The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	0	12639	5626623		Mycobacterium_phage(50.0%)	7	NA	NA
WP_009974147.1|2098_3298_+	DNA polymerase III subunit beta	NA	G8I4E4	Mycobacterium_phage	41.5	9.8e-69
WP_019733260.1|3298_4456_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_029248331.1|4452_4998_+	DUF721 family protein	NA	NA	NA	NA	NA
WP_009974152.1|5256_7290_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	43.1	1.1e-133
WP_011723278.1|7301_9821_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.6	1.1e-90
WP_011723279.1|9923_10787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080708731.1|11724_12639_+	site-specific DNA-methyltransferase	NA	R4JEL7	Mycobacterium_phage	28.5	1.3e-15
>prophage 2
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	22638	28808	5626623		Bodo_saltans_virus(25.0%)	7	NA	NA
WP_009974159.1|22638_23187_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	45.2	1.2e-24
WP_031344747.1|23198_23624_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_003872098.1|23779_24061_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_003876787.1|24191_24935_+	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_011723284.1|24983_25670_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	47.9	7.4e-45
WP_003872101.1|25647_27528_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2R3ZRI5	Marseillevirus	31.0	2.1e-17
WP_003872102.1|27524_28808_-	serine/threonine protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	28.9	2.5e-17
>prophage 3
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	41503	95905	5626623	tRNA,integrase,transposase	Corynebacterium_phage(18.18%)	46	52512:52529	95704:95721
WP_023863179.1|41503_43156_+|transposase	DDE transposase	transposase	Q9MBP7	Staphylococcus_prophage	23.0	1.1e-09
WP_011723301.1|44296_44626_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_019732544.1|44612_45605_-	pirin family protein	NA	NA	NA	NA	NA
WP_019732545.1|45610_46993_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_009974199.1|47086_47503_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_019732546.1|47645_48434_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033720122.1|48430_49258_+	C40 family peptidase	NA	A0A1W6DXV0	Rhodococcus_phage	58.7	9.6e-23
WP_062886724.1|49306_49669_+	DUF4226 domain-containing protein	NA	NA	NA	NA	NA
WP_033726436.1|49784_51236_+	DUF4226 domain-containing protein	NA	NA	NA	NA	NA
WP_003874762.1|51286_51604_+	ESX-1 secretion-associated protein	NA	NA	NA	NA	NA
WP_009974204.1|51600_51912_+	DUF2694 family protein	NA	NA	NA	NA	NA
WP_033711889.1|52171_53824_+	DUF5631 domain-containing protein	NA	NA	NA	NA	NA
52512:52529	attL	ATGCGGTGCAAAGCGGCG	NA	NA	NA	NA
WP_009974208.1|53880_54198_+	DUF2710 family protein	NA	NA	NA	NA	NA
WP_033711886.1|54275_55049_-	TIGR03084 family protein	NA	NA	NA	NA	NA
WP_033711884.1|55106_56378_-	MFS transporter	NA	NA	NA	NA	NA
WP_003874756.1|56523_57129_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_003874755.1|57144_57486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033726441.1|57541_58606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062886453.1|58790_61700_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.9	5.6e-211
WP_033711881.1|61706_62378_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_009974218.1|62436_62940_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011723315.1|63006_63753_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-21
WP_033711878.1|63749_65558_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_019732191.1|65608_66349_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019732190.1|66467_67247_-	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_019732189.1|67263_68178_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_075362169.1|69413_70217_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_075362170.1|70218_71388_-	sulfotransferase	NA	NA	NA	NA	NA
WP_033711873.1|71384_72512_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003874739.1|72643_73750_-	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	42.2	1.2e-73
WP_003874738.1|73809_74352_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062886452.1|74498_75383_-	DUF1707 domain-containing protein	NA	NA	NA	NA	NA
WP_003874736.1|75498_75942_+	DUF5318 domain-containing protein	NA	NA	NA	NA	NA
WP_062886451.1|75938_78572_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_019732043.1|78568_80206_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_003874732.1|80977_81268_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003874731.1|81385_81892_+	single-stranded DNA-binding protein	NA	A0A2H4JEL4	uncultured_Caudovirales_phage	86.1	3.2e-53
WP_003874730.1|81933_82188_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_019732041.1|82218_82677_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_031344718.1|83207_85835_+	replicative DNA helicase	NA	O80281	Escherichia_phage	35.7	2.6e-29
WP_075362171.1|86521_86830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075362172.1|88698_89802_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K1Y646	Mycobacterium_phage	29.0	3.6e-09
WP_075362173.1|89886_90588_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	52.0	3.4e-45
WP_031349784.1|90865_92113_+|transposase	IS256-like element IS1601 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.9	9.8e-80
WP_011725525.1|92226_93459_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_031344705.1|94852_95905_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
95704:95721	attR	CGCCGCTTTGCACCGCAT	NA	NA	NA	NA
>prophage 4
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	101765	102332	5626623		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_009974289.1|101765_102332_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	53.4	4.5e-40
>prophage 5
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	119906	121139	5626623	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_011725525.1|119906_121139_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
>prophage 6
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	126150	133266	5626623		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_033711843.1|126150_127134_+	2-hydroxyacid dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	27.5	5.7e-14
WP_033711842.1|127231_127657_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_033720140.1|127793_129149_-	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003876342.1|129963_131295_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.5	6.9e-47
WP_019733193.1|131592_132168_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_009974331.1|132381_133266_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	31.2	3.6e-28
>prophage 7
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	138997	141524	5626623		Bacillus_virus(100.0%)	3	NA	NA
WP_023871525.1|138997_139798_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	6.6e-29
WP_011723364.1|139794_140760_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_085988234.1|140792_141524_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	29.2	2.2e-18
>prophage 8
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	145749	147078	5626623		Feldmannia_species_virus(100.0%)	1	NA	NA
WP_011723367.1|145749_147078_+	HAMP domain-containing histidine kinase	NA	B5LWN0	Feldmannia_species_virus	26.6	3.0e-10
>prophage 9
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	156573	161686	5626623	protease	Mycobacterium_phage(100.0%)	3	NA	NA
WP_033711828.1|156573_158235_+|protease	type VII secretion system ESX-2 serine protease mycosin MycP2	protease	A0A0A7HDD8	Mycobacterium_phage	36.1	2.5e-70
WP_033717491.1|158231_159818_+	type VII secretion protein EccE	NA	NA	NA	NA	NA
WP_050485424.1|159847_161686_+	type VII secretion system ESX-2 AAA family ATPase EccA2	NA	V5UQM2	Mycobacterium_phage	30.1	1.5e-47
>prophage 10
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	176406	177609	5626623		Morganella_phage(100.0%)	1	NA	NA
WP_033711122.1|176406_177609_-	DNA polymerase IV	NA	A0A1W6JNT0	Morganella_phage	32.9	8.4e-20
>prophage 11
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	184281	184905	5626623		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003872294.1|184281_184905_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.6	7.9e-38
>prophage 12
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	193320	194598	5626623	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_033719214.1|193320_194598_+|tRNA	serine--tRNA ligase	tRNA	A0A2I2L4X3	Orpheovirus	32.6	6.8e-52
>prophage 13
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	207294	208503	5626623		Streptococcus_phage(100.0%)	1	NA	NA
WP_003876945.1|207294_208503_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	44.8	1.0e-89
>prophage 14
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	214205	217488	5626623		Macacine_betaherpesvirus(66.67%)	3	NA	NA
