The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017631	Escherichia coli strain SLK172 chromosome, complete genome	5283836	818774	886639	5283836	transposase,integrase,tRNA,protease	Staphylococcus_phage(40.0%)	59	836783:836800	884795:884812
WP_170386723.1|818774_819746_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_000038139.1|819890_820331_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001126822.1|822320_822887_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_039023561.1|823133_823706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039023560.1|823774_824023_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684812.1|824273_824912_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_032297239.1|825184_826339_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_000345753.1|826368_827169_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001696527.1|827223_827547_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_105076398.1|827791_829020_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	7.7e-170
WP_001696174.1|830104_830893_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001696173.1|831010_831484_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_001696172.1|831502_832273_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001767853.1|832262_833129_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_001696170.1|833138_833576_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001696169.1|833656_834691_+	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_077250607.1|834724_836182_+	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_001767848.1|836226_837231_+	hypothetical protein	NA	NA	NA	NA	NA
836783:836800	attL	CCAATGCCTTTGGTTTTT	NA	NA	NA	NA
WP_001696167.1|837291_839649_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_001696166.1|839658_842346_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_001767846.1|842381_842525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162842841.1|842937_844151_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	95.9	2.0e-162
WP_029400569.1|846847_848827_+	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_126870310.1|848876_849071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001313264.1|849118_849298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000755103.1|850153_850894_+	porin family protein	NA	NA	NA	NA	NA
WP_001313263.1|851075_852575_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_021572001.1|852683_856199_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001218753.1|856650_857913_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	1.1e-78
WP_000234514.1|858291_858999_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839760.1|859396_861532_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001299430.1|861581_862838_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000760323.1|863039_864119_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|864183_864459_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001321419.1|864486_865539_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|865699_866419_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|866418_866745_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|866928_867648_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394131.1|867823_868870_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745217.1|868986_869994_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239928.1|870148_871285_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174735.1|871277_871871_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|871878_872169_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|872165_872732_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001424369.1|872749_873454_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001295381.1|873471_874452_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017111.1|874635_875052_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|875051_875615_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|875723_876674_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001300912.1|876686_877418_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|877497_878205_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001300769.1|878299_878797_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001112301.1|878873_880268_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_075362537.1|880691_881846_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	3.1e-128
WP_001303650.1|882149_882365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297406.1|882500_882632_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001300904.1|882640_884617_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000105566.1|884754_885675_+	agmatinase	NA	NA	NA	NA	NA
884795:884812	attR	CCAATGCCTTTGGTTTTT	NA	NA	NA	NA
WP_001326497.1|885880_886639_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
>prophage 2
NZ_CP017631	Escherichia coli strain SLK172 chromosome, complete genome	5283836	1107987	1121170	5283836		Escherichia_phage(40.0%)	12	NA	NA
WP_001295182.1|1107987_1108749_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1108742_1109369_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1109508_1110648_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1110710_1111703_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104429.1|1111796_1113161_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1113249_1114026_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1114030_1114669_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590404.1|1114665_1115928_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	6.3e-135
WP_000847985.1|1115924_1116833_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|1117028_1117796_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141339.1|1117846_1118503_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
WP_032202565.1|1118608_1121170_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.9e-30
>prophage 3
NZ_CP017631	Escherichia coli strain SLK172 chromosome, complete genome	5283836	1772536	1781978	5283836		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|1772536_1773463_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1773467_1774199_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1774179_1774287_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1774346_1775078_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1775299_1776985_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1776981_1777701_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1777747_1778218_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001373589.1|1778258_1778720_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001423058.1|1778844_1780845_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001333512.1|1780841_1781978_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
NZ_CP017631	Escherichia coli strain SLK172 chromosome, complete genome	5283836	1820477	1882999	5283836	terminase,tail,protease,holin,lysis,capsid,transposase,integrase,tRNA,head,portal	Enterobacteria_phage(35.71%)	76	1812811:1812827	1839086:1839102
1812811:1812827	attL	ACTGACCTCAGCGATGC	NA	NA	NA	NA
WP_000476014.1|1820477_1821839_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000929408.1|1821985_1822318_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|1822508_1823231_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|1823227_1824631_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000130837.1|1824627_1826043_-	MFS transporter	NA	NA	NA	NA	NA
WP_000667585.1|1826043_1829121_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001197875.1|1829121_1832244_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000678988.1|1832243_1833491_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_000533667.1|1833834_1834908_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.9	9.3e-196
WP_001303849.1|1834885_1835104_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281192.1|1835209_1835554_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_000457736.1|1835672_1835915_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_053904227.1|1835989_1836652_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	46.5	7.8e-52
WP_000255944.1|1837407_1838430_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|1838429_1839209_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
1839086:1839102	attR	ACTGACCTCAGCGATGC	NA	NA	NA	NA
WP_001360251.1|1839675_1839897_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	6.0e-33
WP_001444000.1|1839995_1840277_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1840287_1840479_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_075362553.1|1840451_1840634_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	6.3e-28
WP_000186837.1|1840630_1841311_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	4.6e-132
WP_000100845.1|1841307_1842093_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995467.1|1842098_1842395_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000372937.1|1842469_1842613_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1842581_1842746_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|1842818_1843187_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_053901473.1|1843382_1843832_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	83.2	9.3e-65
WP_000088203.1|1843890_1844163_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000193240.1|1844769_1845132_-	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
WP_000428099.1|1845400_1846105_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
WP_000064149.1|1846218_1846452_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	98.7	2.3e-35
WP_000438528.1|1846590_1846887_+	hypothetical protein	NA	Q08J40	Stx2-converting_phage	100.0	5.2e-48
WP_000788878.1|1847787_1848489_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000145926.1|1848485_1848776_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000229807.1|1848848_1849055_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000810176.1|1849062_1849509_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000153270.1|1849505_1850033_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_069723213.1|1850029_1850212_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	96.7	1.1e-27
WP_000566998.1|1850208_1850379_+	protein ninF	NA	A0A2I6PIG4	Escherichia_phage	100.0	7.2e-26
WP_001279421.1|1850371_1850641_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000002247.1|1850640_1850931_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	96.9	7.1e-50
WP_001008177.1|1850927_1851290_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	99.2	2.7e-62
WP_000994505.1|1851286_1851475_+	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	1.2e-26
WP_001235460.1|1851471_1852095_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_000499454.1|1853177_1853336_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|1853416_1853815_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284515.1|1853957_1854173_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1854172_1854670_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1854666_1855104_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000881326.1|1855253_1855871_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_039517139.1|1856364_1856910_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	3.1e-94
WP_016245259.1|1856884_1858810_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198153.1|1858806_1859013_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_032300354.1|1859009_1860581_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.2e-304
WP_029397854.1|1860591_1861911_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	3.4e-232
