The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019219	Klebsiella pneumoniae strain 1756 chromosome, complete genome	5195816	1368239	1426297	5195816	terminase,portal,holin,tRNA,tail,integrase,protease	Enterobacteria_phage(20.83%)	70	1391248:1391269	1435765:1435786
WP_032421614.1|1368239_1369658_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|1369709_1370102_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|1370105_1370459_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004174930.1|1371080_1373252_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|1373300_1374503_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_064162517.1|1374849_1376091_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_002913419.1|1376148_1376508_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_004174934.1|1376638_1377631_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_040223984.1|1377811_1379473_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_032430102.1|1379469_1380705_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|1380968_1381934_+	glucokinase	NA	NA	NA	NA	NA
WP_002913374.1|1381987_1382725_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|1382736_1384434_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_032418593.1|1384432_1384546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004145585.1|1384542_1384728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023282889.1|1384816_1386031_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|1386101_1386173_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_023282888.1|1386511_1387708_-	cyanate transporter	NA	NA	NA	NA	NA
WP_023282887.1|1387704_1388163_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.9	3.8e-13
WP_076027189.1|1388295_1389204_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	6.0e-10
WP_004149226.1|1389213_1390095_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_002913367.1|1390462_1390945_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
1391248:1391269	attL	ATATCCATTTAACTAAGGGGAC	NA	NA	NA	NA
WP_076027190.1|1391464_1392634_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.0	7.5e-199
WP_071887251.1|1392753_1393773_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_077274034.1|1393883_1394084_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.4	1.6e-13
WP_076027192.1|1394091_1394712_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	60.3	3.3e-44
WP_004223219.1|1394708_1395089_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	95.2	6.0e-65
WP_187417456.1|1395088_1395703_-	hypothetical protein	NA	R9TPK2	Aeromonas_phage	93.2	3.3e-28
WP_076027193.1|1395713_1396466_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	85.6	9.0e-129
WP_076027194.1|1396462_1396720_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	74.1	2.5e-30
WP_187417457.1|1396716_1397214_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.6	4.3e-10
WP_032412080.1|1397341_1398127_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	9.0e-63
WP_076027196.1|1398126_1398426_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	6.5e-14
WP_076027197.1|1398513_1399431_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.5	4.0e-46
WP_076027198.1|1400145_1400841_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.7	1.2e-87
WP_001191665.1|1400938_1401181_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_004213338.1|1401215_1401677_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001208720.1|1401914_1402094_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_076027199.1|1402083_1403052_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	9.3e-86
WP_040186313.1|1403048_1403858_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	2.0e-110
WP_000779146.1|1403867_1404245_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_076027200.1|1404257_1405238_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.6	1.1e-134
WP_076027201.1|1405251_1405830_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	9.9e-51
WP_029497336.1|1405987_1406320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294159.1|1406414_1406801_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_071603196.1|1406787_1407069_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	47.3	2.4e-18
WP_076027202.1|1407068_1407698_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.4	2.7e-86
WP_076027203.1|1407700_1407976_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	71.9	8.9e-26
WP_065912073.1|1407926_1408112_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	2.0e-21
WP_039104040.1|1408429_1408633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039104038.1|1408751_1408997_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	4.2e-35
WP_163523724.1|1409105_1409483_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_071785246.1|1409549_1409735_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	1.9e-11
WP_014228567.1|1410056_1410548_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_070984122.1|1410547_1412656_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.5	0.0e+00
WP_020317294.1|1412652_1412868_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
WP_076027204.1|1412864_1414364_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.4	9.5e-247
WP_076027205.1|1414308_1416324_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.5	0.0e+00
WP_076027206.1|1416404_1416731_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	67.3	3.6e-34
WP_020317349.1|1416723_1417017_+	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_020317346.1|1417006_1417558_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.9	5.3e-54
WP_020804325.1|1417554_1417953_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_023304948.1|1417960_1418443_+	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_039104029.1|1418485_1418881_+|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	28.2	8.3e-09
WP_032420719.1|1418901_1419219_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_076027207.1|1419199_1421896_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.3	5.4e-200
WP_076027208.1|1421895_1422369_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.8	6.6e-53