WP_011723409.1|214205_215249_+	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	81.4	7.3e-153
WP_031344666.1|215410_216313_+	esterase family protein	NA	A0A2I6B2Q9	Macacine_betaherpesvirus	39.1	3.1e-43
WP_003872575.1|216477_217488_+	cutinase family protein	NA	A0A160DEA1	Gordonia_phage	27.7	4.5e-06
>prophage 15
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	231998	233231	5626623	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_011725525.1|231998_233231_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
>prophage 16
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	254411	255218	5626623		Staphylococcus_phage(100.0%)	1	NA	NA
WP_023866764.1|254411_255218_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.2e-09
>prophage 17
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	264792	267441	5626623	transposase	Pacmanvirus(50.0%)	2	NA	NA
WP_023871495.1|264792_265860_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.4	1.4e-13
WP_033725720.1|266253_267441_+|transposase	IS481 family transposase	transposase	S5WIU1	Leptospira_phage	30.4	9.9e-13
>prophage 18
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	270597	279367	5626623		Mycobacterium_phage(20.0%)	9	NA	NA
WP_003873402.1|270597_270753_+	hypothetical protein	NA	A0A1C9EH86	Mycobacterium_phage	54.9	1.2e-06
WP_003876976.1|270863_271568_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.9e-35
WP_095762070.1|271800_273213_+	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	28.5	9.3e-10
WP_023882196.1|273214_273700_-	lipoprotein LpqH	NA	NA	NA	NA	NA
WP_033720189.1|273841_275716_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.5	1.3e-136
WP_003876981.1|275725_276694_-	NADPH:quinone oxidoreductase family protein	NA	NA	NA	NA	NA
WP_010948797.1|276693_277317_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019732931.1|277297_278581_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_019732930.1|278602_279367_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.9e-17
>prophage 19
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	284331	285426	5626623		Planktothrix_phage(100.0%)	1	NA	NA
WP_033712860.1|284331_285426_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	5.3e-21
>prophage 20
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	288992	289451	5626623		Pandoravirus(100.0%)	1	NA	NA
WP_019732221.1|288992_289451_+	nucleoside deaminase	NA	S4VYT2	Pandoravirus	37.1	2.9e-05
>prophage 21
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	299892	301131	5626623		Hokovirus(100.0%)	1	NA	NA
WP_019732409.1|299892_301131_+	MBL fold metallo-hydrolase	NA	A0A1V0SGC6	Hokovirus	28.2	8.1e-26
>prophage 22
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	316257	317247	5626623		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_023861966.1|316257_317247_+	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	25.3	2.8e-21
>prophage 23
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	325079	325448	5626623		Streptomyces_phage(100.0%)	1	NA	NA
WP_003874419.1|325079_325448_-	hypothetical protein	NA	A0A2D1GP18	Streptomyces_phage	50.5	5.9e-17
>prophage 24
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	333208	334192	5626623		Cowpox_virus(100.0%)	1	NA	NA
WP_003873385.1|333208_334192_-	NAD-dependent epimerase/dehydratase family protein	NA	Q0NPR0	Cowpox_virus	33.6	8.7e-07
>prophage 25
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	346028	349139	5626623		Bacteriophage(50.0%)	2	NA	NA
WP_033720184.1|346028_347867_+	DNA polymerase III subunits gamma/tau	NA	A0A1L2BWV7	Bacteriophage	31.4	3.9e-40
WP_003877009.1|347876_349139_-	methyltransferase domain-containing protein	NA	A0A2K9L4K8	Tupanvirus	33.0	6.1e-37
>prophage 26
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	381729	382194	5626623		Bacillus_phage(100.0%)	1	NA	NA
WP_003873336.1|381729_382194_+	GatB/YqeY domain-containing protein	NA	A0A218KC79	Bacillus_phage	35.6	2.6e-09
>prophage 27
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	410157	413438	5626623		Tsukamurella_phage(50.0%)	5	NA	NA
WP_009974690.1|410157_410508_+	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	50.0	3.0e-10
WP_009974691.1|410570_411713_-	ArsA family ATPase	NA	NA	NA	NA	NA
WP_003873303.1|411709_412732_-	ArsA family ATPase	NA	NA	NA	NA	NA
WP_003873302.1|412799_412961_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_009974693.1|412961_413438_+	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	31.5	1.1e-15
>prophage 28
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	418051	423679	5626623	protease,holin	uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_003877060.1|418051_419245_+|protease	acid resistance serine protease MarP	protease	A0A1B1IRH0	uncultured_Mediterranean_phage	25.0	2.6e-05
WP_011723569.1|419237_420203_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009974700.1|420203_420743_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_011723570.1|420963_421635_+	peptidase	NA	NA	NA	NA	NA
WP_033712049.1|421726_423679_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.4	5.8e-87
>prophage 29
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	427838	429485	5626623		Planktothrix_phage(100.0%)	1	NA	NA
WP_033712047.1|427838_429485_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	2.8e-13
>prophage 30
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	437734	445957	5626623		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_033720224.1|437734_440065_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.1	5.1e-05
WP_003419650.1|440313_440517_+	cold shock protein CspA	NA	A0A1X9IGI9	Lactococcus_phage	56.2	2.0e-14
WP_003877078.1|440705_441296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033720225.1|441500_444299_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	30.5	1.6e-98
WP_010948854.1|444295_445957_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	32.8	8.4e-18
>prophage 31
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	449241	454190	5626623		Tupanvirus(25.0%)	6	NA	NA
WP_011723619.1|449241_450183_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	35.1	4.1e-38
WP_003873266.1|450179_450521_-	DUF2304 domain-containing protein	NA	NA	NA	NA	NA
WP_023900353.1|450517_451219_-	glycosyltransferase family 2 protein	NA	A0A0N9P7Z4	Sulfolobales_Virus_YNP2	30.8	3.3e-08
WP_033720233.1|451254_452505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003873263.1|452632_453721_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	41.0	4.0e-53
WP_009974729.1|453701_454190_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	45.1	7.3e-31
>prophage 32
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	457726	458383	5626623		Hokovirus(100.0%)	1	NA	NA
WP_003873258.1|457726_458383_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	26.4	2.2e-06
>prophage 33
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	466601	470455	5626623	protease	Bathycoccus_sp._RCC1105_virus(33.33%)	3	NA	NA
WP_003877098.1|466601_469001_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	44.9	4.3e-108
WP_003877099.1|469017_469632_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	53.9	6.6e-45
WP_033713047.1|469651_470455_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	33.3	5.6e-20
>prophage 34
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	476700	481550	5626623	tRNA,protease	Tupanvirus(33.33%)	3	NA	NA
WP_023900339.1|476700_478200_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	36.6	2.6e-74
WP_033720243.1|478343_478682_+	Lsr2 family protein	NA	A0A2D1GPL8	Mycobacterium_phage	40.7	4.6e-16
WP_019684762.1|479018_481550_+|protease	ATP-dependent protease ATP-binding subunit ClpC	protease	K4FB40	Cronobacter_phage	39.7	1.0e-128
>prophage 35
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	495022	498300	5626623	tRNA	Catovirus(50.0%)	3	NA	NA
WP_019733296.1|495022_496429_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	26.2	1.1e-42
WP_019733295.1|496429_497359_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_033713102.1|497406_498300_+	glycerophosphodiester phosphodiesterase	NA	M1HHE5	Acanthocystis_turfacea_Chlorella_virus	25.6	1.5e-10
>prophage 36
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	502445	507064	5626623		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_003875641.1|502445_503687_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	27.5	1.5e-16
WP_085989671.1|503697_504561_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_019733384.1|504614_505373_-	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_003875644.1|505382_506243_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_009974767.1|506242_507064_-	metal ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	24.9	5.1e-08
>prophage 37
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	524316	525846	5626623		Hepacivirus(100.0%)	1	NA	NA