WP_001365129.1|1861920_1862253_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|1862308_1863334_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1863375_1863771_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1863782_1864136_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975096.1|1864147_1864726_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683137.1|1864722_1865118_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235098.1|1865125_1865878_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479086.1|1865891_1866323_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|1866349_1866763_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_075362555.1|1866743_1869305_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.5	0.0e+00
WP_000847379.1|1869301_1869631_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|1869630_1870329_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194778.1|1870334_1871078_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_000090884.1|1871014_1871647_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_075362556.1|1871707_1875100_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_075362557.1|1875169_1875769_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.5	2.2e-109
WP_075362722.1|1875833_1877147_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.9	1.7e-82
WP_024262315.1|1877148_1877418_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.4e-44
WP_023181050.1|1877890_1879426_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_001282653.1|1879442_1880198_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_075362558.1|1880315_1880921_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.0	2.1e-35
WP_069723320.1|1881604_1882999_-	type III secretion system effector NleA	NA	Q6H9S2	Enterobacteria_phage	91.4	6.0e-219
>prophage 5
NZ_CP017631	Escherichia coli strain SLK172 chromosome, complete genome	5283836	1996740	2103549	5283836	terminase,tail,holin,capsid,transposase,integrase,tRNA,head,portal	Enterobacteria_phage(39.34%)	100	2087496:2087521	2097987:2098012
WP_000019441.1|1996740_1997721_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_000784549.1|1997835_1999857_-	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_033556399.1|1999987_2001565_-	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_000194282.1|2001568_2002372_-	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_000982873.1|2002368_2003469_-	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_075362566.1|2003465_2012957_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_069723316.1|2013044_2019152_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000140399.1|2019342_2020302_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_069723317.1|2020558_2022271_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.3	5.6e-33
WP_023286676.1|2022257_2024060_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	27.8	5.5e-23
WP_001286279.1|2024052_2025333_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703034.1|2025360_2026665_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_000059620.1|2026858_2028121_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	1.1e-73
WP_001392298.1|2028458_2029256_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533621.1|2029491_2030517_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_000096345.1|2030516_2030720_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048392.1|2030778_2033250_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.7	2.9e-59
WP_001090200.1|2033342_2033534_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2033530_2033719_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001299931.1|2034119_2034284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2034287_2034506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2034665_2034821_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448563.1|2034987_2035395_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2035478_2035709_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705353.1|2035692_2036214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151251.1|2037199_2037622_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	1.4e-62
WP_001373963.1|2039087_2039741_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000892866.1|2039753_2040449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2041134_2041347_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001004956.1|2041512_2042163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|2042143_2043247_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000687436.1|2043404_2043665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024173619.1|2043731_2044010_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265261.1|2044011_2045067_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.9e-88
WP_000140030.1|2045067_2045433_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.6	2.5e-36
WP_000640035.1|2045441_2045996_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917751.1|2046220_2046418_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024311.1|2046568_2047627_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	89.8	4.6e-187
WP_075362568.1|2048405_2050259_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000284518.1|2050408_2050624_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001774431.1|2050628_2050973_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_024234348.1|2050938_2051211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992175.1|2051316_2051850_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	6.2e-100
WP_001303555.1|2052005_2052188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2052200_2052332_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2052559_2052745_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2053272_2053587_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_052916529.1|2053668_2053893_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.9	1.6e-20
WP_172868095.1|2054063_2055276_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.3	1.4e-163
WP_000453611.1|2055594_2056140_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027259.1|2056114_2058040_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198153.1|2058036_2058243_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_053879169.1|2058239_2059841_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	5.5e-309
WP_075362569.1|2059821_2061141_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.3e-231
WP_001365129.1|2061150_2061483_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|2061538_2062564_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_023181050.1|2062947_2064483_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_001282653.1|2064499_2065255_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_049595780.1|2065661_2066015_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	98.3	3.4e-62
WP_000975091.1|2066026_2066602_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	61.7	1.4e-52
WP_000683153.1|2066598_2066994_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	91.6	6.3e-65
WP_000235098.1|2067001_2067754_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|2067767_2068190_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_075362572.1|2068216_2068630_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_075362573.1|2068610_2071223_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	89.5	0.0e+00
WP_000847353.1|2071219_2071549_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	95.4	4.2e-54
WP_075362574.1|2071548_2072247_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	2.0e-130
WP_001300229.1|2072251_2072995_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	5.7e-144
WP_162783853.1|2072931_2073564_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.1	1.0e-93
WP_075362576.1|2073624_2077101_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	91.0	0.0e+00
WP_025670860.1|2077170_2077770_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	3.1e-108
WP_075362724.1|2077834_2079148_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	98.9	4.1e-76
WP_170386723.1|2079249_2080221_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_001189221.1|2080242_2080491_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.6	1.3e-39
WP_023307902.1|2080940_2082302_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	2.8e-51
WP_000799400.1|2082664_2083528_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|2083511_2084648_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359441.1|2084897_2086124_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|2086172_2087294_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
2087496:2087521	attL	CGGTGTAGTTAATGGTGTAGTTAATT	NA	NA	NA	NA
WP_069723193.1|2087542_2088772_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.4	6.8e-134
WP_045145518.1|2089146_2089335_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_114140383.1|2089387_2089948_+	hypothetical protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	48.9	2.8e-10
WP_012601535.1|2090064_2090292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069723191.1|2090349_2090529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069723190.1|2090724_2090922_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_075362577.1|2090914_2091235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261494.1|2091241_2091541_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_069354211.1|2091537_2093355_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	1.5e-129
WP_000125504.1|2093642_2093888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069723201.1|2093884_2094307_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228103.1|2094525_2095566_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.9	8.8e-66
WP_000190772.1|2095575_2095917_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001179424.1|2095928_2096312_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_069723199.1|2096513_2097056_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	46.3	3.2e-35
WP_069723198.1|2097067_2097349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735411.1|2098092_2099553_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
2097987:2098012	attR	CGGTGTAGTTAATGGTGTAGTTAATT	NA	NA	NA	NA
WP_001265481.1|2099552_2100224_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2100391_2101762_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|2101765_2102407_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|2102442_2103549_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP017631	Escherichia coli strain SLK172 chromosome, complete genome	5283836	2206072	2264269	5283836	terminase,tail,protease,holin,integrase,portal	Enterobacteria_phage(42.55%)	67	2205908:2205930	2248425:2248447
2205908:2205930	attL	TCAGTGTGGTACATGGATATCGA	NA	NA	NA	NA
WP_075362581.1|2206072_2207203_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	50.3	3.7e-102
WP_075362582.1|2207180_2207429_-	excisionase	NA	NA	NA	NA	NA
WP_075362583.1|2207493_2209869_-	exonuclease	NA	V5UQJ3	Shigella_phage	40.3	6.2e-107
WP_063100352.1|2209946_2210150_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001542789.1|2210146_2210335_-	phage cell division inhibition protein	NA	NA	NA	NA	NA
WP_000394557.1|2210866_2211241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|2211252_2211405_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_001003379.1|2211595_2212003_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|2212080_2212308_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705377.1|2212291_2212843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039022662.1|2212814_2213855_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.8e-90
WP_162783854.1|2213766_2214309_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	95.4	3.2e-83
WP_075362585.1|2214341_2215112_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	73.8	5.1e-95
WP_075362586.1|2215127_2215550_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.9	5.1e-65
WP_069723435.1|2215546_2215852_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	97.0	3.0e-51
WP_069723436.1|2215838_2216168_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	8.2e-26
WP_069723437.1|2216681_2217419_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	90.3	9.1e-33
