The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008925	Salmonella enterica subsp. enterica serovar Cerro strain 87 chromosome, complete genome	4602439	130397	180329	4602439	protease,terminase,tail,capsid,holin	Salmonella_phage(62.69%)	72	NA	NA
WP_023234528.1|130397_131693_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	69.9	1.7e-180
WP_001856431.1|131738_131984_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	66.7	9.4e-27
WP_023234529.1|132089_132413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000487123.1|132422_132665_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023205219.1|132627_133701_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	68.2	5.4e-143
WP_000200029.1|133700_133922_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	54.3	1.6e-14
WP_023216154.1|134212_134764_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	60.0	1.8e-57
WP_000870087.1|134760_134928_-	hypothetical protein	NA	G8C7S7	Escherichia_phage	74.1	1.9e-15
WP_001275767.1|134927_135212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042848110.1|135713_136172_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	90.3	1.4e-71
WP_075696912.1|136172_136880_-	recombinase	NA	I6R0N0	Salmonella_phage	98.3	1.6e-135
WP_000902091.1|136876_137020_-	hypothetical protein	NA	I6S1M5	Salmonella_phage	100.0	4.2e-19
WP_000156731.1|137009_137198_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_001670815.1|137178_137352_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	100.0	8.9e-24
WP_075696913.1|137546_138665_-	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	72.6	1.2e-68
WP_048485658.1|138748_138943_-	Restriction inhibitor protein ral	NA	E7C9Q6	Salmonella_phage	98.4	4.2e-30
WP_048485659.1|139021_139405_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	84.5	1.2e-36
WP_000834176.1|139761_139965_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	98.5	5.9e-27
WP_000759585.1|140109_141129_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	36.0	3.5e-51
WP_001104736.1|141335_141989_-	LexA family transcriptional regulator	NA	I6R0S2	Salmonella_phage	100.0	2.3e-128
WP_001059982.1|142098_142308_+	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	100.0	2.1e-35
WP_000424137.1|142438_142732_+	Regulatory protein CII from phage origin	NA	I6RSP4	Salmonella_phage	92.8	4.7e-41
WP_001244625.1|142754_143027_+	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	7.9e-43
WP_048485665.1|143089_143977_+	replication protein	NA	A5VW95	Enterobacteria_phage	93.5	1.2e-143
WP_048485663.1|143973_145350_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	99.3	6.3e-253
WP_075696914.1|145423_145864_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	97.3	2.5e-78
WP_000611490.1|145860_146733_+	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	99.3	2.3e-176
WP_000984218.1|146729_146903_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113772.1|146869_147046_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_000924603.1|147048_147450_+	hypothetical protein	NA	G9L690	Escherichia_phage	82.7	8.6e-62
WP_001108075.1|147612_148224_+	recombination protein NinG	NA	I6R0S7	Salmonella_phage	94.6	1.9e-97
WP_000188967.1|148220_148424_+	phage NinH family protein	NA	A0A1R3Y5V4	Salmonella_virus	98.5	2.7e-32
WP_000219136.1|148404_148584_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	94.9	2.7e-23
WP_001047565.1|148580_149354_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	99.6	5.3e-132
WP_000738703.1|149781_150108_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_016048832.1|151205_151892_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	100.0	1.6e-124
WP_000147264.1|152384_152816_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	100.0	7.6e-72
WP_000445802.1|152799_154119_+|terminase	terminase	terminase	H6WRS9	Salmonella_phage	100.0	1.9e-262
WP_020838511.1|154251_155604_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	99.6	1.3e-258
WP_020838512.1|155557_156517_+|capsid	minor capsid protein	capsid	H6WRT1	Salmonella_phage	99.7	4.6e-178
WP_023205066.1|156532_157795_+	hypothetical protein	NA	H6WRT2	Salmonella_phage	99.8	8.0e-239
WP_001650234.1|157807_158254_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	100.0	3.1e-76
WP_000273924.1|158271_159348_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	100.0	1.4e-207
WP_001151796.1|159357_159546_+	hypothetical protein	NA	Q5G8X9	Enterobacteria_phage	100.0	2.9e-28
WP_000633370.1|159597_159999_+	hypothetical protein	NA	Q5G8X8	Enterobacteria_phage	100.0	1.4e-72
WP_001650231.1|159998_160178_+	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	98.3	2.5e-29