WP_033720255.1|524316_525846_-	fatty acid--CoA ligase family protein	NA	Q75ZG1	Hepacivirus	27.6	8.5e-41
>prophage 38
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	535622	536528	5626623		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_019733909.1|535622_536528_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.7	5.0e-09
>prophage 39
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	546712	547762	5626623	integrase	Gordonia_phage(100.0%)	1	539185:539200	549125:549140
539185:539200	attL	ACACCCGGCTGCGCAA	NA	NA	NA	NA
WP_007172498.1|546712_547762_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_007172498.1|546712_547762_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
549125:549140	attR	ACACCCGGCTGCGCAA	NA	NA	NA	NA
>prophage 40
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	553941	554856	5626623		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_033720262.1|553941_554856_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	35.5	5.8e-37
>prophage 41
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	564331	628840	5626623	integrase,transposase	Gordonia_phage(28.57%)	59	605615:605632	633705:633722
WP_085989547.1|564331_565592_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.5	7.2e-70
WP_158514284.1|565547_565706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033720265.1|565722_566718_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_033720266.1|566784_567816_+	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011723678.1|567914_568595_-	acetoacetate decarboxylase family protein	NA	NA	NA	NA	NA
WP_003875704.1|568679_569900_+	cytochrome P450	NA	NA	NA	NA	NA
WP_019732587.1|570014_570887_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_003875706.1|571090_571903_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_033720269.1|571967_573608_+	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	24.0	9.1e-17
WP_009974821.1|573617_574385_+	phosphotransferase	NA	NA	NA	NA	NA
WP_011723681.1|574407_575235_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011723682.1|575231_576782_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.1	1.9e-08
WP_023363545.1|577141_577531_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_086361399.1|577566_578025_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007172498.1|579908_580958_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_007172497.1|580954_582898_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_075362366.1|583201_583951_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_023363549.1|583986_584556_-	TIGR03086 family protein	NA	NA	NA	NA	NA
WP_158295085.1|584731_585253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023363553.1|585442_586075_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_158295084.1|586287_589164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050485430.1|589592_590621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023363419.1|590683_591598_-	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_023363421.1|591599_592382_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_023363423.1|592722_592971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023363425.1|593074_593965_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_023363427.1|594191_594665_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_023363428.1|594898_595462_+	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_046188119.1|595520_596201_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023363431.1|596205_596841_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_033718872.1|596834_597068_-	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_033718784.1|597252_598146_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_023363435.1|598228_599173_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033718877.1|600571_600847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023363441.1|600833_601484_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_023363443.1|601616_602153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079457954.1|603488_604391_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.1	1.0e-22
WP_023363448.1|604329_605154_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_075362184.1|605150_606056_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
605615:605632	attL	GATCGACGCCGGCATCCT	NA	NA	NA	NA
WP_023363451.1|606763_607012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023363452.1|607402_607738_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_023363454.1|607749_608073_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_023363456.1|608228_608858_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033718792.1|608949_609435_+	peroxiredoxin family protein	NA	NA	NA	NA	NA
WP_023363460.1|609556_609979_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_023363462.1|610234_610816_+	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_023363464.1|610876_611743_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_023363468.1|611934_612687_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.9	1.9e-17
WP_041803502.1|613662_613971_-	MPT51 antigen	NA	NA	NA	NA	NA
WP_007172497.1|614520_616464_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007172498.1|616460_617510_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_023363473.1|619201_620545_+	MCE family protein	NA	NA	NA	NA	NA
WP_079457956.1|620547_621705_+	virulence factor Mce family protein	NA	NA	NA	NA	NA
WP_023363477.1|621707_623156_+	MCE family protein	NA	NA	NA	NA	NA
WP_023363479.1|623388_624393_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_023363483.1|625062_626049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023363485.1|626045_626564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023363488.1|627398_627755_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033717393.1|627937_628840_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
633705:633722	attR	AGGATGCCGGCGTCGATC	NA	NA	NA	NA
>prophage 42
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	649618	650323	5626623		Planktothrix_phage(100.0%)	1	NA	NA
WP_050485431.1|649618_650323_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	1.2e-13
>prophage 43
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	663206	676683	5626623	transposase	Bacillus_phage(33.33%)	11	NA	NA
WP_033719089.1|663206_665066_+	hypothetical protein	NA	A0A0N9QAZ1	Chrysochromulina_ericina_virus	27.5	5.0e-19
WP_011725525.1|665916_667149_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_003875751.1|669168_669885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003875752.1|670043_670763_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	1.4e-33
WP_003875753.1|670803_672240_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	7.0e-21
WP_009974878.1|672227_672632_-	HIT family protein	NA	NA	NA	NA	NA
WP_003875755.1|672666_673089_-	NTF2 domain-containing protein	NA	NA	NA	NA	NA
WP_003875756.1|673158_674286_-	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	7.1e-29
WP_003875757.1|674553_675102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003875758.1|675105_675315_-	ferredoxin	NA	NA	NA	NA	NA
WP_009974879.1|675327_676683_-	cytochrome P450	NA	M1PWN0	Moumouvirus	27.4	7.3e-12
>prophage 44
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	691933	694983	5626623		Mollivirus(50.0%)	2	NA	NA
WP_009974902.1|691933_692824_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	36.4	6.4e-41
WP_011723721.1|692820_694983_+	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	29.4	9.5e-30
>prophage 46
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	766942	868269	5626623	integrase,transposase	Corynebacterium_phage(47.37%)	56	805386:805445	870476:872741
WP_011725525.1|766942_768175_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_007172497.1|770102_772046_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007172498.1|772042_773092_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_007172267.1|774742_775666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033721575.1|777421_778438_+	diiron oxygenase	NA	NA	NA	NA	NA
WP_007172270.1|778650_779514_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_075362367.1|780143_780950_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_007172273.1|781019_781889_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_007172274.1|781860_783489_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007172275.1|783485_784439_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_019733492.1|784893_786360_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_007172276.1|786518_786926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172277.1|787205_787493_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_007172278.1|787519_787972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050485493.1|787959_789081_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_031349784.1|789254_790502_-|transposase	IS256-like element IS1601 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.9	9.8e-80
