The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019041	Acinetobacter junii strain 65 chromosome, complete genome	3378307	1546840	1619865	3378307	terminase,capsid,transposase,protease,head,integrase,tail,tRNA,portal	Moraxella_phage(32.35%)	85	1581981:1582026	1618613:1618658
WP_075696315.1|1546840_1547524_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_004913171.1|1547829_1548315_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075696316.1|1548495_1548936_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_075696317.1|1549032_1549737_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_039909161.1|1549733_1551317_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	55.4	4.5e-146
WP_005404027.1|1551391_1551727_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005404026.1|1551723_1552107_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_004953312.1|1552277_1553666_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.8	1.8e-98
WP_004913152.1|1553769_1554501_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_039048199.1|1554519_1555653_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005402909.1|1555657_1556146_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_039048198.1|1556237_1556933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005402907.1|1556977_1557514_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_004913142.1|1557609_1558758_-	D-alanyl-D-alanine carboxypeptidase PBP5/6	NA	B6DZZ7	Stx2-converting_phage	38.0	8.2e-65
WP_004959481.1|1558872_1559274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005402906.1|1559421_1559796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042891917.1|1559899_1560670_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	44.4	2.8e-53
WP_004913130.1|1560778_1561591_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	50.0	3.3e-12
WP_004953334.1|1561728_1562658_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005402832.1|1562700_1565331_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_075696318.1|1565645_1567823_+	MFS transporter	NA	NA	NA	NA	NA
WP_004913115.1|1567825_1568227_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_075696319.1|1568365_1569334_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_004662919.1|1569531_1569756_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_075696320.1|1569844_1571953_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_075696321.1|1571934_1573683_-	GTPase	NA	NA	NA	NA	NA
WP_004959451.1|1573694_1574711_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_075696322.1|1574798_1575368_+	elongation factor P	NA	NA	NA	NA	NA
WP_075696323.1|1577650_1577953_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_039048194.1|1578031_1578991_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_004913086.1|1579004_1579922_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_039908395.1|1579924_1581913_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
1581981:1582026	attL	TTGACATCGTAGAGGTCTCCAGTTCGAGTCTGGATATACCTACCAA	NA	NA	NA	NA
WP_075696324.1|1582170_1583190_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	46.0	1.8e-79
WP_075696325.1|1583221_1583461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075696326.1|1583476_1583758_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_075696327.1|1583750_1583999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075696328.1|1584009_1584954_-	3'-5' exoribonuclease	NA	A0A2I6TCA6	Escherichia_phage	32.5	1.9e-14
WP_075696329.1|1584950_1585676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075696330.1|1585750_1586071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075696331.1|1586073_1586262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075696332.1|1586264_1586570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075696333.1|1586670_1587312_-	LexA family transcriptional regulator	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	45.1	4.3e-23
WP_075696334.1|1587410_1587620_+	ribonuclease D	NA	NA	NA	NA	NA
WP_075696335.1|1587649_1588153_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_075696336.1|1588149_1588434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075696337.1|1588436_1589339_+	toprim domain-containing protein	NA	A0A0R6PHP8	Moraxella_phage	37.7	1.7e-52
WP_075696338.1|1589335_1591171_+	hypothetical protein	NA	A0A0R6PHT6	Moraxella_phage	28.2	2.1e-46
WP_075696340.1|1591541_1592021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075696341.1|1592442_1592793_+	HNH endonuclease	NA	A0A218MNA6	uncultured_virus	42.0	6.7e-10
WP_075696342.1|1592794_1593019_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
WP_075696343.1|1593005_1593314_+	HNH endonuclease	NA	A0A0R6PHK1	Moraxella_phage	52.2	3.7e-20
WP_075696344.1|1593310_1593844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075696345.1|1594057_1594519_+	hypothetical protein	NA	S4TNN3	Salmonella_phage	39.7	5.9e-14
WP_075696346.1|1594520_1596209_+|terminase	terminase large subunit	terminase	A0A2H4J6B3	uncultured_Caudovirales_phage	58.5	3.1e-193
WP_075696347.1|1596269_1596893_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PCV7	Moraxella_phage	43.9	1.6e-38
WP_075696348.1|1596889_1598212_+|capsid	phage major capsid protein	capsid	A0A0R6PCM7	Moraxella_phage	52.2	5.5e-121
WP_075696349.1|1598266_1598572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075696350.1|1598572_1599838_+|portal	phage portal protein	portal	A0A2H4JB65	uncultured_Caudovirales_phage	56.0	8.9e-129