WP_001278454.1|2217534_2217639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|2217828_2218041_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_000687435.1|2218261_2218522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075362587.1|2218588_2218867_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.6e-11
WP_075362588.1|2218868_2219927_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	1.7e-88
WP_000140022.1|2219927_2220293_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	4.6e-38
WP_001409110.1|2220301_2220844_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.3	1.9e-67
WP_024244911.1|2221156_2221354_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.0e-28
WP_000839567.1|2223205_2223421_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	97.2	6.9e-34
WP_075362590.1|2223425_2223740_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	97.1	2.7e-50
WP_001274714.1|2223795_2224329_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_122986183.1|2224545_2224731_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.4e-19
WP_000373410.1|2225207_2225684_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_001077625.1|2225680_2227804_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102415.1|2227800_2228013_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|2228012_2229515_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|2229459_2231484_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2231571_2231898_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281348.1|2231890_2232172_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_000974958.1|2232174_2232798_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_000682716.1|2232810_2233209_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2233216_2233969_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479045.1|2233982_2234405_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533450.1|2234431_2234740_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	98.0	6.6e-54
WP_075362591.1|2234783_2237429_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	96.7	0.0e+00
WP_000847336.1|2237425_2237755_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	1.2e-53
WP_001152639.1|2237754_2238453_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_075362592.1|2238457_2239201_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.4e-145
WP_162783855.1|2239137_2239770_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	6.1e-94
WP_075362594.1|2239830_2243223_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	91.0	0.0e+00
WP_075362595.1|2243292_2243892_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	4.1e-100
WP_075362726.1|2243956_2245270_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	98.4	1.5e-75
WP_001023445.1|2245271_2245541_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_023307902.1|2245990_2247352_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	2.8e-51
WP_001079505.1|2248603_2249110_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2248425:2248447	attR	TCAGTGTGGTACATGGATATCGA	NA	NA	NA	NA
WP_001056490.1|2249155_2249656_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2249741_2249921_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|2250301_2251108_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|2251107_2252301_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_072169209.1|2252312_2253674_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|2253674_2255270_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194582.1|2255269_2256832_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2256923_2256968_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_075362596.1|2257105_2257987_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2257983_2258604_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001301109.1|2258631_2260527_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|2260739_2261615_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|2261654_2262245_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559274.1|2262241_2263000_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	1.5e-06
WP_000422045.1|2263219_2264269_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP017631	Escherichia coli strain SLK172 chromosome, complete genome	5283836	2339252	2409914	5283836	terminase,coat,tail,holin,lysis,transposase,tRNA	Escherichia_phage(41.07%)	73	NA	NA
WP_075362728.1|2339252_2340485_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2340739_2341723_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2342200_2343574_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2343702_2344638_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000079604.1|2345926_2346142_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2346220_2346430_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2346422_2346617_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2346673_2347483_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_075362597.1|2347475_2350076_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_001352098.1|2350526_2350697_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2350696_2350918_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_063856386.1|2351359_2351848_+	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2351844_2352000_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000362155.1|2352398_2352818_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|2352918_2353200_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693836.1|2353183_2353609_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_069722905.1|2353680_2354751_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_001151151.1|2354791_2355214_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|2355554_2357552_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_000625667.1|2357615_2358893_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000019009.1|2359023_2359905_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829241.1|2360309_2361522_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001117227.1|2361918_2363118_-	MFS transporter	NA	NA	NA	NA	NA
WP_122986748.1|2363629_2363737_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	93.1	2.5e-08
WP_075362599.1|2363914_2365189_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_162829241.1|2365191_2366405_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_075362600.1|2367004_2367256_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_071600497.1|2368315_2368621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2368645_2368885_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2368884_2369172_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813269.1|2369243_2369399_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_025670565.1|2369867_2370467_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	3.2e-105
WP_000255944.1|2370588_2371611_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_077903257.1|2371610_2372405_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.1e-135
WP_173662722.1|2372407_2373621_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	6.0e-167
WP_069723324.1|2373771_2374029_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	85.9	4.5e-40
WP_000640161.1|2374025_2374568_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000506936.1|2375612_2376041_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2376212_2376587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|2376838_2377054_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001351713.1|2377053_2377551_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_001228688.1|2377767_2377953_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_075362603.1|2378149_2379607_+	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001291094.1|2379744_2380536_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204037.1|2380528_2381461_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000613571.1|2381396_2381648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089447.1|2381651_2382746_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000625348.1|2382726_2384028_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763704.1|2384030_2385437_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001351715.1|2385420_2386533_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_032216333.1|2387500_2388640_+|coat	coat protein	coat	G8C7P7	Escherichia_phage	74.7	3.7e-158
WP_000908084.1|2388682_2388859_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000524260.1|2389256_2389640_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|2389640_2390021_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|2390017_2390410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2390436_2391399_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_012565075.1|2391549_2391909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|2392016_2392217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000840618.1|2392382_2395616_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	1.1e-111
WP_000024051.1|2395608_2395947_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|2395946_2396645_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_001351716.1|2396650_2397394_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
WP_000090943.1|2397330_2397933_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_075362604.1|2397993_2401473_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.5	0.0e+00
WP_075362605.1|2401540_2402140_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	9.4e-105
WP_072007630.1|2402204_2405432_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.4e-06
WP_001351719.1|2405431_2406007_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
WP_000078178.1|2406104_2406695_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2407011_2407245_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2407313_2407427_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001157925.1|2407766_2407940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300461.1|2408205_2408640_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_069723034.1|2408780_2409914_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 8
NZ_CP017631	Escherichia coli strain SLK172 chromosome, complete genome	5283836	3038159	3091283	5283836	terminase,tail,holin,capsid,transposase,integrase,head,portal	Enterobacteria_phage(40.38%)	67	3052407:3052422	3101961:3101976
WP_075362625.1|3038159_3038429_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	96.6	2.7e-43
WP_075362626.1|3038430_3039744_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.3	5.3e-76
WP_001230425.1|3039808_3040408_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.3e-109
WP_075362627.1|3040475_3043949_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.4	0.0e+00
WP_000649825.1|3044082_3044610_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	61.0	2.1e-60
WP_097479149.1|3044800_3045433_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	4.9e-104
WP_075362628.1|3045378_3046122_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	4.7e-146
WP_001299882.1|3046127_3046826_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_000847304.1|3046825_3047155_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_075362629.1|3047151_3049731_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.9	0.0e+00
WP_075362630.1|3049711_3050125_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	81.8	1.9e-40
WP_000479105.1|3050151_3050583_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_001357739.1|3050596_3051349_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
WP_000683066.1|3051356_3051752_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975046.1|3051748_3052282_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_001204547.1|3052297_3052651_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
3052407:3052422	attL	GTCAGCGTGTCACCAC	NA	NA	NA	NA
WP_000201525.1|3052643_3053018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522615.1|3053069_3054098_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000256809.1|3054155_3054503_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253961.1|3054539_3056045_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