WP_033725840.1|790532_791711_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	53.7	2.3e-107
WP_094494180.1|791839_792952_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.2	1.0e-67
WP_057969464.1|793156_794050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132160400.1|796909_797980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019733492.1|798103_799570_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_007172498.1|801833_802883_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_007172497.1|802879_804823_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
805386:805445	attL	GGTCACGTCCCGTGGAGTGGTGTAAGAGCGGTCGCGTGTCCGCGTGTGGCTCTGTGGTAG	NA	NA	NA	NA
WP_011725525.1|808273_809506_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_007172264.1|812905_814450_-	MCE family protein	NA	NA	NA	NA	NA
WP_033721559.1|814455_815583_-	virulence factor Mce family protein	NA	NA	NA	NA	NA
WP_007172262.1|815585_817100_-	virulence factor Mce family protein	NA	NA	NA	NA	NA
WP_007172261.1|817096_818662_-	MCE family protein	NA	NA	NA	NA	NA
WP_007172260.1|818658_819702_-	MCE family protein	NA	NA	NA	NA	NA
WP_007172259.1|819698_820916_-	MCE family protein	NA	NA	NA	NA	NA
WP_033721558.1|820922_821792_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_085981747.1|821794_822508_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_095764629.1|822585_823419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011725525.1|825883_827116_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_033717226.1|827620_828703_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	29.9	5.5e-10
WP_011725525.1|830012_831245_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_007172255.1|834984_835692_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007172254.1|836001_836451_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_007172252.1|836803_837583_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_131727298.1|837456_837981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075362171.1|838874_839183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075362192.1|839179_841105_-|integrase	tyrosine-type recombinase/integrase	integrase	G8C7K6	Escherichia_phage	26.8	6.5e-06
WP_075362172.1|841052_842156_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K1Y646	Mycobacterium_phage	29.0	3.6e-09
WP_033717226.1|843127_844210_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	29.9	5.5e-10
WP_047324300.1|844218_846465_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007172469.1|846454_846916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172240.1|848870_850436_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_080691069.1|850482_851289_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_007172237.1|851510_851834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172236.1|852166_853405_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.6	1.9e-06
WP_011725525.1|855408_856641_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_011725525.1|857427_858660_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_075362194.1|859018_859921_+	hypothetical protein	NA	A0A2P1JQX9	Mycobacterium_phage	70.4	1.6e-100
WP_007172497.1|860189_862133_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007172498.1|862129_863179_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_007172498.1|867219_868269_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
870476:872741	attR	CTACCACAGAGCCACACGCGGACACGCGACCGCTCTTACACCACTCCACGGGACGTGACCAGAAGGTCCGCGCCGCAACGCATCTGCGTGCCACAACGTGTTCTGACCACTTCACTTCCTAGTGAAAGAGGACCGGCATCGTCCTAGCCTTCCCCAAGGACCGTTATTGCCAAACGCAAGCTCGGCTGTCACTGGGGGACTGCACCCCACCGAGATAGTCCCAGAGGGAAATGAGTAGTTTCATGCGAACCCGAAGGTCGGCATCGATCGATGCGGCAGCGCACTTTGTGTGCGAGATCGCCGTGTCGCTACCGTGGTCCGGGTCGCGCGTGCAGCTGGGAGGCCGGAGGCATATTGGGCGGGGCGCAATGCTTGATGAGATCATCGACGTTCTGTCCGACCCGCTCAGGCGCGGTACCTACCGACGGTGGGTAGAGCATGATGTGGTCTAGCACGCCCTCGTAGCGGCGTAGCCCGTTGCGAACCTCGTCAGCGGTGCCGGCGACACCCATGACGTCGATCATGTCATCGGTGACGGCGTTGAACATGGCCTGAAAGTCGCTGCGGGTGAAGGCTTCTCGGATGACGGCACCCTGCTTGGCGAATCCGCAGAAGTCGAGCAGCGGTTCGTAGGTCCTGACCGAGGCGTAGAATGCGATCTGCTGCGCTACCTCGCGACGAGCGATCTCGGGGTCGTCGTGGATGGAGCACATCACCATCGACACGATCTCGACGCCGTTAGGGTCGCGCCCGGTGCGTTGTGCGCCCTTGGCCACCGCAGGCCGCACGACTTCCTCCACATACGCGGTGGTGAAGAGTGGATGCCCGGCCAAGCCGTCAGCGACCCGTCCGGCGGCTTCACACATTCGCGGCCGCACGGCGGCGGTGACGATGGGGATATTGCGCGCAGGGGGTTCTACCGGCCCGGTGGGGACGAGATTCATATTGTAGAAACGGCCCTCATGGCGGACGGGTCCTTCGTGCAGGTTCCAGATGCGCCGGATAAGGGGTACGAGTTCCTCGACGCGCAGGGCGGGGGCGCTGGTATCGGTGACAGAGTGCCAATCGCTCATCATCCGTTTGGTGCCGTTGCCGATCCCGAGCACGACCCGACCACCGGACAGTTCGTCGAGGTCGCGTGTTTCGGTCGCCAAGACCAGCGGACTACGTCCGATGCCGTAGAGGATTGACGACCCGATGCGACACCTGTTCGTCGAGGTTGCCATCGCCGCCATCGAGATGGATCCCGACCGGGTGTAGAACTCGGATGCCCAGACGGCGTCGAACCCGGCCTGGTCGGCAGCCGCGGCGGTGGCCTTCATCGCGGCAAGTTCAGGGGCGACGACTGAAAGTCCATAAGTACTCATAAGTGACGGCTCCATCGTGTGGTAGGTGACAGACGGTGTCAGCGGCTAGTTGACCCGAAGGCGAAAGCCCATCGCCGCCGACAGCAAGCAGGTGTGTCAGCGTTGCCTCAGGACCGCGGTCTCAGTCCTCGACGGCGAGAGCGCCTGTGGGGCAGCACGATACTGCTTCTTCGATGAGTGATCTGTGGCATTCCGGTGGCTCGGGGTTCACGATATTGAGTTGGCCATCGTGCCTGACCTCGAAGAAGTCAGGAGCCAGGCCTTCACACATTCCGATTGACGAGCATCGGTTGCGGTCGACTCTGATCTTCATACCACGCCGCCTTACGCGTTCGGGGTGAAGCGGACGGGAAGGTGATTCACGCCGTGGAAGAACGTGCTGACGGTGTAGCTGGGTGGCCCGCAGACTTCAATATCAGGCAGGCGGTGCAGCAGTTCTCTGAAGAGCGCAGCGAGTTGCTGCCTGGCCAGCTGGTTGCCGAGGCAGTGATGGATTCCCCCGCCTCCGAAGCTCACGTGCGGGTTAGGGTCGCGCGACAGATCGAACTTCTCCGGGTTAGTGAACACGGTGGTGTCCCAGTTGGCCGAGCTGTAGAAAAGTATGATCTTGTCACCCTCGGTGATCTGCTGCCCGCCCAGTTCGCAGTCGCGAGCCGCCGTCCGGCGAAATGTCATGATTGGTGTGGCCCACCGGACGAATTCTTCCACGGCCCCTTTGATCCGTCCGTCGAAATCCTCCATGAGCCAAGCTCTTTGGTCTGGGAAGTCCGTCAATGCTTTCATCGCGTGACTGGTGCTTTGGCGCGTGGTGTCGTTCCCGGCGATCGTGAGAAGTATGAAAAACGAGACGATCTCGTCGTCGGTGAGTTGTTCGCCGTCCACTTCAGCTTGAACGAGGT	NA	NA	NA	NA
>prophage 47
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	877527	879081	5626623		Staphylococcus_phage(100.0%)	1	NA	NA
WP_007172224.1|877527_879081_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.2	1.4e-35
>prophage 48
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	883167	885654	5626623		Staphylococcus_phage(50.0%)	2	NA	NA
WP_007172220.1|883167_884715_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.6	9.4e-48
WP_157679851.1|885108_885654_-	hypothetical protein	NA	A0A2P1JQX9	Mycobacterium_phage	61.8	6.7e-41
>prophage 49
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	897505	1034965	5626623	integrase,transposase	Corynebacterium_phage(39.13%)	87	923318:923377	1032739:1033226
WP_046187320.1|897505_898780_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	48.2	2.2e-98
WP_019733492.1|899451_900918_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_033721600.1|902490_903501_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007172563.1|904108_904528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172205.1|907496_907661_-	DUF5078 domain-containing protein	NA	NA	NA	NA	NA
WP_007172204.1|907909_908551_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033717419.1|909496_912442_+	RND family transporter	NA	NA	NA	NA	NA
WP_033717417.1|912438_913335_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007172201.1|913449_913896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088295654.1|913980_914583_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033717415.1|915011_915611_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031349784.1|916268_917516_+|transposase	IS256-like element IS1601 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.9	9.8e-80
WP_011725525.1|919228_920461_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_007172497.1|921373_923317_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
923318:923377	attL	TGCCGGGCTCCGGCCAACGTCGCACGAGCAGCACCGTATTCGGCGGCGAGCTGCTCGATC	NA	NA	NA	NA
WP_011725525.1|923868_925101_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_085981753.1|925482_926250_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.2	1.2e-32
WP_079669096.1|926288_927797_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_033721569.1|930069_931578_-	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	32.8	8.1e-28
WP_033721570.1|931710_932607_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007172283.1|932659_933100_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_033721572.1|933148_933793_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007172286.1|933916_935410_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_007172287.1|935406_936504_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_007172600.1|936546_937755_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_007172288.1|938025_938571_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_085978347.1|943227_944498_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	50.4	1.2e-53