WP_075696351.1|1599818_1600109_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JAM4	uncultured_Caudovirales_phage	43.0	1.7e-11
WP_167543102.1|1600110_1600254_+	hypothetical protein	NA	A0A2H4JE05	uncultured_Caudovirales_phage	41.3	3.1e-06
WP_151707993.1|1600278_1600497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075696352.1|1600499_1600856_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	50.5	3.6e-19
WP_075696353.1|1600855_1601314_+	HK97 gp10 family phage protein	NA	A0A2H4J6A2	uncultured_Caudovirales_phage	50.3	1.1e-33
WP_075696354.1|1601310_1601676_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_075696355.1|1601737_1602214_+	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	33.1	2.7e-14
WP_075696356.1|1602210_1602741_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_075696358.1|1603050_1603605_+	hypothetical protein	NA	A0A0D4DBW7	Acinetobacter_phage	60.0	1.2e-56
WP_075696359.1|1603613_1603793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081378474.1|1604194_1604971_+	phage antirepressor N-terminal domain-containing protein	NA	A0A0M3LR56	Mannheimia_phage	43.5	2.1e-27
WP_075696361.1|1605055_1605430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075696362.1|1605496_1608778_+	hypothetical protein	NA	A0A2H4J326	uncultured_Caudovirales_phage	25.4	3.8e-22
WP_075696363.1|1608784_1609126_+|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	44.0	5.7e-14
WP_075696364.1|1609179_1610031_+	hypothetical protein	NA	E5KJQ6	Acinetobacter_phage	66.4	7.2e-50
WP_075696365.1|1610017_1610815_+|tail	phage minor tail protein L	tail	A0A0R6PIJ5	Moraxella_phage	59.7	3.8e-85
WP_075696366.1|1610814_1611564_+	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	54.1	8.8e-76
WP_075696367.1|1611547_1612123_+|tail	tail assembly protein	tail	A0A0R6PH75	Moraxella_phage	56.2	6.8e-52
WP_075696368.1|1612177_1616029_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	64.0	0.0e+00
WP_075696369.1|1616025_1616574_+	DUF4376 domain-containing protein	NA	A0A172Q0F8	Acinetobacter_phage	39.7	1.0e-28
WP_075696370.1|1616617_1616884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075696371.1|1616867_1617377_+	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	56.0	2.3e-43
WP_075696372.1|1617377_1617680_+	anaerobic dehydrogenase	NA	G8GDD9	Salmonella_phage	43.3	5.7e-18
WP_075696373.1|1617679_1618042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075696375.1|1618260_1618485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171053769.1|1619145_1619433_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
1618613:1618658	attR	TTGACATCGTAGAGGTCTCCAGTTCGAGTCTGGATATACCTACCAA	NA	NA	NA	NA
WP_100222377.1|1619679_1619865_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP019041	Acinetobacter junii strain 65 chromosome, complete genome	3378307	1756989	1799913	3378307	tRNA,transposase	Bacillus_phage(40.0%)	39	NA	NA
WP_000016639.1|1756989_1757274_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	34.8	8.9e-05
WP_004961400.1|1758141_1758726_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	29.1	3.6e-08
WP_005402463.1|1759149_1760814_+	L-lactate permease	NA	NA	NA	NA	NA
WP_004961408.1|1760831_1761575_+	transcriptional regulator LldR	NA	NA	NA	NA	NA
WP_075696404.1|1761578_1762724_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_080632252.1|1763013_1764042_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_042893003.1|1764060_1765761_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_075696405.1|1766799_1767954_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004961419.1|1768055_1768340_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_075696406.1|1768360_1769359_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004961424.1|1769428_1770169_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004769411.1|1770304_1771204_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005105870.1|1771254_1772271_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004769408.1|1772260_1773256_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_050676159.1|1773753_1773999_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_004682263.1|1774020_1775133_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.1	1.2e-33
WP_075696407.1|1775361_1776192_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_075696408.1|1776432_1776735_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_039046974.1|1777341_1778499_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_039046973.1|1778584_1779268_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004961451.1|1779271_1779571_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_039046972.1|1779792_1780401_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004961461.1|1781580_1782219_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_080632252.1|1782321_1783350_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000016639.1|1784359_1784644_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	34.8	8.9e-05
