The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009246	Corynebacterium flavescens strain OJ8, complete genome	2758653	37327	92273	2758653	protease,transposase	Enterobacteria_phage(22.22%)	47	NA	NA
WP_075728797.1|37327_37972_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_084559239.1|38514_39129_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_084559240.1|39095_40523_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_075728799.1|40696_40969_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_075728800.1|41077_43021_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2R3ZRI5	Marseillevirus	32.6	2.2e-17
WP_084559086.1|43026_44541_-	serine/threonine protein kinase	NA	Q86363	Rous_sarcoma_virus	28.8	2.5e-13
WP_075728801.1|44540_45971_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_075728802.1|45967_47320_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_075728803.1|47316_48777_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_075728804.1|48773_49232_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_075728805.1|49267_50107_-	DUF3662 and FHA domain-containing protein	NA	NA	NA	NA	NA
WP_075730915.1|50508_51699_-|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_141256069.1|52033_52720_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_075728806.1|52723_53878_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_075728807.1|53887_54085_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_075728808.1|54087_54870_+	thiazole synthase	NA	NA	NA	NA	NA
WP_075728809.1|54870_55998_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_075728810.1|55984_57010_-	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_075728811.1|57366_58344_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_084559087.1|58647_59571_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075728812.1|59691_60351_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_075730921.1|60331_61048_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_141256071.1|61044_61809_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.0	2.3e-31
WP_075728814.1|61920_62502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084559241.1|62547_63174_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_075728815.1|63075_64074_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_075728816.1|64082_65057_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075728817.1|65053_65692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075728818.1|65757_67497_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	24.4	8.2e-16
WP_141256073.1|67852_68173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075728819.1|68299_68968_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	59.9	4.8e-73
WP_075730924.1|69876_70140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075730926.1|71165_71702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141256096.1|71881_72427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084559088.1|72710_72911_-	Hin recombinase	NA	NA	NA	NA	NA
WP_075728821.1|73710_74340_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_075728822.1|74524_76069_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_084559089.1|76258_78367_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_075728823.1|78387_80406_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_075728824.1|81632_83309_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.0	2.3e-31
WP_075728825.1|83305_84640_+	MFS transporter	NA	NA	NA	NA	NA
WP_075728826.1|84929_87998_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	41.3	5.7e-206
WP_084559242.1|88036_89161_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_157105725.1|89740_89935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141256064.1|90265_90502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075728828.1|91038_91356_+|transposase	transposase	transposase	A0A2P1JR43	Mycobacterium_phage	43.5	7.1e-11
WP_075728829.1|91352_92273_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	44.7	1.1e-59
>prophage 2
NZ_CP009246	Corynebacterium flavescens strain OJ8, complete genome	2758653	1217128	1268074	2758653	tRNA,transposase	Shigella_phage(18.18%)	38	NA	NA
WP_075729397.1|1217128_1218049_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	49.1	1.4e-59
WP_075728828.1|1218045_1218363_-|transposase	transposase	transposase	A0A2P1JR43	Mycobacterium_phage	43.5	7.1e-11
WP_075730915.1|1218727_1219918_+|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_075729726.1|1220311_1222945_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	34.2	4.4e-45
WP_075729727.1|1222956_1223409_-	RDD family protein	NA	NA	NA	NA	NA
WP_075729728.1|1223453_1224200_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075729729.1|1224463_1225924_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_075729730.1|1226107_1226710_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_075729731.1|1226780_1228874_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_075729732.1|1229031_1229484_+	universal stress protein	NA	NA	NA	NA	NA
WP_075729733.1|1229566_1230007_+	universal stress protein	NA	NA	NA	NA	NA
WP_075729734.1|1230028_1231090_-	DUF2183 domain-containing protein	NA	NA	NA	NA	NA
WP_075729735.1|1231104_1233378_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_075729736.1|1233545_1234460_-	DoxX family protein	NA	NA	NA	NA	NA
WP_075729737.1|1234554_1235157_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	28.2	2.7e-11
WP_075729738.1|1235219_1238057_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.1	1.3e-284
WP_150387360.1|1238064_1239045_+	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_075729740.1|1239315_1239837_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.2	6.9e-11
WP_075729741.1|1239875_1240070_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075729742.1|1240129_1240513_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_075729478.1|1240767_1241958_+|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_157105729.1|1242178_1243368_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.7	7.3e-32
WP_075731095.1|1243565_1244573_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_141256075.1|1244871_1245498_+	NINE protein	NA	NA	NA	NA	NA