WP_015976785.1|160170_160533_+	hypothetical protein	NA	Q5G8X6	Enterobacteria_phage	100.0	9.5e-68
WP_015976786.1|160540_160936_+	hypothetical protein	NA	Q5G8X5	Enterobacteria_phage	100.0	7.2e-69
WP_023234671.1|160932_161319_+	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	98.4	2.9e-67
WP_010835559.1|161334_162072_+	immunoglobulin domain-containing protein	NA	Q5G8X3	Enterobacteria_phage	98.8	2.7e-130
WP_023205069.1|162116_162770_+	hypothetical protein	NA	H6WRU2	Salmonella_phage	99.5	1.3e-120
WP_000065269.1|162991_163720_+	KilA-N domain-containing protein	NA	H6WRU3	Salmonella_phage	100.0	3.1e-142
WP_001260076.1|163741_164113_-	hypothetical protein	NA	H6WRU4	Salmonella_phage	99.2	1.9e-63
WP_023230837.1|164033_164291_+	hypothetical protein	NA	H6WRU5	Salmonella_phage	98.8	1.0e-39
WP_000049860.1|164311_164638_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	100.0	3.3e-51
WP_001154344.1|164748_164922_+	hypothetical protein	NA	H6WRU7	Salmonella_phage	100.0	5.8e-23
WP_001028069.1|164995_165634_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	100.0	2.1e-118
WP_001187765.1|165713_166502_+	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	100.0	5.2e-127
WP_117160639.1|166932_167283_+	hypothetical protein	NA	H6WRV1	Salmonella_phage	100.0	5.2e-63
WP_048485424.1|167275_167578_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	90.0	3.7e-41
WP_000184444.1|167667_168522_-	KilA-N domain-containing protein	NA	I6R977	Salmonella_phage	46.0	5.2e-56
WP_023234673.1|168830_169160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023234674.1|169156_169624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048485422.1|169683_172080_+|tail	phage tail protein	tail	F1C5E9	Cronobacter_phage	52.8	2.8e-163
WP_023234676.1|172080_172479_-	hypothetical protein	NA	Q5G8W7	Enterobacteria_phage	97.7	8.5e-70
WP_023234677.1|172571_172919_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	95.7	8.2e-61
WP_023234678.1|172954_173659_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	96.2	1.9e-133
WP_023234679.1|173658_174378_+	C40 family peptidase	NA	H6WRW2	Salmonella_phage	99.1	1.7e-132
WP_023234680.1|174320_174848_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	84.5	2.4e-67
WP_023234681.1|174857_178037_+|tail	phage tail protein	tail	H6WRW4	Salmonella_phage	93.2	0.0e+00
WP_023234682.1|178045_179005_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.7	2.8e-183
WP_023234683.1|179015_180329_+	hypothetical protein	NA	I6R0Q9	Salmonella_phage	60.8	1.1e-140
>prophage 2
NZ_CP008925	Salmonella enterica subsp. enterica serovar Cerro strain 87 chromosome, complete genome	4602439	910516	920464	4602439	tail,transposase,plate	Salmonella_phage(36.36%)	11	NA	NA
WP_060710283.1|910516_911011_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.4e-13
WP_023234313.1|911169_911331_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	2.9e-08
WP_023234314.1|911584_912256_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	2.8e-81
WP_031222499.1|913068_914184_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	31.9	3.2e-29
WP_023234317.1|914235_914667_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	51.8	5.1e-36
WP_077910631.1|914669_915452_-|tail	phage tail protein	tail	A0A0M3ULD8	Salmonella_phage	88.4	5.4e-68
WP_023234318.1|915451_916132_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	97.8	4.9e-126
WP_023234319.1|916128_917328_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	97.5	5.0e-214
WP_023234320.1|917328_917682_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	96.6	4.6e-59
WP_000502119.1|918558_919017_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000444509.1|919213_920464_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
>prophage 3
NZ_CP008925	Salmonella enterica subsp. enterica serovar Cerro strain 87 chromosome, complete genome	4602439	1203699	1212879	4602439	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|1203699_1205733_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|1205973_1206432_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023234558.1|1206603_1207134_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_001598435.1|1207190_1207658_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	91.0	3.0e-74
WP_000598637.1|1207704_1208424_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|1208420_1210106_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_023234557.1|1210328_1211069_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.1	5.1e-100
WP_001261696.1|1211128_1211236_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|1211216_1211948_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|1211931_1212879_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 4