WP_038433285.1|1422355_1422838_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
WP_048269234.1|1422845_1423232_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	50.8	4.7e-33
WP_076027209.1|1423228_1426297_+	kinase	NA	A0A286S259	Klebsiella_phage	66.5	0.0e+00
1435765:1435786	attR	ATATCCATTTAACTAAGGGGAC	NA	NA	NA	NA
>prophage 2
NZ_CP019219	Klebsiella pneumoniae strain 1756 chromosome, complete genome	5195816	1657456	1664363	5195816	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_023278799.1|1657456_1658320_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1658330_1659104_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|1659346_1660243_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1660485_1661847_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004890796.1|1662165_1662888_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1662884_1664363_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP019219	Klebsiella pneumoniae strain 1756 chromosome, complete genome	5195816	2630109	2640996	5195816		Escherichia_phage(87.5%)	9	NA	NA
WP_077274046.1|2630109_2633217_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2633271_2634537_+	MFS transporter	NA	NA	NA	NA	NA
WP_076027398.1|2634567_2635656_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.4	4.4e-209
WP_004176262.1|2635742_2636003_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|2636300_2637161_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2637181_2637943_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2638203_2639106_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|2639117_2640383_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|2640375_2640996_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP019219	Klebsiella pneumoniae strain 1756 chromosome, complete genome	5195816	2929957	2977972	5195816	tail,holin,terminase,integrase	Salmonella_phage(17.78%)	58	2917639:2917654	2975278:2975293
2917639:2917654	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_076027459.1|2929957_2931904_-	flagellar biosynthesis protein	NA	A0A286S1P0	Klebsiella_phage	82.8	1.8e-51
WP_076027460.1|2931981_2935050_-	kinase	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
WP_076027461.1|2935046_2935427_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	94.4	9.0e-69
WP_076027462.1|2935436_2935919_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.9	2.1e-83
WP_023322459.1|2935905_2936379_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.6	3.0e-61
WP_076027463.1|2936378_2939261_-|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.6	8.6e-103
WP_077254381.1|2939360_2939702_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	43.3	2.6e-06
WP_076027464.1|2939796_2939994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008807841.1|2940131_2940614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076027465.1|2940667_2941840_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_032434136.1|2941863_2942256_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_008807839.1|2942252_2942804_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
WP_076027466.1|2942805_2943135_-	glutamate 5-kinase	NA	NA	NA	NA	NA
WP_004184451.1|2943165_2943399_-	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	49.2	1.3e-09
WP_004190649.1|2943408_2943663_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_004190651.1|2943664_2944060_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	44.2	1.1e-13
WP_151391665.1|2944100_2944373_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004190653.1|2944381_2945335_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_076027467.1|2945345_2946131_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_076027468.1|2946215_2947328_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.9	2.8e-110
WP_008807834.1|2947311_2948712_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	9.2e-127
WP_008807833.1|2948711_2950019_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.1	1.6e-149
WP_076027469.1|2949996_2951001_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.0	1.3e-37
WP_016831935.1|2951349_2951595_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	95.1	6.7e-33
WP_016831934.1|2951879_2952101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016831932.1|2952841_2953042_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	5.9e-19
WP_062628070.1|2953225_2953501_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	46.1	5.1e-13
WP_004899661.1|2953503_2954133_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	77.5	3.1e-90
WP_008806056.1|2954132_2954414_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.1	1.3e-32
WP_025983157.1|2954400_2954796_-|holin	phage holin family protein	holin	G8C7V8	Escherichia_phage	73.1	1.5e-45
WP_032429808.1|2955548_2956037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130951621.1|2956039_2956342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076027470.1|2956606_2957389_-	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	1.7e-114
WP_004184498.1|2957385_2957682_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	75.0	4.1e-37
WP_076027472.1|2957890_2958487_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	5.0e-90
WP_072072840.1|2958522_2958756_-	hypothetical protein	NA	A0A0M4R5D9	Salmonella_phage	58.4	4.4e-18
WP_048299385.1|2959869_2960550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048299384.1|2960558_2961254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048299383.1|2961253_2961778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048299382.1|2961879_2962086_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	75.4	3.2e-20
WP_048299381.1|2962277_2962646_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.6	3.2e-10
WP_048299380.1|2962653_2963403_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	81.5	9.3e-118
WP_180298460.1|2963405_2964287_-	hypothetical protein	NA	S5MC07	Escherichia_phage	54.0	2.4e-24
WP_048299379.1|2964304_2965099_-	ParB/RepB/Spo0J family partition protein	NA	C7BGF1	Burkholderia_phage	51.7	7.4e-65
WP_048299378.1|2965227_2965764_-	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	70.6	4.7e-63