WP_011725525.1|945271_946504_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_081385942.1|946539_947592_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_007172563.1|947588_948008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172294.1|948112_949306_-	cytochrome P450	NA	NA	NA	NA	NA
WP_033717422.1|949371_949953_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019733492.1|950254_951721_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_033717424.1|952427_953051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087139652.1|953035_953647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172298.1|954337_955414_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007172299.1|955410_955734_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007172300.1|955874_957002_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_023870547.1|957274_958492_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.0	1.1e-14
WP_023861565.1|958491_959304_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	41.7	4.5e-49
WP_047324308.1|960775_962287_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.0	3.0e-54
WP_007172498.1|964507_965557_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_007168413.1|967954_968908_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011725525.1|970662_971895_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_007168407.1|975397_975790_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_007168406.1|975789_976065_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_007168405.1|976217_977090_-	dehydrogenase	NA	NA	NA	NA	NA
WP_138017752.1|977928_978060_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_033712837.1|980947_982090_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_085981616.1|982138_983755_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.5	1.6e-26
WP_007168400.1|983787_984444_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_033712835.1|984440_985898_-	cytochrome P450	NA	NA	NA	NA	NA
WP_007168397.1|986075_987044_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007168396.1|987040_988564_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007168395.1|988638_990285_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_007168394.1|990281_991205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007168393.1|991223_992060_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023900852.1|992194_992863_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046184162.1|992889_993567_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011725525.1|993760_994993_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_075362371.1|995048_995963_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_033717470.1|996155_997172_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_074021704.1|997304_997496_-	ferredoxin	NA	NA	NA	NA	NA
WP_007168386.1|997507_998809_-	cytochrome P450	NA	NA	NA	NA	NA
WP_085981614.1|998896_999526_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007168383.1|1000233_1001682_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.6	4.4e-55
WP_019732564.1|1002211_1002427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007168381.1|1002474_1003371_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007168380.1|1003423_1003864_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_075362205.1|1003913_1004558_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046186891.1|1004618_1005065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172497.1|1006281_1008225_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007172498.1|1008221_1009271_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_007168415.1|1011989_1012526_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_085989547.1|1012827_1014089_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.5	7.2e-70
WP_007172498.1|1016250_1017300_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_007172497.1|1017296_1019240_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_158514285.1|1019603_1019819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080711236.1|1019757_1020003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075362207.1|1019978_1020290_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_031349784.1|1021601_1022849_-|transposase	IS256-like element IS1601 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.9	9.8e-80
WP_047324308.1|1023083_1024595_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.0	3.0e-54
WP_011725525.1|1025567_1026800_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_007168486.1|1028994_1029336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007168487.1|1029356_1029764_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_033711258.1|1029767_1030040_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_007172497.1|1030794_1032738_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_094494180.1|1033852_1034965_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.2	1.0e-67
1032739:1033226	attR	TGCCGGGCTCCGGCCAACGTCGCACGAGCAGCACCGTATTCGGCGGCGAGCTGCTCGATCGACAAATGCACGTAGCGGGCCGTGGTCTCCGGCGAGACATGCCCCATCAACGCCCGCAACGCCAGCAGATCGATTCCGGCCGCCGACAATTCGGTGCCGTAGGTATGCCGTAAACGGTGCGGGCGGACTCTTGTGGCGCCAGAGGTCTCCCGGTGCCGACGGAACAGGCTGCGCAGCCCGGCCTCGCTGACCGGTGCACCGGTCGTCGGGCCGCGCAGCACTACGAAGCACTGCGGCGTCGCCAACCCCGGCGGCCGCTCCCATCGCAGGTAGGCGGCGAGCTCGGTGAAGAACGCCGCATCGACCGGGACATGACGTTCCTTGCCGCCCTTGCCGATCACCCGAAGCCGGCGCCGGCCCATATCGACGTCGGCGAGCAGCAGGCCACGCGCCTCGGCCGAACGCAGCCCTCCGAGTAGCATCACCAG	NA	NA	NA	NA
>prophage 50
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1042821	1043025	5626623		Lactococcus_phage(100.0%)	1	NA	NA
WP_003873070.1|1042821_1043025_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.1	1.5e-17
>prophage 51
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1051434	1053301	5626623		Synechococcus_phage(50.0%)	2	NA	NA
WP_003877228.1|1051434_1051773_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A222YX16	Synechococcus_phage	28.9	3.3e-06
WP_033717365.1|1051897_1053301_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	27.0	3.2e-34
>prophage 52
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1063000	1064617	5626623		Lactobacillus_phage(100.0%)	1	NA	NA
WP_023900248.1|1063000_1064617_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	28.2	5.1e-28
>prophage 53
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1068901	1070629	5626623		Lactobacillus_phage(100.0%)	1	NA	NA
WP_023900245.1|1068901_1070629_+	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	24.1	5.4e-20
>prophage 54
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1076416	1077223	5626623		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_019732835.1|1076416_1077223_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	3.1e-18
>prophage 55
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1127723	1128425	5626623		Escherichia_phage(100.0%)	1	NA	NA
WP_003877305.1|1127723_1128425_-	SDR family oxidoreductase	NA	I7B2R4	Escherichia_phage	34.1	3.8e-12
>prophage 56
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1152356	1156333	5626623		Tupanvirus(50.0%)	4	NA	NA
WP_023869696.1|1152356_1153832_+	fatty acid--CoA ligase family protein	NA	A0A2K9KZV5	Tupanvirus	21.6	6.9e-16
WP_033719011.1|1153828_1154455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003872942.1|1154465_1154651_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_075362214.1|1154647_1156333_-	alpha-keto acid decarboxylase family protein	NA	E4WLQ6	Ostreococcus_tauri_virus	20.4	2.0e-06
>prophage 57
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1170467	1172117	5626623		Acidianus_filamentous_virus(100.0%)	1	NA	NA
WP_019732158.1|1170467_1172117_-	DEAD/DEAH box helicase	NA	B2CRJ8	Acidianus_filamentous_virus	23.1	3.2e-17
>prophage 58
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1176265	1179825	5626623		Macacine_betaherpesvirus(50.0%)	5	NA	NA
WP_062887132.1|1176265_1177039_-	transglycosylase family protein	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	71.0	2.4e-04
WP_009975122.1|1177472_1177751_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_062886205.1|1177755_1178850_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_009975124.1|1178846_1179254_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_003872914.1|1179417_1179825_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	46.0	1.3e-09
>prophage 59
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1212105	1214478	5626623		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_033720313.1|1212105_1214478_+	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	26.6	1.0e-29
>prophage 60
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1229344	1230253	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_009975180.1|1229344_1230253_-	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	50.4	6.9e-67