NZ_CP008925	Salmonella enterica subsp. enterica serovar Cerro strain 87 chromosome, complete genome	4602439	1726155	1737418	4602439	tail,transposase	Salmonella_phage(42.86%)	9	NA	NA
WP_023233681.1|1726155_1728336_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.5	5.8e-19
WP_010989057.1|1728343_1729507_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980503.1|1730057_1730273_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.8	3.6e-22
WP_023233680.1|1730340_1731444_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	87.2	9.7e-180
WP_023233679.1|1731440_1731926_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	85.1	9.4e-71
WP_023233678.1|1731922_1733479_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.8	4.3e-165
WP_023233677.1|1733640_1734771_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	33.6	2.4e-40
WP_023233676.1|1734727_1735711_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023207031.1|1736257_1737418_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	2.7e-39
>prophage 5
NZ_CP008925	Salmonella enterica subsp. enterica serovar Cerro strain 87 chromosome, complete genome	4602439	4153141	4211858	4602439	protease,portal,tRNA,lysis,integrase,holin,coat	Salmonella_phage(60.34%)	76	4170656:4170702	4212148:4212194
WP_023234230.1|4153141_4154227_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000815601.1|4154322_4155390_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000098736.1|4155386_4155896_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_023234229.1|4156013_4156736_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255991.1|4156738_4157233_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912377.1|4157405_4158791_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
WP_001143570.1|4158881_4159430_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190278.1|4159556_4159769_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729165.1|4159770_4160637_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
WP_000681035.1|4161183_4161741_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000619618.1|4161815_4162349_+	type 1 fimbrial protein subunit FimI	NA	NA	NA	NA	NA
WP_001675699.1|4162392_4163085_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_023234228.1|4163115_4165728_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_023234227.1|4165742_4166750_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000603407.1|4166759_4167278_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000801272.1|4167323_4167956_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_023234225.1|4168559_4169282_-	fimbria biosynthesis regulator FimY	NA	NA	NA	NA	NA
WP_000948629.1|4169772_4170369_-	fimbria biosynthesis transcriptional regulator FimW	NA	NA	NA	NA	NA
4170656:4170702	attL	CTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_023234224.1|4170715_4171879_-|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	97.7	5.2e-224
WP_109161052.1|4172648_4173056_-	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	92.1	8.8e-38
WP_023893317.1|4173112_4173472_-	Eaf protein	NA	T1SA95	Salmonella_phage	90.8	8.0e-59
WP_023234218.1|4173580_4174198_-	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	65.9	8.0e-67
WP_023234217.1|4174194_4174365_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	96.4	1.1e-23
WP_023234216.1|4174375_4174669_-	DUF2856 family protein	NA	A0A0N7CAQ6	Salmonella_phage	97.9	9.4e-50
WP_023893316.1|4174684_4175233_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	98.9	3.0e-105
WP_048485107.1|4175241_4175748_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	99.4	2.3e-91
WP_052892833.1|4175748_4176456_-	recombinase	NA	I6R0N0	Salmonella_phage	98.3	2.7e-135
WP_000017617.1|4176452_4176596_-	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	95.7	4.6e-18
WP_000156731.1|4176585_4176774_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_001200013.1|4176754_4176907_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R0R7	Salmonella_phage	100.0	2.4e-25
WP_000713611.1|4177230_4177518_-	hypothetical protein	NA	Q76H36	Enterobacteria_phage	98.9	7.8e-49
WP_001083253.1|4177551_4178052_-	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.5	5.2e-32
WP_000216186.1|4178133_4178436_-	hypothetical protein	NA	I6S5Z3	Salmonella_phage	94.0	4.5e-47
WP_000786966.1|4178795_4179005_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	100.0	2.0e-30
WP_000841071.1|4179346_4179865_-	hypothetical protein	NA	I6R9C4	Salmonella_phage	100.0	1.9e-85
WP_000712403.1|4180066_4180756_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000182204.1|4180866_4181082_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103493.1|4181192_4181474_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	98.9	1.3e-43