WP_000831765.1|3056034_3057627_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_000259002.1|3057623_3057830_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_075362631.1|3057813_3059742_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	6.7e-261
WP_000235436.1|3059713_3060223_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_023181050.1|3061086_3062622_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_001282653.1|3062638_3063394_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_052916529.1|3064576_3064801_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.9	1.6e-20
WP_001303878.1|3064882_3065197_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3065724_3065910_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|3066137_3066269_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|3066281_3066464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992175.1|3066619_3067153_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	6.2e-100
WP_075362633.1|3067524_3067839_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	97.1	1.2e-50
WP_001596848.1|3067843_3068059_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	94.4	3.4e-33
WP_075362634.1|3068126_3069179_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	94.0	2.8e-197
WP_032287971.1|3069332_3069527_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	7.9e-29
WP_059240238.1|3069754_3070576_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	1.8e-77
WP_059240236.1|3070572_3070953_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	3.1e-37
WP_059240234.1|3070953_3072009_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.2e-88
WP_059240233.1|3072010_3072289_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001217946.1|3072828_3073200_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042399.1|3073192_3073510_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_059240231.1|3073646_3074177_-	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	61.9	7.2e-56
WP_000951717.1|3074173_3074383_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	100.0	2.5e-36
WP_075362635.1|3074384_3075155_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	98.0	3.1e-140
WP_059239299.1|3075151_3075835_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	81.5	2.0e-42
WP_069723346.1|3075831_3076122_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	81.2	3.4e-36
WP_059239302.1|3076118_3076820_-	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	55.8	4.1e-51
WP_059239305.1|3076806_3077559_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.0	2.8e-77
WP_000788766.1|3077581_3078328_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.7	9.0e-113
WP_059239307.1|3078334_3079300_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	2.2e-58
WP_001360156.1|3079280_3079802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070718.1|3079785_3080061_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.9	8.6e-13
WP_000036090.1|3080173_3080584_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	32.2	1.5e-08
WP_000379575.1|3080762_3080918_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171935.1|3081077_3081284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033813300.1|3081308_3081947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033813301.1|3081947_3082157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069723343.1|3082727_3082916_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_069723342.1|3082912_3083116_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_069723341.1|3083193_3085659_+	exonuclease	NA	V5UQJ3	Shigella_phage	43.4	1.0e-104
WP_000003742.1|3085720_3085990_+	excisionase	NA	NA	NA	NA	NA
WP_059239312.1|3085958_3087077_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_000580316.1|3087243_3088038_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759317.1|3088034_3089081_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000076376.1|3089138_3089600_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_170386723.1|3090311_3091283_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
3101961:3101976	attR	GTGGTGACACGCTGAC	NA	NA	NA	NA
>prophage 9
NZ_CP017631	Escherichia coli strain SLK172 chromosome, complete genome	5283836	3177044	3207447	5283836	transposase	Stx2-converting_phage(23.08%)	28	NA	NA
WP_039025881.1|3177044_3177689_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	31.6	8.0e-25
WP_000692312.1|3177703_3177925_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186770.1|3177993_3178470_-	RadC family protein	NA	NA	NA	NA	NA
WP_075362640.1|3178485_3178959_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.1	2.5e-12
WP_075362641.1|3179300_3180119_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	1.2e-46
WP_000789536.1|3180529_3180943_-	hypothetical protein	NA	A0A1B2IAE4	Erwinia_phage	42.0	5.8e-21
WP_023293987.1|3181259_3182240_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
WP_001104026.1|3182412_3182952_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_063082307.1|3183077_3183536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063082306.1|3183664_3184735_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203506.1|3184731_3185637_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_075362643.1|3185633_3188030_-	dynamin family protein	NA	NA	NA	NA	NA
WP_075362644.1|3188247_3189120_-	GTPase family protein	NA	NA	NA	NA	NA
WP_063082116.1|3189383_3190940_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_075362645.1|3190936_3192196_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_075362646.1|3192317_3192614_+	HsdR protein	NA	NA	NA	NA	NA
WP_170386723.1|3192698_3193670_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_073481441.1|3196653_3197634_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	5.7e-184
WP_139120226.1|3197744_3198134_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	97.7	1.1e-66
WP_000612591.1|3198130_3198478_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_072643824.1|3198527_3200066_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	2.2e-283
WP_029396387.1|3200503_3201238_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001287791.1|3202433_3202625_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124181.1|3202677_3202911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260380.1|3203006_3203630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029396382.1|3203890_3204286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002461143.1|3204582_3205356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168768808.1|3206218_3207447_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.5e-168
>prophage 10
NZ_CP017631	Escherichia coli strain SLK172 chromosome, complete genome	5283836	3379055	3454423	5283836	transposase,integrase,tRNA,protease	Pseudomonas_phage(12.5%)	58	3393869:3393887	3455836:3455854
WP_000886683.1|3379055_3380348_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_063856169.1|3380438_3381782_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	3.6e-80
WP_032202383.1|3381792_3382404_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|3382558_3386548_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3386682_3387177_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3387721_3388687_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043578.1|3388809_3390576_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001202202.1|3390576_3392298_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001241676.1|3392339_3393044_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3393328_3393547_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
3393869:3393887	attL	AATCCCCCCCTCACCGCCA	NA	NA	NA	NA
WP_001274547.1|3394036_3394879_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839253.1|3394963_3395161_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001054233.1|3395177_3395666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854686.1|3395662_3396046_-	toxin	NA	NA	NA	NA	NA
WP_001285602.1|3396122_3396503_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086748.1|3396552_3397197_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	33.3	1.0e-27
WP_069723389.1|3397215_3397437_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	1.6e-09
WP_069723390.1|3397523_3397922_-	RadC family protein	NA	NA	NA	NA	NA
WP_069723391.1|3397937_3398423_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	2.6e-12
WP_024220054.1|3398514_3399333_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	4.7e-46
WP_053904493.1|3399659_3402509_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_069723392.1|3402880_3403753_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000282126.1|3404084_3404267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422690.1|3404566_3404986_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	95.9	2.2e-47
WP_001323403.1|3405611_3406391_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|3406390_3407413_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_000301248.1|3408773_3409349_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3409417_3409996_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_029397834.1|3410044_3411085_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	3.8e-77
WP_000007450.1|3411107_3411563_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_029397833.1|3411585_3412743_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254142.1|3412742_3413324_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	3.7e-13
WP_001360177.1|3413646_3414705_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280116.1|3414714_3415857_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3415849_3416623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182420.1|3416624_3417704_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	1.6e-38
WP_000797372.1|3417703_3418660_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_029397832.1|3418670_3419879_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176768.1|3419896_3420364_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000567766.1|3420665_3421031_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
WP_089519163.1|3421573_3422287_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	43.8	6.9e-38
WP_087205686.1|3422477_3423538_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	52.7	3.3e-84
WP_075362652.1|3424385_3427331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000073819.1|3429045_3429480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001411495.1|3430885_3431023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072197.1|3432404_3433229_-	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_001544449.1|3433477_3433816_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000192271.1|3433929_3435501_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000459228.1|3435512_3436688_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_000757210.1|3436701_3438591_+	enterotoxin	NA	NA	NA	NA	NA
WP_024167628.1|3438759_3438966_-	methyltransferase	NA	NA	NA	NA	NA
WP_000622487.1|3439070_3440507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000282094.1|3445898_3446462_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001242276.1|3447671_3449495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001349431.1|3449595_3449844_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_063082223.1|3449859_3451425_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001282653.1|3452115_3452871_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_023181050.1|3452887_3454423_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
3455836:3455854	attR	AATCCCCCCCTCACCGCCA	NA	NA	NA	NA
>prophage 11
NZ_CP017631	Escherichia coli strain SLK172 chromosome, complete genome	5283836	3530825	3636666	5283836	terminase,tail,protease,holin,lysis,capsid,transposase,integrase,head,portal	Escherichia_phage(31.71%)	120	3550053:3550087	3638100:3638134