WP_072072839.1|2965766_2966000_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	60.3	4.7e-20
WP_031593521.1|2966104_2966500_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	71.8	3.5e-47
WP_031593522.1|2966795_2967635_+	hypothetical protein	NA	A0A0R6PIN1	Moraxella_phage	32.7	6.3e-30
WP_076027473.1|2968143_2968452_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	5.0e-25
WP_004179600.1|2968748_2968940_+	YebW family protein	NA	NA	NA	NA	NA
WP_022631175.1|2968948_2969104_+	DNA breaking-rejoining protein	NA	K7PGY4	Enterobacteria_phage	71.2	1.5e-14
WP_049124967.1|2969241_2972292_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	57.4	6.2e-293
WP_022631173.1|2972304_2973414_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.7	1.0e-184
WP_022631172.1|2973454_2973694_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
WP_012542039.1|2973914_2975132_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	3.3e-120
WP_004151901.1|2975278_2976169_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
2975278:2975293	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|2976168_2977161_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|2977162_2977972_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 5
NZ_CP019219	Klebsiella pneumoniae strain 1756 chromosome, complete genome	5195816	3402889	3412353	5195816	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_012737718.1|3402889_3404611_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3404655_3405357_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3405710_3405929_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3406049_3408329_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3408359_3408677_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3409002_3409224_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3409300_3411241_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3411237_3412353_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP019220	Klebsiella pneumoniae strain 1756 plasmid pKp1756, complete sequence	73952	12007	61350	73952	transposase	Escherichia_phage(35.71%)	42	NA	NA
WP_000038402.1|12007_12934_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.5e-66
WP_001348086.1|12956_13154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148285.1|13184_13436_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001161115.1|13469_13667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001077023.1|14015_14864_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000157098.1|14949_15285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283947.1|15518_15851_+	IncI1-type relaxosome accessory protein NikA	NA	NA	NA	NA	NA
WP_001405892.1|15861_18561_+	IncI1-type relaxase NikB	NA	NA	NA	NA	NA
WP_001289276.1|18597_20889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011264050.1|20881_21952_-	IncI1-type conjugal transfer protein TrbB	NA	NA	NA	NA	NA
WP_011264049.1|21970_23179_-	IncI1-type conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_000118520.1|24463_24781_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001221666.1|24777_25311_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_000976514.1|25404_26550_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_000907866.1|27796_28828_+	replication initiation protein	NA	NA	NA	NA	NA
WP_000841013.1|29525_29741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001579760.1|29737_30730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000521604.1|30788_31406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|32766_33627_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|34322_35027_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018329.1|35177_35993_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_000027057.1|37064_37925_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|38620_39325_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018329.1|39475_40291_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067858.1|40480_41185_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001300294.1|42574_43243_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|43278_43515_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|43511_43874_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|43891_45586_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_000732292.1|46091_46367_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|46380_46731_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|46802_47237_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001532073.1|47373_48588_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	2.1e-34
WP_072135327.1|48621_50025_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
WP_032491824.1|51542_52334_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
WP_001067858.1|53783_54488_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000080860.1|57010_58147_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|58197_58425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|58448_58640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|59121_59664_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|59676_60537_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|60645_61350_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP019220	Klebsiella pneumoniae strain 1756 plasmid pKp1756, complete sequence	73952	67245	72634	73952	integrase	Escherichia_phage(33.33%)	8	64546:64558	70899:70911
64546:64558	attL	TGAAATCAGCCAG	NA	NA	NA	NA
WP_001372173.1|67245_68028_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_000239529.1|68165_68441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|68434_69079_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103690.1|69307_70279_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000340829.1|70283_70676_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000457523.1|70680_71952_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
70899:70911	attR	TGAAATCAGCCAG	NA	NA	NA	NA
WP_000109071.1|71951_72389_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|72385_72634_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