>prophage 61
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1233592	1237665	5626623		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_033720318.1|1233592_1235086_-	mannitol dehydrogenase family protein	NA	E5EQS6	Micromonas_sp._RCC1109_virus	32.0	4.2e-53
WP_033725454.1|1235364_1237665_+	ATP-dependent DNA ligase	NA	A0A291AUP8	Sinorhizobium_phage	36.1	1.7e-37
>prophage 62
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1250677	1257122	5626623		Bacillus_phage(33.33%)	5	NA	NA
WP_011723921.1|1250677_1253002_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	37.2	4.5e-118
WP_003872834.1|1253075_1253666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011723922.1|1253667_1254720_-	M23 family metallopeptidase	NA	A0A2D1G842	Mycobacterium_phage	48.8	1.5e-20
WP_003872832.1|1255043_1256207_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_011723923.1|1256219_1257122_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L5E9	Tupanvirus	28.7	1.2e-13
>prophage 63
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1262510	1264738	5626623		Synechococcus_phage(50.0%)	2	NA	NA
WP_003872825.1|1262510_1263140_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.3	7.5e-20
WP_024636987.1|1263154_1264738_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	42.3	1.8e-54
>prophage 64
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1269023	1269872	5626623		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011723931.1|1269023_1269872_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.9	6.1e-57
>prophage 65
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1279545	1287224	5626623		Bacillus_phage(75.0%)	9	NA	NA
WP_003872811.1|1279545_1280232_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.3	4.8e-36
WP_019732008.1|1280248_1281817_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.3	1.1e-19
WP_011723940.1|1281899_1283366_+	PDZ domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	32.5	5.5e-05
WP_008254072.1|1283425_1283923_+	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_003872807.1|1283947_1284403_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_011723941.1|1284470_1285151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003872805.1|1285215_1285542_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_011723942.1|1285648_1286239_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003877502.1|1286315_1287224_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	40.1	2.3e-46
>prophage 66
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1300352	1301974	5626623		Synechococcus_phage(50.0%)	2	NA	NA
WP_075362216.1|1300352_1301369_+	GHMP kinase	NA	A0A222YW25	Synechococcus_phage	39.1	6.8e-55
WP_009975259.1|1301365_1301974_+	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	33.3	7.8e-14
>prophage 67
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1305257	1305875	5626623		Pacmanvirus(100.0%)	1	NA	NA
WP_009975264.1|1305257_1305875_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A1X6WG33	Pacmanvirus	29.4	7.7e-09
>prophage 68
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1309685	1310936	5626623		Pandoravirus(100.0%)	1	NA	NA
WP_033720327.1|1309685_1310936_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	41.3	3.9e-36
>prophage 69
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1317091	1317886	5626623		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_023900158.1|1317091_1317886_-	FkbM family methyltransferase	NA	E4WLN6	Ostreococcus_tauri_virus	34.7	8.3e-08
>prophage 70
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1324955	1326638	5626623		Catovirus(100.0%)	1	NA	NA
WP_023884539.1|1324955_1326638_+	GMC family oxidoreductase	NA	A0A1V0S9J5	Catovirus	45.3	1.1e-06
>prophage 71
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1344856	1348580	5626623	tRNA	Hokovirus(50.0%)	3	NA	NA
WP_019732441.1|1344856_1346416_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	40.0	2.3e-102
WP_011723968.1|1346435_1347290_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_019732437.1|1347491_1348580_+	resuscitation-promoting factor	NA	A0A1I9SA30	Rhodococcus_phage	63.5	9.0e-21
>prophage 72
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1355542	1356871	5626623		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_009975291.1|1355542_1355890_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	60.7	1.4e-31
WP_003877535.1|1355890_1356871_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.4	8.1e-45
>prophage 73
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1366749	1371423	5626623		Streptococcus_phage(50.0%)	6	NA	NA
WP_023873941.1|1366749_1368039_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	56.9	8.5e-135
WP_023873943.1|1368040_1368718_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003872730.1|1368710_1369199_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
WP_019732886.1|1369192_1370143_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003872728.1|1370346_1370655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003877545.1|1370742_1371423_-	response regulator	NA	W8CYM9	Bacillus_phage	30.5	3.8e-25
>prophage 74
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1374938	1377089	5626623		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_023869583.1|1374938_1377089_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.1	1.2e-27
>prophage 75
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1380654	1381428	5626623		Bacillus_phage(100.0%)	1	NA	NA
WP_033718675.1|1380654_1381428_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.1	1.6e-32
>prophage 76
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1391229	1392861	5626623		Catovirus(100.0%)	1	NA	NA
WP_031344293.1|1391229_1392861_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.0	2.2e-18
>prophage 77
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1406516	1409936	5626623		Streptococcus_phage(50.0%)	2	NA	NA
WP_003872698.1|1406516_1407923_+	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	41.4	5.0e-56
WP_003872696.1|1408769_1409936_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	31.2	1.1e-24
>prophage 78
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1415763	1416552	5626623		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003878551.1|1415763_1416552_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	36.7	5.4e-15
>prophage 79
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1419734	1425952	5626623		Aeromonas_phage(33.33%)	5	NA	NA
WP_031348075.1|1419734_1421015_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	48.8	2.9e-87
WP_011724007.1|1421102_1421930_+	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_009975376.1|1422149_1423451_+	PhoH family protein	NA	A0A2L0UZX2	Agrobacterium_phage	30.8	2.3e-23
WP_011724008.1|1423578_1424454_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011724009.1|1424518_1425952_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.2	1.3e-14
>prophage 80
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1431179	1435368	5626623		Moumouvirus(33.33%)	4	NA	NA
WP_011724013.1|1431179_1432724_+	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	35.2	1.5e-32
WP_009975382.1|1432720_1433821_-	NAD-dependent epimerase/dehydratase family protein	NA	Q76TT0	Molluscum_contagiosum_virus	33.0	2.4e-29
WP_003875383.1|1433882_1434131_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_009975385.1|1434120_1435368_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	52.6	4.0e-73
>prophage 81
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1439684	1440629	5626623		Pseudomonas_phage(100.0%)	1	NA	NA
WP_033720356.1|1439684_1440629_+	HNH endonuclease	NA	A0A125RNK0	Pseudomonas_phage	40.6	9.3e-06
>prophage 82
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1448373	1450273	5626623		Synechococcus_phage(50.0%)	2	NA	NA
WP_009975403.1|1448373_1449396_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	M1T2E7	Synechococcus_phage	53.8	3.2e-92
WP_003875404.1|1449409_1450273_-	alpha/beta hydrolase	NA	A0A0M4K6M8	Mollivirus	29.8	2.0e-07
>prophage 83
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1453732	1455415	5626623		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_075362220.1|1453732_1455415_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	37.6	2.5e-70
>prophage 84
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1468579	1469422	5626623		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_033720361.1|1468579_1469422_+	CbbQ/NirQ/NorQ/GpvN family protein	NA	A0A2H4N7N3	Lake_Baikal_phage	27.1	2.3e-11
>prophage 85
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1489280	1489994	5626623		Bacillus_phage(100.0%)	1	NA	NA
WP_019731812.1|1489280_1489994_-	NAD-dependent deacylase	NA	A0A068EPD4	Bacillus_phage	33.1	1.3e-20
>prophage 86