WP_075729744.1|1245542_1246343_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_075729745.1|1246421_1247468_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	1.4e-26
WP_075729746.1|1247501_1250009_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_075729747.1|1250160_1251204_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_075729748.1|1251278_1252442_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_075729749.1|1252484_1253420_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_075729750.1|1253416_1254586_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.4	3.1e-11
WP_075729751.1|1254582_1255503_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_075729752.1|1255506_1255989_+	arginine repressor	NA	NA	NA	NA	NA
WP_075729753.1|1256069_1257290_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_075729754.1|1257290_1258730_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_084559146.1|1258869_1259058_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_075729755.1|1259141_1260401_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	38.7	4.2e-70
WP_157105729.1|1266884_1268074_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.7	7.3e-32
>prophage 3
NZ_CP009246	Corynebacterium flavescens strain OJ8, complete genome	2758653	1967045	2022147	2758653	tRNA,transposase,protease	Paenibacillus_phage(14.29%)	45	NA	NA
WP_075730252.1|1967045_1968389_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	27.3	1.3e-32
WP_075730253.1|1968212_1969709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075730254.1|1971800_1973648_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	37.6	8.4e-19
WP_075730255.1|1973666_1974212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075730256.1|1974456_1974720_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_075731262.1|1975030_1976041_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_157105729.1|1976413_1977602_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.7	7.3e-32
WP_157105731.1|1977603_1977741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084559269.1|1977982_1978801_+	DNA adenine methylase	NA	A0A2I4R668	Erysipelothrix_phage	44.5	1.8e-50
WP_075730258.1|1978793_1980152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075730259.1|1980148_1980793_-	LysE family translocator	NA	NA	NA	NA	NA
WP_075730260.1|1980789_1981176_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_075730261.1|1981186_1982161_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_075730262.1|1982162_1983833_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_075730263.1|1983829_1984576_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075730264.1|1984668_1985544_-	DegV family protein	NA	NA	NA	NA	NA
WP_075730265.1|1985543_1986242_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_075730266.1|1986248_1986719_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_075730267.1|1986804_1987422_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_084559270.1|1987437_1988265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075730269.1|1988446_1989718_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.7	1.0e-84
WP_075730270.1|1989887_1992524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075730271.1|1992520_1995994_+	AAA family ATPase	NA	E3T5J8	Cafeteria_roenbergensis_virus	22.9	8.1e-07
WP_075731264.1|1996029_1996578_-	DUF1707 domain-containing protein	NA	NA	NA	NA	NA
WP_075730272.1|1996596_1997514_-	hypothetical protein	NA	A7ITA6	Paramecium_bursaria_Chlorella_virus	32.7	2.1e-10
WP_075730273.1|1997516_1998446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075730274.1|1998442_1999675_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.7	8.6e-52
WP_075730275.1|1999772_2001305_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_075730276.1|2001488_2001767_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_075730277.1|2001807_2002113_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_141256028.1|2002330_2006044_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_141256026.1|2006512_2007301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157105732.1|2007500_2008673_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_075730252.1|2008496_2009840_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	27.3	1.3e-32
WP_075730280.1|2010148_2010559_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	46.2	1.4e-27
WP_075730281.1|2010632_2010944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075730282.1|2010990_2011431_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_075730283.1|2011427_2012990_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_084559187.1|2012989_2015797_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	39.5	8.0e-138
WP_075730285.1|2015857_2016820_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_075730286.1|2017125_2017881_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075730287.1|2017877_2019170_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.2	5.5e-134
WP_075730288.1|2019471_2020785_+	MFS transporter	NA	NA	NA	NA	NA
WP_075730289.1|2020901_2021525_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	39.8	2.7e-30
WP_075730290.1|2021547_2022147_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.6	1.0e-42
>prophage 4
NZ_CP009246	Corynebacterium flavescens strain OJ8, complete genome	2758653	2052321	2059921	2758653	terminase	Rhodococcus_phage(33.33%)	11	NA	NA
WP_084559189.1|2052321_2053635_-|terminase	terminase	terminase	A0A1V0E630	Streptomyces_phage	42.0	4.5e-83
WP_075730314.1|2053555_2053963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075730315.1|2053964_2054441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075730316.1|2054437_2054758_-	hypothetical protein	NA	G9FH59	Rhodococcus_phage	39.2	9.7e-08
WP_075730317.1|2054775_2054973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075730318.1|2054999_2055671_-	transcriptional regulator	NA	A0A2P1JXP2	Rhodococcus_phage	41.1	1.2e-28
WP_075730319.1|2055683_2057204_-	hypothetical protein	NA	A0A0F6WE93	Mycobacterium_phage	36.9	9.5e-77
WP_075730320.1|2057235_2058051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075730321.1|2058047_2058374_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_141255955.1|2058370_2059321_-	DNA (cytosine-5-)-methyltransferase	NA	A0A088F6E9	Mycobacterium_phage	41.1	1.6e-69