WP_000526135.1|3530825_3531284_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001295296.1|3531474_3531990_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3532042_3532108_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|3532342_3533230_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|3533528_3534032_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3534435_3535182_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|3535320_3535980_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569083.1|3535976_3536699_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_032202460.1|3536959_3539185_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001295299.1|3539181_3540108_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_000710619.1|3540383_3540644_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_025670142.1|3540908_3543191_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990183.1|3543232_3543910_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|3543983_3544250_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3544514_3544775_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443530.1|3545003_3546089_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386551.1|3546229_3547192_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|3547219_3549370_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145126.1|3549489_3549972_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
3550053:3550087	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000007101.1|3550203_3551568_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|3551796_3552468_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|3552470_3553466_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001459597.1|3553458_3555195_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070131.1|3555187_3556321_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|3556331_3557438_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|3557399_3557810_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_075362654.1|3557942_3558704_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650318.1|3558700_3559942_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045450.1|3559941_3560898_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446895.1|3560933_3561647_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373627.1|3561851_3562556_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852290.1|3562691_3563144_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|3563145_3563391_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3563383_3563869_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|3563871_3564384_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_069722678.1|3564405_3565395_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|3565791_3566700_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|3566891_3568913_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_032216032.1|3569491_3570169_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246761.1|3570161_3570917_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118797.1|3570903_3572058_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|3572054_3573095_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_023281131.1|3573181_3574471_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	7.7e-19
WP_000767389.1|3574529_3575006_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001102750.1|3575685_3576924_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	82.3	3.6e-207
WP_075362732.1|3577261_3577858_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	75.3	7.8e-75
WP_085959875.1|3577917_3579145_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.3e-172
WP_032164481.1|3579724_3580555_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.9	1.7e-149
WP_000950984.1|3580771_3581653_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	1.0e-147
WP_096150060.1|3581816_3581948_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950792.1|3582294_3583275_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	1.7e-87
WP_162783859.1|3583451_3583604_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	96.6	1.4e-09
WP_172868095.1|3583592_3584805_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.3	1.4e-163
WP_075362655.1|3585035_3586394_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.8	2.8e-80
WP_001230418.1|3586458_3587058_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	1.5e-110
WP_000515383.1|3587125_3590521_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.9	0.0e+00
WP_000090913.1|3590581_3591184_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	3.6e-88
WP_001300229.1|3591120_3591864_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	5.7e-144
WP_001152529.1|3591868_3592567_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	2.9e-129
WP_000847393.1|3592566_3592896_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.7e-53
WP_075362656.1|3592892_3595472_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.4	0.0e+00
WP_000255944.1|3595595_3596618_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|3596617_3597397_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000153263.1|3597575_3598103_+	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	8.0e-100
WP_001254222.1|3598099_3598282_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000566868.1|3598278_3598449_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001108038.1|3598441_3599053_+	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
WP_001028841.1|3599049_3599715_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_000750155.1|3599926_3600886_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|3601224_3601347_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|3601361_3602051_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_162541127.1|3602235_3602979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|3603064_3603223_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001282653.1|3604689_3605445_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_023181050.1|3605461_3606997_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_024164617.1|3608455_3608671_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075135.1|3608670_3609168_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_000092324.1|3609164_3609602_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.4e-70
WP_000881338.1|3609751_3610369_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.4	1.2e-91
WP_001307652.1|3610556_3610751_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_001569616.1|3611145_3611655_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.2	3.6e-12
WP_075362660.1|3611626_3613555_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.7e-259
WP_000259002.1|3613538_3613745_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_069723232.1|3613741_3615334_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	9.3e-184
WP_075362661.1|3615323_3616829_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|3616865_3617213_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522623.1|3617270_3618299_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201513.1|3618350_3618734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204560.1|3618726_3619080_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000975031.1|3619094_3619628_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
WP_000683065.1|3619624_3620020_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_001143022.1|3620027_3620780_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.1e-126
WP_000479115.1|3620793_3621225_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_075362662.1|3621251_3621629_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	4.6e-41
WP_001323403.1|3621679_3622459_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|3622458_3623481_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_075362663.1|3623507_3623897_-	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	1.7e-59
WP_000145926.1|3623970_3624261_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788866.1|3624257_3624959_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	1.4e-128
WP_069722757.1|3624955_3625855_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.3	1.2e-172
WP_024203136.1|3625887_3626184_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	99.0	4.4e-47
WP_162829241.1|3626424_3627638_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_069723382.1|3627689_3627854_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	1.0e-24
WP_001302016.1|3627929_3628625_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000087627.1|3628976_3629510_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_032194733.1|3629943_3630216_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	97.8	2.2e-40
WP_061090272.1|3630624_3630993_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	1.7e-64
WP_001198860.1|3631065_3631230_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372924.1|3631198_3631342_+	host cell division inhibitory peptide Kil	NA	A0A0N7C011	Escherichia_phage	100.0	1.2e-18
WP_000995439.1|3631417_3631714_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3631719_3632505_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186804.1|3632501_3633182_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_000682318.1|3633178_3633361_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548531.1|3633333_3633525_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077887845.1|3633535_3633817_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_000763367.1|3633915_3634137_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000120063.1|3634347_3634950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3635192_3635360_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3635399_3635618_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3635595_3636666_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3638100:3638134	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 12
NZ_CP017631	Escherichia coli strain SLK172 chromosome, complete genome	5283836	4145744	4158200	5283836	integrase	Enterobacteria_phage(33.33%)	13	4150330:4150342	4154244:4154256
WP_075362680.1|4145744_4148501_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.5	2.3e-299
WP_075362681.1|4148513_4149116_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	2.4e-23
WP_075362682.1|4149108_4149330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048943303.1|4149326_4149590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065661.1|4149586_4149781_-	hypothetical protein	NA	NA	NA	NA	NA
4150330:4150342	attL	ACGCGGATTATAA	NA	NA	NA	NA
WP_000476150.1|4150834_4151017_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_075362683.1|4151009_4151843_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	6.9e-21
WP_000412538.1|4151855_4152287_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_000035054.1|4152286_4152490_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000772643.1|4152918_4154133_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000893279.1|4154488_4155742_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	2.2e-95
4154244:4154256	attR	ACGCGGATTATAA	NA	NA	NA	NA
WP_001285288.1|4155753_4156857_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|4157144_4158200_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 13
NZ_CP017631	Escherichia coli strain SLK172 chromosome, complete genome	5283836	4841765	4888180	5283836	terminase,tail,protease,lysis,transposase,tRNA,portal	Enterobacteria_phage(46.3%)	56	NA	NA
WP_025670864.1|4841765_4842803_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_170386723.1|4843797_4844769_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_001143619.1|4845414_4848798_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	72.8	0.0e+00
WP_001101710.1|4849221_4849491_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	95.5	4.6e-43
WP_075362703.1|4849492_4850743_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZDE7	Stx2-converting_phage	95.0	3.3e-75
WP_075362704.1|4850807_4851407_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.1e-105
WP_075362705.1|4851476_4854869_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.2	0.0e+00
