The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018935	Bacillus cereus strain JEM-2 chromosome, complete genome	5229506	883291	893836	5229506	holin	Bacillus_phage(62.5%)	9	NA	NA
WP_000609128.1|883291_883966_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	6.1e-36
WP_075396510.1|883968_885144_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_075396509.1|885256_886480_-	hypothetical protein	NA	A0A173GB44	Bacillus_phage	44.1	5.9e-21
WP_075396508.1|886683_887967_-	C40 family peptidase	NA	A0A2I7SDE4	Paenibacillus_phage	30.7	2.6e-19
WP_075396507.1|888070_889054_-	N-acetylmuramoyl-L-alanine amidase	NA	A9QTG1	Bacillus_phage	74.6	5.9e-88
WP_000930102.1|889058_889484_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	72.1	1.1e-46
WP_075396506.1|890250_890634_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	43.8	2.1e-17
WP_000402993.1|891004_891358_+	helix-turn-helix transcriptional regulator	NA	A0A2I7SDF8	Paenibacillus_phage	36.5	1.0e-05
WP_139316730.1|892519_893836_+	SH3 domain-containing protein	NA	J9PQW7	Bacillus_phage	72.8	9.2e-36
>prophage 2
NZ_CP018935	Bacillus cereus strain JEM-2 chromosome, complete genome	5229506	1392076	1400449	5229506		Synechococcus_phage(50.0%)	8	NA	NA
WP_075396331.1|1392076_1392664_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.8	7.7e-27
WP_001262445.1|1392660_1393701_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	3.2e-68
WP_000879025.1|1393803_1395219_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_075396330.1|1395203_1397423_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	7.4e-163
WP_000666779.1|1397406_1398090_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278820.1|1398086_1398341_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170540.1|1398333_1399053_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	2.0e-48
WP_000625683.1|1399141_1400449_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
>prophage 3
NZ_CP018935	Bacillus cereus strain JEM-2 chromosome, complete genome	5229506	1445510	1453460	5229506		Bacillus_phage(33.33%)	6	NA	NA
WP_075396323.1|1445510_1447016_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	9.2e-32
WP_000929888.1|1446999_1447701_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_075396322.1|1447846_1449172_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	9.2e-44
WP_000743900.1|1449556_1451095_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	2.6e-21
WP_001029999.1|1451502_1453137_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
WP_000917306.1|1453175_1453460_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.2e-20
>prophage 4
NZ_CP018935	Bacillus cereus strain JEM-2 chromosome, complete genome	5229506	4423017	4465318	5229506	integrase,holin,capsid,tail,bacteriocin,protease,head,terminase,portal	Bacillus_phage(83.78%)	52	4449420:4449434	4470510:4470524
WP_075666810.1|4423017_4424082_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	91.5	3.6e-192
WP_075666809.1|4424078_4424318_-|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	91.1	1.0e-30
WP_075666808.1|4424317_4424554_-	hypothetical protein	NA	A0A1B1P887	Bacillus_phage	80.3	2.5e-24
WP_075666807.1|4424629_4425334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075666806.1|4425627_4429494_-	peptidase S74	NA	Q2I8E8	Bacillus_phage	87.1	0.0e+00
WP_075395983.1|4429490_4430981_-|tail	phage tail protein	tail	A0A288WFS2	Bacillus_phage	98.4	1.2e-289
WP_075395984.1|4430995_4434847_-|tail	phage tail tape measure protein	tail	Q2I8F0	Bacillus_phage	97.7	0.0e+00
WP_000344052.1|4434861_4435038_-	hypothetical protein	NA	A0A288WFY6	Bacillus_phage	100.0	3.4e-15
WP_000779158.1|4435067_4435385_-	hypothetical protein	NA	A0A288WFU2	Bacillus_phage	95.2	3.2e-51
WP_000896772.1|4435433_4436042_-|tail	tail protein	tail	A0A288WG55	Bacillus_phage	99.0	4.8e-104
WP_075395985.1|4436042_4436402_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	95.0	1.0e-58
WP_075395986.1|4436398_4436836_-	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	98.6	6.7e-76
WP_001068017.1|4436828_4437152_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	92.5	7.0e-54
WP_000244595.1|4437148_4437427_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	95.6	9.9e-41
WP_075395987.1|4437447_4438620_-|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	93.1	1.7e-198
WP_075395988.1|4438657_4439368_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	96.2	7.5e-125
WP_075395989.1|4439354_4440608_-|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	98.6	6.1e-239
WP_075395990.1|4440796_4442491_-|terminase	terminase large subunit	terminase	A0A2H4JB98	uncultured_Caudovirales_phage	99.3	6.2e-312
WP_075396036.1|4442492_4442987_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J8E3	uncultured_Caudovirales_phage	98.8	8.1e-86
WP_075395991.1|4443104_4443503_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	97.3	1.0e-59
WP_001198484.1|4443492_4443747_-	hypothetical protein	NA	A0A2H4J3B1	uncultured_Caudovirales_phage	100.0	1.3e-44
WP_075395992.1|4443880_4444093_-	hypothetical protein	NA	A0A1B1P8F3	Bacillus_phage	98.6	1.0e-29
WP_155119909.1|4444089_4444245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075395993.1|4444414_4444741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075395995.1|4445459_4446005_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075395996.1|4446396_4447299_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_075395997.1|4447506_4448049_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.1	2.5e-88