WP_075730323.1|2059381_2059921_-	hypothetical protein	NA	A0A0U4KJR0	Gordonia_phage	41.3	1.8e-25
>prophage 5
NZ_CP009246	Corynebacterium flavescens strain OJ8, complete genome	2758653	2074735	2133154	2758653	capsid,transposase,integrase	Corynebacterium_phage(18.18%)	54	2118719:2118770	2127644:2127695
WP_075730355.1|2074735_2076025_-|integrase	site-specific integrase	integrase	G8IR34	Mycobacterium_virus	34.0	3.4e-51
WP_075730356.1|2076273_2077122_-	acyltransferase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	39.2	8.2e-46
WP_075730357.1|2077244_2078816_-	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_075730358.1|2079002_2080382_-	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_084559191.1|2080388_2081708_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_084559192.1|2081738_2083301_-	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_075730359.1|2083366_2084629_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_075730360.1|2084731_2086153_-	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_075730361.1|2086470_2087304_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	4.1e-58
WP_075730362.1|2087423_2087900_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_075730363.1|2088062_2088689_-	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
WP_075730364.1|2088842_2091350_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	31.6	9.3e-45
WP_075730365.1|2091378_2092137_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075731277.1|2092207_2092891_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_075730366.1|2092932_2094135_-	alkylhydroperoxidase domain protein	NA	NA	NA	NA	NA
WP_075730367.1|2094199_2095807_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	5.1e-20
WP_075730368.1|2095810_2096611_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_075730369.1|2096607_2097633_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_075730370.1|2097636_2099283_-	TIGR04028 family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_141255944.1|2099454_2101296_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_075730372.1|2101469_2101682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075730373.1|2102323_2103475_-	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	31.8	8.3e-25
WP_075730374.1|2103619_2104009_+	globin	NA	NA	NA	NA	NA
WP_075730375.1|2104014_2105106_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075730376.1|2105249_2105891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075730377.1|2105966_2106392_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_075730378.1|2106419_2108090_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	29.8	6.0e-48
WP_075730379.1|2108209_2108791_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_075731279.1|2109004_2111047_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_075730380.1|2111371_2112091_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075730381.1|2112097_2113402_-	MFS transporter	NA	NA	NA	NA	NA
WP_075730382.1|2113522_2113912_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_141255942.1|2114024_2114669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075730384.1|2114722_2115403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075731281.1|2115437_2115632_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_075730385.1|2115774_2116587_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_141255940.1|2116630_2117278_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.2	4.1e-29
WP_084559271.1|2117358_2118549_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
2118719:2118770	attL	GGTTGTGATCCTGGTTGTCGCGGGTTCGAGCCCCGTCAGCCACCCCAAAGAA	NA	NA	NA	NA
WP_075730388.1|2118795_2119920_-|integrase	site-specific integrase	integrase	A0A1W6JQG4	Corynebacterium_phage	32.2	3.0e-43
WP_141255938.1|2119906_2120509_-	helix-turn-helix transcriptional regulator	NA	A0A2H4PIT7	Corynebacterium_phage	69.2	1.5e-22
WP_075730390.1|2120507_2120714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075730391.1|2120800_2121301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075730392.1|2121315_2121846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157105735.1|2121842_2122013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075730393.1|2122147_2122690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075730394.1|2122686_2124228_+	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_157105736.1|2124314_2124485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075730397.1|2125096_2125393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075730398.1|2125385_2125880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075730399.1|2125898_2126765_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_075730915.1|2127896_2129087_-|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
2127644:2127695	attR	GGTTGTGATCCTGGTTGTCGCGGGTTCGAGCCCCGTCAGCCACCCCAAAGAA	NA	NA	NA	NA
WP_150387368.1|2129489_2130491_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_075730400.1|2130908_2132135_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_075728828.1|2132836_2133154_+|transposase	transposase	transposase	A0A2P1JR43	Mycobacterium_phage	43.5	7.1e-11
>prophage 6
NZ_CP009246	Corynebacterium flavescens strain OJ8, complete genome	2758653	2195133	2204206	2758653		Faustovirus(16.67%)	9	NA	NA
WP_075731294.1|2195133_2196294_-	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	29.2	2.3e-06
WP_075730441.1|2196336_2197326_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	78.1	2.0e-139
WP_075730442.1|2197661_2198369_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075730443.1|2198428_2200591_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.8	5.0e-204
WP_075730444.1|2200662_2201094_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	34.9	9.7e-11
WP_075730445.1|2201105_2201351_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	61.6	1.2e-18
WP_003847162.1|2201771_2201894_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_075730446.1|2202013_2203354_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_075730447.1|2203381_2204206_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.5	5.3e-66