WP_162783853.1|4854929_4855562_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.1	1.0e-93
WP_075362706.1|4855498_4856242_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.1	3.7e-143
WP_001152529.1|4856246_4856945_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	2.9e-129
WP_000847401.1|4856944_4857274_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_075362707.1|4857270_4859916_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	84.3	0.0e+00
WP_000532075.1|4859959_4860268_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479043.1|4860294_4860717_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235098.1|4860730_4861483_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000682716.1|4861490_4861889_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974958.1|4861901_4862525_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_001281348.1|4862527_4862809_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_001097065.1|4862801_4863128_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|4863215_4865240_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|4865184_4866687_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|4866686_4866899_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077626.1|4866895_4869019_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000373410.1|4869015_4869492_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_122986183.1|4869968_4870154_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.4e-19
WP_075362709.1|4870370_4870904_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	8.1e-100
WP_075362710.1|4870967_4871318_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	92.9	2.4e-36
WP_000839596.1|4871322_4871538_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|4871605_4872658_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|4872808_4873012_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001038608.1|4873282_4873729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204819.1|4873813_4874179_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
WP_001564461.1|4874196_4875186_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.2e-194
WP_001061380.1|4875193_4876003_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	2.8e-152
WP_000767118.1|4876022_4876412_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	98.4	3.0e-67
WP_000210170.1|4876408_4876735_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001305610.1|4876731_4877385_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_001305611.1|4877384_4877879_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_075362712.1|4877875_4878694_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	8.9e-122
WP_000620696.1|4878690_4878915_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_047089119.1|4878911_4880063_-	Rha family phage regulatory protein	NA	K7PLX4	Enterobacteria_phage	96.1	2.8e-206
WP_000515860.1|4880059_4880611_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_000649477.1|4880654_4880855_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859460.1|4880945_4881620_+	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
WP_000135680.1|4882308_4882671_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_075362714.1|4882736_4883561_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	8.6e-149
WP_000008232.1|4883689_4884226_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_075362715.1|4884216_4884567_+	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	95.7	2.8e-56
WP_069723346.1|4884563_4884854_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	81.2	3.4e-36
WP_075362716.1|4884850_4885534_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	81.5	2.0e-42
WP_075362717.1|4885530_4886334_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	84.6	5.1e-122
WP_000951717.1|4886335_4886545_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	100.0	2.5e-36
WP_075362718.1|4886541_4887069_+	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	62.0	3.5e-55
WP_069723195.1|4887068_4887641_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.4	1.9e-107
WP_001093918.1|4887677_4887959_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_000390072.1|4888006_4888180_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	98.2	9.8e-23
>prophage 1
NZ_CP017632	Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence	369298	14734	185404	369298	integrase,head,plate,transposase,portal,lysis,tail,holin,terminase	Escherichia_phage(53.33%)	173	33869:33928	142496:145889
WP_001067858.1|14734_15439_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_057109146.1|15773_16166_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_063102497.1|16485_16872_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_072644484.1|19159_19324_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000259031.1|19504_20344_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|20471_20675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|20899_21604_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|21793_22609_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|22759_23464_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000612791.1|23694_24558_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|24595_24841_+	GrpB family protein	NA	NA	NA	NA	NA
WP_000034420.1|25309_26101_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_109023896.1|26103_26379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|27280_27613_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|27782_28574_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|28666_29926_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206356.1|30187_30979_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|30984_31275_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|31386_31884_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|32028_33042_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_071830595.1|33244_33595_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|33720_34281_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
33869:33928	attL	GCTTCGCCCGCACCGGCGACACCGTGGTGGTGCATAGCATGGATCGCCTGGCGCGCAATC	NA	NA	NA	NA
WP_001138064.1|34283_37250_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_063078308.1|37654_38215_+	Ref family protein	NA	Q71TG3	Escherichia_phage	96.2	8.0e-98
WP_024245511.1|38404_39046_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	96.7	1.5e-111
WP_059338150.1|39136_40177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024245513.1|40176_40686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000747846.1|40744_40993_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|40989_41430_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_069723462.1|41463_48231_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.6	0.0e+00
WP_069723461.1|48307_50017_+|portal	phage portal protein	portal	Q71TR7	Escherichia_phage	99.3	0.0e+00
WP_000132937.1|50009_51029_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_042032566.1|51320_51878_-	lysozyme	NA	Q71TF3	Escherichia_phage	98.9	1.4e-105
WP_063099965.1|52047_52536_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	98.8	4.2e-87
WP_000724561.1|52769_53882_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	98.1	1.0e-200
WP_001165940.1|54621_54927_-	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	100.0	1.2e-52
WP_069723460.1|54916_57904_-	hypothetical protein	NA	Q1MVM9	Enterobacteria_phage	99.2	0.0e+00
WP_033553840.1|57916_58282_-	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	95.8	1.1e-44
WP_033553841.1|58278_60198_-	phage protein DarA	NA	A0A1B0V7H1	Salmonella_phage	98.0	0.0e+00
WP_033553842.1|60199_60802_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	98.5	3.9e-98
WP_033553843.1|60788_61232_-|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	99.3	1.1e-81
WP_000887652.1|61228_61558_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_032163794.1|62581_63127_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_032163793.1|63090_63708_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.3	7.2e-84
WP_063856239.1|63707_67727_-|tail	tail fiber protein	tail	Q71TP5	Escherichia_phage	65.9	0.0e+00
WP_001286326.1|67738_68173_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_069723459.1|68251_69088_-|tail	phage tail protein	tail	A0A077SLH5	Escherichia_phage	98.6	3.8e-152
WP_000047923.1|69087_70521_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_033553797.1|70517_70874_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	99.2	1.1e-60
WP_114140405.1|70873_74614_-	transglycosylase SLT domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	87.0	0.0e+00
WP_063119473.1|74695_75577_-	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.3	1.1e-173
WP_000523980.1|75591_76203_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_069723458.1|76213_76780_-	hypothetical protein	NA	A0A077SK12	Escherichia_phage	98.4	4.3e-99
WP_001033469.1|76860_77400_-	DUF5384 family protein	NA	A0A077SL46	Escherichia_phage	100.0	1.8e-46
WP_000039791.1|77403_77916_-	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
WP_000245709.1|78535_78757_+	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	98.6	3.6e-38
WP_069723457.1|78753_79788_+	phage antirepressor KilAC domain-containing protein	NA	A0A077SLI1	Escherichia_phage	95.6	2.2e-181
WP_001187871.1|79951_80752_+	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
WP_023154394.1|80781_81627_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	99.3	3.8e-152
WP_069723463.1|81677_81923_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	1.5e-13
WP_023156625.1|82104_82260_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	90.2	1.2e-14
WP_000509939.1|82376_82886_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035301.1|82897_83479_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_069723236.1|83514_84330_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.9	2.9e-112
WP_069723237.1|84339_85929_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	99.1	1.4e-304
WP_023157211.1|85989_87696_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000038866.1|87921_88923_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_001285362.1|88939_90136_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_069723485.1|90693_91554_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	99.7	1.4e-157
WP_001281120.1|91872_92265_-	hypothetical protein	NA	A0A1B0VBK3	Salmonella_phage	94.6	1.8e-67
WP_000336812.1|92276_92417_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_075362737.1|92442_92865_-	ppfA	NA	Q1MVI9	Enterobacteria_phage	90.7	9.4e-59
WP_075362738.1|92904_93693_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	90.5	4.9e-109
WP_001177860.1|94156_94441_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_000472529.1|94433_95339_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_075362739.1|95335_97600_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	67.9	0.0e+00
WP_039022915.1|97970_99140_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	86.9	1.0e-179
WP_023181050.1|99859_101395_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_001282653.1|101411_102167_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_064753586.1|102630_103566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069723417.1|104297_104999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001697558.1|105057_105360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039022917.1|105464_106097_-	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_000212018.1|106089_107106_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_069723418.1|107107_107893_-|plate	baseplate	plate	Q71T90	Escherichia_phage	99.6	1.6e-144
WP_000896801.1|107879_108608_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_069723465.1|108611_109829_-|tail	phage tail protein	tail	Q71T88	Escherichia_phage	99.5	1.2e-223
WP_000235786.1|109838_110216_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|110361_110607_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_069723466.1|110609_111188_+	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_001567997.1|111254_111410_+	hypothetical protein	NA	Q1MVH0	Enterobacteria_phage	98.0	1.2e-19
