1|112441_113953_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	1.1e-24
WP_004118481.1|114186_114417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118478.1|114936_115362_+	antirestriction protein	NA	NA	NA	NA	NA
WP_004152754.1|115598_115853_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
WP_004118473.1|115887_116205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004182050.1|116931_117159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568051.1|117250_117481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004182052.1|117532_118888_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_004182054.1|118935_119499_+	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
119396:119412	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
WP_004182056.1|120333_120876_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.3	9.3e-51
WP_004182058.1|120924_121173_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004182059.1|121242_123300_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	9.1e-22
WP_004182061.1|123344_123776_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004152640.1|123772_124501_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004152639.1|124497_124824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004182064.1|124879_125254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086937184.1|125453_126828_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
WP_009310020.1|126998_128039_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_162859354.1|128244_130527_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_004220208.1|130853_131933_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_032448955.1|131984_133034_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