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1502011	1503628	5626623		Escherichia_phage(100.0%)	1	NA	NA
WP_003875456.1|1502011_1503628_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.5	1.1e-19
>prophage 87
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1511346	1513947	5626623		Mamastrovirus(100.0%)	1	NA	NA
WP_085989663.1|1511346_1513947_+	bifunctional FO biosynthesis protein CofGH	NA	A9ZMK9	Mamastrovirus	36.6	2.6e-18
>prophage 88
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1529796	1531745	5626623		Tupanvirus(100.0%)	2	NA	NA
WP_003875476.1|1529796_1530489_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.3	4.1e-27
WP_023868557.1|1530485_1531745_+	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	28.6	2.3e-28
>prophage 89
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1539270	1540233	5626623		Staphylococcus_phage(100.0%)	1	NA	NA
WP_009975530.1|1539270_1540233_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	30.5	4.2e-30
>prophage 90
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1551998	1553420	5626623		Hepacivirus(100.0%)	1	NA	NA
WP_009975544.1|1551998_1553420_+	acyl-CoA synthetase	NA	Q75ZG1	Hepacivirus	32.3	3.3e-31
>prophage 91
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1557009	1558161	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_011724080.1|1557009_1558161_+	PPE family protein	NA	V5UPR1	Mycobacterium_phage	32.6	1.5e-05
>prophage 92
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1573928	1579465	5626623	protease	Staphylococcus_phage(33.33%)	6	NA	NA
WP_011724088.1|1573928_1574873_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	3.3e-19
WP_009975569.1|1574862_1575501_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003875521.1|1575666_1576335_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_009975574.1|1576536_1577292_+	RNA polymerase sigma factor SigE	NA	A0A0F6TH34	Sinorhizobium_phage	31.0	2.5e-09
WP_019733172.1|1577408_1577810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011724091.1|1577950_1579465_+|protease	trypsin-like serine protease	protease	A0A1B1IRH0	uncultured_Mediterranean_phage	31.1	9.3e-08
>prophage 93
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1588890	1590069	5626623		Planktothrix_phage(100.0%)	1	NA	NA
WP_011724098.1|1588890_1590069_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	36.7	5.0e-25
>prophage 94
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1612404	1613148	5626623		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_023897558.1|1612404_1613148_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.8	4.0e-12
>prophage 95
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1617756	1620593	5626623		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	2	NA	NA
WP_011724115.1|1617756_1619457_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.5	2.8e-53
WP_011724116.1|1619453_1620593_+	acyltransferase	NA	C6ZR20	Salmonella_phage	25.5	4.9e-09
>prophage 96
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1628513	1632413	5626623		Bacillus_virus(100.0%)	1	NA	NA
WP_033724924.1|1628513_1632413_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	29.0	1.7e-05
>prophage 97
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1637022	1693975	5626623	integrase,transposase	Mycobacterium_phage(33.33%)	54	1672235:1672294	1694090:1695221
WP_033720400.1|1637022_1638837_-	protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	30.7	5.4e-18
WP_033725343.1|1639084_1640293_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011724128.1|1640399_1641545_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_011724129.1|1641654_1641987_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_011724130.1|1642133_1644050_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	2.9e-46
WP_011724131.1|1644046_1645804_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	1.7e-40
WP_003875581.1|1645985_1646543_+	DUF3558 domain-containing protein	NA	NA	NA	NA	NA
WP_003875582.1|1646539_1647109_+	DUF3558 domain-containing protein	NA	NA	NA	NA	NA
WP_011724134.1|1647135_1647639_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011724135.1|1647670_1649089_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_011724136.1|1649347_1650499_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_011724137.1|1650495_1653126_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011724138.1|1653189_1654434_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_009975665.1|1654420_1656097_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_011724139.1|1656107_1657943_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.5e-15
WP_024636893.1|1657939_1658815_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009975670.1|1658862_1659837_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009975672.1|1659985_1660477_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003875595.1|1660608_1660998_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_010949617.1|1661217_1662162_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_009975676.1|1662161_1664012_+	adenylyl-sulfate kinase	NA	A0A1Q1PNX7	Noumeavirus	26.0	2.0e-28
WP_009975678.1|1664070_1664556_+	RrF2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003877279.1|1664552_1664948_-	VOC family protein	NA	NA	NA	NA	NA
WP_011724141.1|1664999_1665413_-	VOC family protein	NA	NA	NA	NA	NA
WP_011724142.1|1665479_1666358_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009975682.1|1666419_1667292_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011724143.1|1667316_1669062_-	potassium transporter TrkA	NA	NA	NA	NA	NA
WP_009975685.1|1669155_1669527_-	steroid Delta-isomerase	NA	NA	NA	NA	NA
WP_044088653.1|1669586_1670156_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011724144.1|1670143_1670431_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_062908098.1|1670628_1671318_-	hypothetical protein	NA	A0A2D1GPL9	Mycobacterium_phage	46.4	4.5e-26
WP_011724145.1|1671439_1671946_+	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011725525.1|1672014_1673247_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
1672235:1672294	attL	AGTGGGTTGGTTGACCAGATCTTTTTCCAGTGGGCCACCGGGAAGTCGGCGAAGGCGGTG	NA	NA	NA	NA
WP_024637839.1|1673489_1673921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011724147.1|1673917_1674979_-	hypothetical protein	NA	G8I4U5	Mycobacterium_phage	39.2	8.5e-16
WP_011724148.1|1674978_1675272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033712867.1|1676639_1677875_-|transposase	IS256-like element IS1311 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	53.0	6.3e-111
WP_011724170.1|1677930_1678110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011724172.1|1679350_1680439_-	hypothetical protein	NA	G8I4U5	Mycobacterium_phage	39.8	5.1e-16
WP_011724148.1|1680438_1680732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024637324.1|1680979_1682143_+|integrase	site-specific integrase	integrase	G1JV00	Mycobacterium_phage	38.9	8.1e-68
WP_011724176.1|1682319_1682544_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_011724177.1|1682676_1684080_+	gp54 protein	NA	A0A0F6WEU1	Mycobacterium_phage	49.1	5.0e-88
WP_139807388.1|1684076_1685225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132160312.1|1685609_1686101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075362222.1|1686097_1686568_+	flagellar hook-length control protein	NA	NA	NA	NA	NA
WP_024637502.1|1686750_1687449_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	36.3	8.4e-12
WP_011724184.1|1687445_1687802_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024637503.1|1687899_1688379_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_011724186.1|1688383_1689490_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_011724187.1|1689486_1690161_+	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	39.8	6.0e-15
WP_023862343.1|1690157_1690571_+	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_007172497.1|1690985_1692929_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007172498.1|1692925_1693975_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
1694090:1695221	attR	AGTGGGTTGGTTGACCAGATCTTTTTCCAGTGGGCCACCGGGAAGTCGGCGAAGGCGGTGATGTCGGCGGCGGCCTCGCGCAACATGGTTTCGACCTTGGGGAACTGGCGGCCGAGCATGCCGGCGATGGTGTCGAGTTGTTCGCGCACGTGCTCGGCGTCTGGCTGGGCGAAGACGGTGCGGATCGCGGCGGCGACCATCTCTGCGGAGCCCTTGGGCACTTGGGCGAGCACGTTGCGCAGGAAGTGCACTCGACACCGCTGCCAGGCGGCCCCGATCAGCACGGCGTCAATGGCACTGCGCAGTCCGGCATGGGCATCGGAGATGACCAGTTGGACTCCGGCCAGACCGCGGGATTTCAACGACCGCAAAAACGCGGTCCAGAACGCCCCGTCCTCGGAGTCTCCGACCTCAAAGCCCAGTACCTCGCGGCGCCCGTCAGCGGCCACCCCGGTGGCGATGACCACCGCCTGCGACACCACCCGATGATTCACCCGGGCCTTGCAGTAGGTGGCGTCGAGGAAGACATACGGAAAGCGCTGATCACCCAACGGCCGGTCCCGGAAGGCCGCGACCTCGGTGTCGAGGTCTTTGCAGATCCGGCTGACCTCGCTTTTGGAGATCCCGGTATCGGTACCCAGTGCCTTGACCAGATCGTCGACCTTGCGGGTGGAGGTGCCGTGCAGGTAGGCCTCCATCACCACCGCGAACAAGCACTGATCGACCCGGCGACGCCGCTCCAACAACGCCGGGAAAAATGACCCGGTGCGCAGCTTGGGAATCCGCAGTTCCAGGTCCCCTGCGACCGTGGACAGCGTGCGCGGACGCGAGCCGTTGCGCTGATTGGAGCGGGTCTCGGTGCGCTCATGGGGAGAAGCCCCGATGAACGCGGTCAACTCCGCGTCGATCAAGGCTTGGTAGATCGTTTCGGCGGCTTGAGTGATCCGCTCACCGGCATCGGCGGTGCGCAGTGCGTCGAGCACCTCCAGCAAGGCAGACTGGTCCAGGGCCATCGCGATGTTCCTCTCGGTAGTGATTCTTGGTCGTTTCACCACAGAGACTCACGCGATGGCCCTCTTACGTCAGGGACCGACACGCCGCCATCACTTACACCACTCCCCGGGACGCTCCC	NA	NA	NA	NA