WP_000484110.1|111911_112538_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_024199458.1|112534_113212_+	metallophosphoesterase	NA	A0A077SLQ6	Escherichia_phage	99.6	2.2e-134
WP_069723467.1|113208_113910_+	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	99.6	2.7e-143
WP_075362740.1|114211_115474_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.8	1.2e-234
WP_000021768.1|115546_116053_+	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.8e-93
WP_001774487.1|116247_116829_+	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	99.5	7.7e-112
WP_001774486.1|116821_117082_+	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	98.8	1.5e-43
WP_162783860.1|117105_117267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069723432.1|117263_117992_+	site-specific DNA-methyltransferase	NA	A0A2I7QM56	Vibrio_phage	57.7	5.0e-76
WP_069723429.1|118806_119232_+	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	59.9	2.7e-45
WP_069723428.1|119745_120732_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	51.6	2.6e-99
WP_001261544.1|120728_121091_+	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_000123562.1|121165_121303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069723427.1|121752_122004_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	98.8	2.9e-39
WP_069723426.1|122010_122583_-	DNA-binding protein	NA	Q71TH9	Escherichia_phage	98.9	2.5e-107
WP_000506730.1|122757_123147_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
WP_001190712.1|123219_123441_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|123440_123821_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001339207.1|123825_124005_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	100.0	7.1e-24
WP_069723425.1|124032_125076_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.8	1.1e-204
WP_001326849.1|125164_125617_+	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_069723424.1|125702_126896_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	91.9	4.2e-189
WP_000124150.1|126895_128380_+|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_075362742.1|128602_128716_+	ash family protein	NA	NA	NA	NA	NA
WP_072178795.1|128740_128962_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	1.6e-25
WP_069723292.1|128958_130071_+	phage antirepressor KilAC domain-containing protein	NA	A0A077SLR9	Escherichia_phage	86.5	2.9e-176
WP_000611656.1|130103_130955_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000542332.1|131862_132084_+	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
WP_046660036.1|132091_133123_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	99.4	6.4e-194
WP_000427623.1|133642_134647_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|134725_135160_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|135231_135582_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_065203552.1|135595_135871_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|135906_136329_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|136380_138075_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|138092_138455_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|138451_138688_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|138723_139392_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|140781_141486_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|141727_142432_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072692426.1|142467_142908_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	3.2e-49
WP_001138064.1|142910_145877_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000427623.1|145955_146960_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
142496:145889	attR	GCTTCGCCCGCACCGGCGACACCGTGGTGGTGCATAGCATGGATCGCCTGGCGCGCAATCTCGATGATTTGCGCCGGATCGTGCAAACGCTGACACAACGCGGCGTGCATATCGAATTCGTCAAGGAACACCTCAGTTTTACTGGCGAAGACTCTCCGATGGCGAACCTGATGCTCTCGGTGATGGGCGCGTTCGCCGAGTTCGAGCGCGCCCTGATCCGCGAGCGTCAGCGCGAGGGTATTGCGCTCGCCAAGCAACGCGGGGCTTACCGTGGCAGGAAGAAATCCCTGTCGTCTGAGCGTATTGCCGAACTGCGCCAACGTGTCGAGGCTGGCGAGCAAAAGACCAAGCTTGCTCGTGAATTCGGAATCAGTCGCGAAACCCTGTATCAATACTTGAGAACGGATCAGTAAATATGCCACGTCGTTCCATCCTGTCCGCCGCCGAGCGGGAAAGCCTGCTGGCGTTGCCGGACTCCAAGGACGACCTGATCCGACATTACACATTCAACGATACCGACCTCTCGATCATCCGACAGCGGCGCGGGCCAGCCAATCGGCTGGGCTTCGCGGTGCAGCTCTGTTACCTGCGCTTTCCCGGCGTCATCCTGGGCGTCGATGAACTACCGTTCCCGCCCTTGTTGAAGCTGGTCGCCGACCAGCTCAAGGTCGGCGTCGAAAGCTGGAACGAGTACGGCCAGCGGGAGCAGACCCGGCGCGAGCACCTGAGCGAGCTGCAAACCGTGTTCGGTTTCCGGCCCTTCACCATGAGCCATTACCGGCAGGCCGTCCAGATGCTGACCGAGCTGGCGATGCAAACCGACAAAGGCATCGTGCTGGCCAGCGCCTTGATCGGGCACCTGCGGCGGCAGTCGGTCATTCTGCCCGCCCTCAACGCCGTCGAGCGGGCGAGTGCCGAGGCGATCACCCGTGCTAACCGGCGCATCTACGACGCCTTGGCCGAACCACTGGCGGACGCGCATCGCCGCCGCCTCGACGATCTGCTCAAGCGCCGGGACAACGGCAAGACGACCTGGTTGGCTTGGTTGCGCCAGTCTCCGGCCAAGCCAAATTCGCGGCATATGCTGGAACACATCGAACGCCTCAAGGCATGGCAGGCACTCGATCTGCCTACCGGCATCGAGCGGCTGGTTCACCAGAACCGCCTGCTCAAGATTGCCCGCGAGGGCGGCCAGATGACACCCGCCGACCTGGCCAAATTCGAGCCGCAACGGCGCTACGCCACTCTCGTGGCGCTGGCCACCGAGGGCATGGCCACCGTCACCGACGAAATCATCGACCTGCACGACCGCATCCTGGGTAAGCTGTTTAACGCTGCCAAGAATAAGCATCAGCAGCAGTTCCAGGCGTCAGGCAAGGCCATCAACGCCAAGGTACGTCTGTACGGGCGCATCGGTCAGGCGCTGATCGACGCCAAGCAATCAGGCCGCGATGCGTTTGCCGCCATCGAGGCCGTCATGTCCTGGGATTCCTTTGCCGAGAGCGTCACCGAGGCGCAGAAGCTCGCGCAACCCGATGACTTCGATTTCCTGCATCGCATCGGCGAGAGCTACGCCACCCTGCGCCGCTATGCACCGGAATTCCTTGCCGTGCTCAAGCTGCGGGCCGCGCCCGCCGCCAAAAACGTGCTTGATGCCATTGAGGTGCTGCGCGGCATGAACACCGACAACGCCCGCAAGCTGCCAGCCGATGCACCGACCGGCTTCATCAAGCCGCGCTGGCAGAAACTGGTGATGACCGACGCCGGCATCGACCGGCGCTACTACGAACTGTGCGCGCTGTCCGAGTTGAAGAACTCCCTGCGCTCGGGCGACATCTGGGTGCAGGGTTCACGCCAGTTCAAGGACTTCGAGGACTACCTGGTACCGCCCGAGAAGTTCACCAGCCTCAAGCAGTCCAGCGAATTGCCGCTGGCCGTGGCCACCGACTGCGAACAATATCTGCATGAGCGGCTGACGCTGCTGGAAGCACAACTTGCCACCGTCAACCGCATGGCGGCAGCCAACGACCTGCCGGATGCCATCATCACCGAGTCGGGCTTGAAGATCACGCCGCTGGATGCGGCGGTGCCCGACACCGCGCAGGCGCTGATAGACCAGACAGCCATGGTCCTGCCGCACGTCAAGATCACCGAACTGCTGCTCGAAGTCGATGAGTGGACGGGCTTCACCCGGCACTTCACGCACTTGAAATCGGGCGATCTGGCCAAGGACAAGAACCTGTTGTTGACCACGATCCTGGCCGACGCGATCAACCTGGGCCTGACCAAGATGGCCGAGTCCTGCCCCGGCACGACCTACGCGAAGCTCGCTTGGCTGCAAGCCTGGCATACCCGCGACGAAACGTACTCGACAGCGTTGGCTGAACTGGTCAACGCTCAGTTTCGGCATCCCTTTGCCGGGCACTGGGGCGATGGCACCACATCATCATCGGACGGACAGAATTTCCGAACCGCTAGCAAGGCAAAGAGCACGGGGCACATCAACCCAAAATATGGCAGCAGCCCAGGACGGACTTTCTACACCCACATCTCCGACCAATACGCGCCATTCCACACCAAGGTGGTCAATGTCGGCCTGCGCGACTCAACCTACGTGCTCGACGGCCTGCTGTACCACGAATCCGACCTGCGGATCGAGGAGCACTACACCGACACGGCGGGCTTCACCGATCACGTCTTCGCCCTGATGCACCTCTTGGGCTTCCGCTTCGCGCCGCGCATCCGCGACCTGGGCGACACCAAGCTCTACATCCCGAAGGGCGATGCCGCCTATGACGCGCTCAAGCCGATGATCGGCGGCACGCTCAACATCAAGCACGTCCGCGCCCATTGGGACGAAATCCTGCGGCTGGCCACCTCGATCAAGCAGGGCACGGTGACGGCCTCGCTGATGCTCAGGAAACTCGGCAGCTACCCGCGCCAGAACGGCTTGGCCGTCGCGCTGCGCGAGTTGGGCCGCATCGAGCGCACGCTGTTCATCCTCGACTGGCTGCAAAGCGTCGAGCTACGCCGCCGCGTGCATGCCGGGCTGAACAAGGGCGAGGCGCGCAATGCGCTGGCCCGTGCCGTGTTCTTCAACCGCCTTGGTGAAATCCGTGACCGCAGTTTCGAGCAGCAGCGCTACCGGGCCAGCGGCCTCAACCTGGTGACGGCGGCCATCGTGCTGTGGAACACGGTCTACCTGGAGCGTGCGGCGCATGCGTTGCGCGGCAATGGTCATGCCGTCGATGACTCGCTATTGCAGTACCTGTCGCCACTCGGCTGGGAGCACATCAACCTGACCGGTGATTACCTATGGCGCAGCAGCGCCAAGATCGGCGCGGGGAAGTTCAGGCCGCTACGGCCTCTGCAACCGGCTTAGCGTGCTTTATTT	NA	NA	NA	NA
WP_065800308.1|147224_147614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170386723.1|147708_148680_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_001067784.1|148770_149475_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|150399_151284_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|151500_152715_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|152742_153048_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|153159_154653_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|154683_154935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|154828_155131_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|155217_156033_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_085940648.1|156122_157212_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_170628443.1|157409_157769_-	phenol hydroxylase	NA	NA	NA	NA	NA
WP_000602738.1|159705_160458_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000171321.1|161766_161988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199192.1|162008_162785_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_001067855.1|162898_163603_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071448054.1|163608_164355_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014839979.1|164354_164873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|164877_165294_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001617865.1|165905_166781_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_001067855.1|167083_167788_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_031613424.1|169477_169828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|170204_170522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|170572_170980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|171009_171471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|171807_172038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|172699_172933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975182.1|173154_174051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572389.1|174053_174569_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833382.1|174783_176211_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000220758.1|176271_176439_+	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000078514.1|176461_177781_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_001572381.1|178060_179266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|179262_180081_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_152921935.1|180723_180879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|180890_181595_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032193599.1|181624_182329_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_000105383.1|182996_184433_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001067834.1|184699_185404_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
>prophage 2
NZ_CP017632	Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence	369298	188742	235109	369298	integrase,transposase,protease	Escherichia_phage(31.25%)	47	196362:196375	233128:233141
WP_001389365.1|188742_189507_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067858.1|189674_190379_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001175593.1|190921_191245_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063120614.1|191350_192484_+	permease	NA	NA	NA	NA	NA
WP_075362743.1|193183_193393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001282653.1|193409_194165_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_023181050.1|194181_195717_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_173662724.1|195828_196062_-	hypothetical protein	NA	NA	NA	NA	NA
196362:196375	attL	TTGCCAAAGCACTG	NA	NA	NA	NA
WP_000784387.1|197102_197960_-	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001224687.1|197975_198284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043843.1|198832_199258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053276223.1|199511_200327_-	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
WP_000985911.1|200339_200750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134171.1|200851_201058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088046.1|201118_202444_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_024136327.1|202448_202742_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000341066.1|203345_203738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151575.1|204110_204452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|204543_204735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000077926.1|204784_205066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173662723.1|205734_206947_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	1.4e-168