WP_039046970.1|1784861_1785887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042893690.1|1785939_1786233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075696410.1|1786503_1787538_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_075696411.1|1787534_1790087_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_075696412.1|1790149_1790833_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_075696413.1|1790964_1791498_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004915346.1|1792448_1792661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171065699.1|1792709_1793711_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_171261431.1|1793778_1794858_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_075696415.1|1794926_1796429_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_039046964.1|1796432_1796978_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_004961495.1|1797508_1797727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004915353.1|1798102_1798321_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	66.7	2.1e-17
WP_075696416.1|1798758_1799913_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP019041	Acinetobacter junii strain 65 chromosome, complete genome	3378307	2249488	2318004	3378307	tRNA,transposase,integrase	Pseudomonas_phage(15.38%)	51	2283821:2283844	2325408:2325431
WP_136700189.1|2249488_2250627_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.0	7.9e-84
WP_075696581.1|2251221_2251794_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_075696897.1|2251849_2252533_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	2.4e-51
WP_004953914.1|2252689_2253460_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004962441.1|2253602_2254664_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_075696582.1|2254676_2255309_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_075696583.1|2255305_2256124_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004953903.1|2256123_2257212_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	50.0	6.7e-08
WP_004915237.1|2257459_2257918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004953900.1|2258130_2258559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004962450.1|2258700_2260068_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	64.8	5.1e-130
WP_004962453.1|2260071_2260320_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	48.9	2.1e-18
WP_004915215.1|2260367_2261621_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.5	6.8e-97
WP_075696584.1|2261815_2262604_+	DUF695 domain-containing protein	NA	NA	NA	NA	NA
WP_039048315.1|2262662_2263895_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004912080.1|2263933_2264680_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	5.1e-15
WP_075696585.1|2265003_2265693_+	DUF3820 family protein	NA	A0A059VJT9	Pseudomonas_phage	39.8	6.3e-36
WP_075696586.1|2265837_2266401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004962472.1|2268408_2269965_-	AAA family ATPase	NA	U5XGM6	Phormidium_phage	34.5	1.3e-57
WP_004962475.1|2270007_2270622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004962476.1|2270618_2270852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004962478.1|2270885_2272604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004962480.1|2272646_2273129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039909161.1|2273522_2275106_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	55.4	4.5e-146
WP_005404027.1|2275180_2275516_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005404026.1|2275512_2275896_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_075696588.1|2275956_2276490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004962485.1|2276762_2276996_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_004962494.1|2279396_2280089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075696590.1|2280092_2281421_-	McrC family protein	NA	NA	NA	NA	NA
WP_004962497.1|2281420_2282941_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	35.8	1.6e-44
WP_004962500.1|2283761_2284223_-	hypothetical protein	NA	NA	NA	NA	NA
2283821:2283844	attL	TTTTTGATTTTTGCAAGAAGTCTA	NA	NA	NA	NA
WP_075696591.1|2284240_2287648_-	TM0106 family RecB-like putative nuclease	NA	F2Q6W6	Yellow_head_virus	28.4	2.7e-10
WP_075696592.1|2288438_2293823_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_075696593.1|2295732_2298930_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_075696594.1|2298931_2300770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075696595.1|2300773_2302051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155771246.1|2302635_2302767_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000618091.1|2302763_2303099_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_075696596.1|2303173_2304778_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	4.3e-144
WP_075696597.1|2305033_2306482_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_001261740.1|2307233_2308025_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_075696599.1|2308115_2308577_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_075696600.1|2308702_2308948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075696601.1|2309091_2309700_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075696602.1|2309920_2310598_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075696603.1|2311062_2311704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075696604.1|2311693_2313883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075696605.1|2313875_2316935_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_075696606.1|2316992_2317448_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_121533679.1|2317437_2318004_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
2325408:2325431	attR	TTTTTGATTTTTGCAAGAAGTCTA	NA	NA	NA	NA