WP_075395998.1|4448048_4448531_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.4e-71
WP_000645586.1|4448835_4448958_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_075396000.1|4448981_4449284_-	hypothetical protein	NA	Q3HKX6	Bacillus_phage	72.0	1.3e-33
4449420:4449434	attL	TTTAATAATTTTATA	NA	NA	NA	NA
WP_075396001.1|4449772_4449967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075396002.1|4450238_4450445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075396003.1|4451020_4451248_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	97.3	6.0e-36
WP_075396004.1|4451250_4451526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075396005.1|4451559_4451829_-	hypothetical protein	NA	D2XR50	Bacillus_phage	84.3	1.4e-36
WP_075396006.1|4452108_4454106_+	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_075396037.1|4454286_4454781_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	50.5	3.1e-21
WP_075396007.1|4454796_4455216_-	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	43.0	4.8e-15
WP_075396008.1|4455228_4455483_-	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	91.7	3.2e-38
WP_075396009.1|4455497_4455671_-	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	98.2	4.7e-25
WP_075396010.1|4455889_4456693_-	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	98.5	5.6e-145
WP_139316691.1|4456661_4457537_-	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	96.2	3.7e-49
WP_075396013.1|4457913_4458180_-	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	76.5	1.4e-28
WP_044792376.1|4458236_4458428_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	85.2	2.4e-22
WP_075396014.1|4458644_4458998_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	92.2	3.2e-52
WP_075396015.1|4459322_4459469_-	complement C1q protein	NA	NA	NA	NA	NA
WP_075396016.1|4459506_4460658_-	hypothetical protein	NA	A0A1B0T6A5	Bacillus_phage	32.8	2.1e-52
WP_075666805.1|4461298_4461778_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_075396017.1|4462077_4463187_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.1	5.2e-149
WP_000413152.1|4463255_4463927_-	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_042332081.1|4464236_4464722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080496862.1|4465108_4465318_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
4470510:4470524	attR	TTTAATAATTTTATA	NA	NA	NA	NA
>prophage 5
NZ_CP018935	Bacillus cereus strain JEM-2 chromosome, complete genome	5229506	4747142	4753359	5229506		Bacillus_phage(71.43%)	10	NA	NA
WP_139316659.1|4747142_4747727_-	hypothetical protein	NA	A0A288WFQ7	Bacillus_phage	77.5	2.9e-82
WP_075395665.1|4747704_4748895_-	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	65.2	2.9e-145
WP_075395666.1|4749013_4749196_-	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	76.7	9.1e-19
WP_075395667.1|4749192_4749495_-	hypothetical protein	NA	H0USY0	Bacillus_phage	54.6	2.4e-24
WP_080496853.1|4749678_4749897_+	helix-turn-helix transcriptional regulator	NA	A0A0S2SXU5	Bacillus_phage	52.3	2.9e-11
WP_075395668.1|4749893_4750478_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_075395669.1|4750606_4751059_+	SHOCT domain-containing protein	NA	B8R671	Lactobacillus_phage	36.2	3.6e-08
WP_075395670.1|4751150_4752122_+	DUF91 domain-containing protein	NA	NA	NA	NA	NA
WP_075395671.1|4752238_4752835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075395672.1|4753005_4753359_+	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	29.6	8.2e-08
>prophage 6
NZ_CP018935	Bacillus cereus strain JEM-2 chromosome, complete genome	5229506	5062810	5071545	5229506		Bacillus_phage(71.43%)	9	NA	NA
WP_075395549.1|5062810_5063683_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.9	1.1e-66
WP_003158174.1|5063825_5063939_-	hypothetical protein	NA	W8CYT3	Bacillus_phage	95.8	1.6e-05
WP_000818985.1|5064055_5064775_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000823559.1|5064970_5065558_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_001231492.1|5065582_5066656_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	88.2	2.7e-171
WP_128294964.1|5066652_5067339_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	93.4	8.5e-118
WP_000453764.1|5067418_5069179_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.5	8.2e-266
WP_001194297.1|5069419_5070184_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755546.1|5070282_5071545_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
>prophage 1
NZ_CP018936	Bacillus cereus strain JEM-2 plasmid unnamed1, complete sequence	94665	15050	22011	94665	integrase	Bacillus_phage(33.33%)	9	7045:7070	25817:25842
7045:7070	attL	TGTAAATGTGTAAATGTGTAAATATC	NA	NA	NA	NA
WP_075395863.1|15050_16316_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.7	6.4e-103
WP_075395797.1|16312_16654_+	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	40.3	1.9e-09
WP_075395864.1|16700_17075_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	51.3	9.0e-29
WP_075395798.1|17188_17434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075666865.1|17509_18094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075395799.1|18229_18466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075395865.1|18759_19833_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	44.2	5.1e-77
WP_000023351.1|20401_21013_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	32.1	7.8e-14
WP_075395800.1|21030_22011_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	34.3	1.1e-38
25817:25842	attR	GATATTTACACATTTACACATTTACA	NA	NA	NA	NA