WP_075362744.1|206950_208183_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000301242.1|208611_209187_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_000116677.1|209254_209833_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_062914744.1|209881_210922_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007448.1|210944_211400_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054787.1|211422_212580_-	TerD family protein	NA	NA	NA	NA	NA
WP_042634303.1|212579_213161_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001035162.1|213484_214543_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001285478.1|214552_215695_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001040059.1|215687_216461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042634304.1|216462_217542_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_000797366.1|217541_218498_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506887.1|218508_219717_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|219734_220202_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_001388628.1|220664_221303_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|221325_221967_+	TerD family protein	NA	NA	NA	NA	NA
WP_001253658.1|221966_222605_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|222690_223731_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000081622.1|223730_225368_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001284313.1|225393_226893_+	kinase	NA	NA	NA	NA	NA
WP_001232449.1|227059_228142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285422.1|228502_228715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000795947.1|228885_230061_+|integrase	tyrosine-type recombinase/integrase	integrase	B3Y8R6	Escherichia_phage	26.9	4.2e-16
WP_162783861.1|230082_231174_-	PAP2 family protein	NA	NA	NA	NA	NA
WP_170386723.1|232254_233226_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
233128:233141	attR	CAGTGCTTTGGCAA	NA	NA	NA	NA
WP_170386723.1|234137_235109_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
>prophage 3
NZ_CP017632	Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence	369298	290657	346297	369298	transposase	Salmonella_phage(27.78%)	57	NA	NA
WP_001300563.1|290657_291770_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_075362746.1|291859_292198_-	pili assembly chaperone	NA	NA	NA	NA	NA
WP_170386723.1|292160_293132_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_000594612.1|294433_295309_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	43.0	2.1e-60
WP_001065779.1|295785_296841_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	31.2	1.1e-12
WP_000594931.1|296858_297059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046788421.1|297055_297772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970403.1|298006_298861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|298980_300003_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|300002_300782_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_075362747.1|300825_301641_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	38.3	2.2e-43
WP_075362748.1|302010_303174_+	DNA-binding protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.0e-17
WP_042634269.1|303421_305113_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	31.0	7.6e-67
WP_000070863.1|305109_305286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502497.1|305334_305796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000535422.1|305776_306058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046788420.1|306115_306712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152919722.1|306727_307956_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	1.2e-170
WP_001572417.1|308450_310907_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_000159529.1|312014_313103_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	50.6	2.4e-82
WP_000681217.1|315100_317521_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_000491822.1|317985_318573_-	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	71.1	1.1e-09
WP_000149861.1|318617_318881_-	hypothetical protein	NA	M9UXL5	Escherichia_phage	46.5	3.2e-09
WP_001167416.1|318974_319736_-	methyltransferase	NA	A0A2I7RNS1	Vibrio_phage	32.9	1.2e-19
WP_000277497.1|319816_320581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000803860.1|320901_321069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000694550.1|321141_323532_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_000170638.1|323966_324437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581857.1|324486_324783_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	35.1	3.2e-05
WP_000853477.1|326380_326758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133498.1|326852_327281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001290637.1|327345_327603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833773.1|327758_328367_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	39.8	5.4e-23
WP_000104323.1|328535_329786_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_001426334.1|330066_330213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000556022.1|330628_330955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042634392.1|331020_331278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046788417.1|331504_332296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000182314.1|332347_332797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000469466.1|332969_335354_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_001180999.1|335603_335843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829241.1|335905_337119_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000172889.1|337218_337530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159618.1|337526_337715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000241454.1|337775_338309_+	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	65.2	2.6e-45
WP_000280722.1|338423_339032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276410.1|339259_339487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133831.1|339666_339987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165367.1|340502_340814_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001424592.1|340818_341310_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_000781545.1|341862_342066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|342120_342345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000814954.1|342384_342585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001424621.1|342807_343119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000703843.1|343493_343775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000137793.1|343990_344596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087522250.1|344928_346297_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
>prophage 1
NZ_CP017633	Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence	120528	0	61946	120528	transposase,integrase,protease	Escherichia_phage(42.11%)	60	3525:3584	41987:42807
WP_001067858.1|0_705_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_015387340.1|1126_2002_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_013023839.1|2048_2525_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
3525:3584	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|3576_4281_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|4666_5083_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|5087_5606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839978.1|5605_6394_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049824851.1|6413_6884_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_001067855.1|6893_7598_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000105383.1|8421_9858_+	glutathione synthase	NA	NA	NA	NA	NA
WP_072657327.1|10525_11092_-	replication initiation protein	NA	NA	NA	NA	NA
WP_001067855.1|11178_11883_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063865358.1|12189_13365_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA2	NA	NA	NA	NA	NA
WP_058914901.1|13388_16541_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_000888203.1|16610_17090_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|17178_17883_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000572405.1|18189_18984_-	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
WP_000957857.1|20562_20751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072648941.1|20760_21960_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000220561.1|22456_22738_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
WP_000121743.1|22727_22979_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_024129959.1|24213_25053_+	replication initiation protein	NA	NA	NA	NA	NA
WP_000435064.1|25073_25916_+	replication initiation protein	NA	NA	NA	NA	NA
WP_001074384.1|25919_26366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024129958.1|26502_26856_+	DNA distortion protein 3	NA	NA	NA	NA	NA
WP_001282653.1|28318_29074_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_023181050.1|29090_30626_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_000957857.1|31195_31384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|31613_31718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|31846_32104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|32161_32938_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|32934_33678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|33728_34079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246635.1|34758_35754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991830.1|35757_36690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952231.1|36987_38076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000253407.1|38077_38947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741348.1|39003_40569_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001261287.1|40876_41107_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|41289_41994_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|43890_44895_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
41987:42807	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCAGCTGCGGGCCGCTCCCGCCGCGAAGGACGTGCTCGACGCCATCGAGGTGCTGCGCGGCATGAACAGCGACAACGCCCGCAAGGTGCCCGCCGACGCGCCGACCGAGTTCATCAAGCCGCGCTGGCAGAAGCTGGTCATGACCGACACCGGCATCGACCGGCGCTACTACGAACTGTGCGCGCTGTCGGAGATGAAGAACGCGTTGCGTTCCGGCGACATCTGGGTGCAGGGGTCGCGCCAGTTCAAGGACTTCGAGGACTACCTGGTGCCGCCCGCGAAATTCGCCAGCCTCAAGCAGGCCAGCGAATTGCCGCTGGCCGTGGCCACCGACTGCAACCGGTACCTGAACGACCGGCTGACGCTGCTGGAAACACAGCTTGCCACCGTCAACCGTATGGCGACGGCCAACGAGCTGCCGGACGCCATCATCACCGAGTCAGGCTTGAAGATCACGCCGCTCGACGCGGCGGTACCCGACACCGCCCAAGCGCTGATCGACCAGACGGCAATGATCCTGCCGCACGTCAAGATCACCGAACTGCTGCTGGAGGTGGACGAATGGACGGGCTTCACTCGGCATTTCGCGCATCTGAAATCGGGCGACCCGGCCAAAGACAAGAACCTGTTGCTGACCACGATCCTCGCCGACGCGATCAACCTGGGCCTGACCAAGATGGCGGAGTCTTGCCCCGGCACGACCTACGCCAAGCTGGCTTGGCTGCAAGCCTGGCACATCCGCGACGAAACCTACGGGGCGGCG	NA	NA	NA	NA
WP_000954592.1|45076_45253_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|45582_46398_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|46458_47262_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|47261_48098_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_058914914.1|48403_48649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001493764.1|48677_49328_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032153701.1|49433_50633_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|50899_51205_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023300759.1|51232_52447_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_021598067.1|52663_53548_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|53578_55072_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|55282_55507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|55503_56241_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|56726_56867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|56872_57577_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|58593_59298_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001398199.1|60608_61010_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|60942_61200_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|61292_61946_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