WP_001125981.1|4181508_4181655_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000065658.1|4181647_4182547_+	hypothetical protein	NA	E7C9R4	Salmonella_phage	98.7	3.0e-155
WP_000131496.1|4182536_4183973_+	AAA family ATPase	NA	E7C9R5	Salmonella_phage	98.5	4.1e-271
WP_000736917.1|4184049_4184490_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	97.9	5.0e-79
WP_000611490.1|4184486_4185359_+	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	99.3	2.3e-176
WP_000984218.1|4185355_4185529_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113772.1|4185495_4185672_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_000924603.1|4185674_4186076_+	hypothetical protein	NA	G9L690	Escherichia_phage	82.7	8.6e-62
WP_001108075.1|4186238_4186850_+	recombination protein NinG	NA	I6R0S7	Salmonella_phage	94.6	1.9e-97
WP_000188967.1|4186846_4187050_+	phage NinH family protein	NA	A0A1R3Y5V4	Salmonella_virus	98.5	2.7e-32
WP_001047565.1|4187207_4187981_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	99.6	5.3e-132
WP_000738703.1|4188407_4188734_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001167376.1|4188717_4189155_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	91.0	3.6e-69
WP_000088937.1|4189151_4189619_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	88.4	6.1e-67
WP_016048832.1|4189831_4190518_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	100.0	1.6e-124
WP_000807793.1|4190911_4191154_+	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	100.0	1.7e-36
WP_023217189.1|4191156_4191561_+	hypothetical protein	NA	C6ZR73	Salmonella_phage	98.5	9.0e-67
WP_001629224.1|4191573_4192032_+	hypothetical protein	NA	A0A2P1MXF5	Escherichia_phage	66.2	3.3e-49
WP_023217188.1|4192031_4193492_+	hypothetical protein	NA	W6MW26	Pseudomonas_phage	76.5	3.3e-220
WP_031601950.1|4193491_4195669_+|portal	portal protein	portal	A0A1R3Y5N6	Salmonella_virus	99.9	0.0e+00
WP_023217186.1|4195682_4196594_+	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	8.3e-161
WP_023217185.1|4196593_4197886_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.5	1.9e-243
WP_023217184.1|4197926_4198487_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.9	1.8e-102
WP_001166101.1|4198470_4198971_+	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
WP_023233541.1|4198930_4200349_+	packaged DNA stabilization protein gp10	NA	I1TEJ1	Salmonella_phage	98.3	7.3e-273
WP_023233542.1|4200352_4201054_+	hypothetical protein	NA	A0A0M4QWW6	Salmonella_phage	95.7	1.7e-73
WP_000627700.1|4201053_4201509_+	DUF2824 family protein	NA	A0A1R3Y5P3	Salmonella_virus	100.0	1.8e-87
WP_023233543.1|4201511_4202204_+	hypothetical protein	NA	A0A0M4RTU3	Salmonella_phage	95.7	1.1e-104
WP_023233544.1|4202214_4203597_+	DNA transfer protein	NA	A0A192Y834	Salmonella_phage	92.9	1.6e-224
WP_023233545.1|4203596_4205546_+	hypothetical protein	NA	A0A192Y934	Salmonella_phage	89.0	3.7e-283
WP_000889769.1|4205563_4205893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757527.1|4205923_4206289_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_001085430.1|4206302_4206482_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000532175.1|4206581_4206833_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
WP_023233546.1|4206968_4208759_+	right-handed parallel beta-helix repeat-containing protein	NA	S4TWS4	Salmonella_phage	78.5	1.7e-229
WP_023233547.1|4208794_4210585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023233548.1|4210581_4211499_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	93.1	7.5e-162
WP_023233549.1|4211495_4211858_-	GtrA family protein	NA	I1TED9	Salmonella_phage	91.7	9.2e-55
4212148:4212194	attR	CTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 6
NZ_CP008925	Salmonella enterica subsp. enterica serovar Cerro strain 87 chromosome, complete genome	4602439	4548786	4556099	4602439	integrase,protease	Dickeya_phage(16.67%)	7	4550364:4550378	4561604:4561618
WP_023227176.1|4548786_4549905_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125881.1|4549901_4551848_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.0	1.6e-39
4550364:4550378	attL	ATTGCCCGCGCGCTG	NA	NA	NA	NA
WP_000447499.1|4551977_4552199_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|4552522_4552843_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|4552873_4555150_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|4555362_4555560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048484675.1|4555778_4556099_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	44.7	1.0e-17
4561604:4561618	attR	CAGCGCGCGGGCAAT	NA	NA	NA	NA