>prophage 98
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1703841	1706983	5626623		Pandoravirus(50.0%)	3	NA	NA
WP_023884453.1|1703841_1705374_+	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	39.9	3.9e-38
WP_023869403.1|1705370_1706051_+	TIGR02234 family membrane protein	NA	NA	NA	NA	NA
WP_003877736.1|1706164_1706983_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.9	3.2e-31
>prophage 99
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1714965	1716600	5626623		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_049770295.1|1714965_1716600_-	thiol reductant ABC exporter subunit CydC	NA	M1ID50	Paramecium_bursaria_Chlorella_virus	26.9	1.6e-05
>prophage 100
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1723768	1729014	5626623		Feldmannia_irregularis_virus(50.0%)	4	NA	NA
WP_031348925.1|1723768_1724383_+	ANTAR domain-containing response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	31.7	3.0e-05
WP_033711527.1|1724513_1725728_-	lipid-transfer protein	NA	NA	NA	NA	NA
WP_003876233.1|1725724_1726165_-	Zn-ribbon domain-containing OB-fold protein	NA	NA	NA	NA	NA
WP_033711491.1|1726263_1729014_+	DNA polymerase I	NA	A8ASX2	Listeria_phage	27.9	3.1e-41
>prophage 101
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1734415	1741662	5626623		Bacillus_virus(25.0%)	5	NA	NA
WP_019732267.1|1734415_1735204_-	Fpg/Nei family DNA glycosylase	NA	G3MA33	Bacillus_virus	23.6	1.2e-11
WP_019732266.1|1735203_1736202_-	hypothetical protein	NA	G8GER3	unidentified_phage	29.9	1.1e-09
WP_019732265.1|1736198_1736663_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_075362374.1|1736760_1739337_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	36.6	1.1e-29
WP_033711496.1|1739586_1741662_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.2	9.8e-16
>prophage 102
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1747505	1754320	5626623		Bacillus_virus(33.33%)	5	NA	NA
WP_033711501.1|1747505_1748228_-	Mg2+ transporter-C (MgtC) family protein	NA	G3MA03	Bacillus_virus	44.3	1.5e-11
WP_075362224.1|1748280_1749864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009977337.1|1750149_1750593_+	universal stress protein	NA	NA	NA	NA	NA
WP_042906860.1|1750610_1751297_-	MBL fold metallo-hydrolase	NA	A0A221J762	Mycobacterium_phage	74.4	4.4e-13
WP_075362225.1|1751404_1754320_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	53.1	5.3e-294
>prophage 103
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1761537	1769841	5626623	tRNA,transposase	Corynebacterium_phage(33.33%)	5	NA	NA
WP_011725525.1|1761537_1762770_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_033726257.1|1763099_1763765_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019733448.1|1763850_1765266_-	membrane protein	NA	NA	NA	NA	NA
WP_132160194.1|1765413_1768995_-|tRNA	bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX	tRNA	A0A1V0SIS0	Klosneuvirus	35.4	2.1e-74
WP_075362228.1|1769235_1769841_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	34.5	1.6e-11
>prophage 104
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1774590	1775634	5626623	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_033727043.1|1774590_1775634_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.2	8.1e-27
>prophage 105
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1781400	1782615	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_019733770.1|1781400_1782615_+	acetylornithine transaminase	NA	B5LJF5	Mycobacterium_phage	31.2	1.7e-15
>prophage 106
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1787938	1800719	5626623		Paenibacillus_phage(100.0%)	2	NA	NA
WP_075362231.1|1787938_1794313_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	33.3	4.5e-27
WP_075362232.1|1794293_1800719_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	30.1	1.5e-22
>prophage 107
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1805030	1808095	5626623		Moumouvirus(50.0%)	2	NA	NA
WP_075362234.1|1805030_1806314_-	cytochrome P450	NA	H2EDX0	Moumouvirus	26.4	2.9e-10
WP_075362235.1|1806319_1808095_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.1	1.6e-38
>prophage 108
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1821413	1946253	5626623	tRNA,integrase,transposase	Corynebacterium_phage(26.67%)	94	1855242:1855301	1878584:1880001
WP_019733748.1|1821413_1822175_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	6.3e-21
WP_011725238.1|1822283_1823561_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	30.1	2.1e-37
WP_003876309.1|1823647_1824286_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003876310.1|1824297_1825563_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	37.9	1.7e-63
WP_011725236.1|1825654_1826023_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_085989551.1|1826051_1826846_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_031348029.1|1826856_1827870_+	HAD-IIA family hydrolase	NA	NA	NA	NA	NA
WP_003876314.1|1827893_1828079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011725234.1|1828087_1828897_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_011725233.1|1828893_1829820_+	NAD kinase	NA	NA	NA	NA	NA
WP_033727028.1|1829845_1831615_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003876318.1|1831798_1832980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033727026.1|1832980_1833934_+	copper transporter	NA	NA	NA	NA	NA
WP_003876320.1|1834056_1835808_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.0	2.3e-127
WP_023861739.1|1835800_1836424_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_023861738.1|1836420_1837362_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	25.9	7.8e-21
WP_011725231.1|1837387_1838140_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_009977240.1|1838377_1839241_+	ParA family protein	NA	Q8JL10	Natrialba_phage	36.9	1.5e-23
WP_003876325.1|1839237_1840056_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003876326.1|1840052_1840760_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	27.6	4.4e-08
WP_031348901.1|1840759_1841503_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_019732781.1|1841499_1842186_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_019732782.1|1842182_1843583_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_008257537.1|1843901_1844927_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_008257535.1|1845106_1845316_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_008257533.1|1845520_1845955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011725525.1|1847050_1848283_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_129560197.1|1848742_1849036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075362238.1|1849534_1851478_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007172498.1|1851474_1852524_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_036428947.1|1854171_1854450_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
1855242:1855301	attL	GCGGGTCACGTCCCGTGGAGTGGTGTAAGAGCGGTCGCGTGTCCGCGTGTGGCTCTGTGG	NA	NA	NA	NA
WP_011725525.1|1855307_1856540_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_008257522.1|1857774_1857972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075362171.1|1858411_1858720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075362192.1|1858716_1860642_-|integrase	tyrosine-type recombinase/integrase	integrase	G8C7K6	Escherichia_phage	26.8	6.5e-06
WP_075362172.1|1860589_1861693_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K1Y646	Mycobacterium_phage	29.0	3.6e-09
WP_081385944.1|1861777_1862512_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	49.1	2.4e-33
WP_071321399.1|1862508_1862820_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_008257510.1|1863581_1863881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008257509.1|1864005_1865367_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011725525.1|1865553_1866786_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_075362240.1|1866843_1867638_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	7.7e-38
WP_008257507.1|1869240_1870491_-	MFS transporter	NA	NA	NA	NA	NA
WP_099156410.1|1870539_1871916_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_008257505.1|1871945_1873229_-	Orn/DAP/Arg decarboxylase 2	NA	NA	NA	NA	NA
WP_014942259.1|1873309_1874332_-	ornithine cyclodeaminase	NA	NA	NA	NA	NA
WP_008257503.1|1874413_1875511_-	PLP-dependent cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	33.4	5.0e-35
WP_008257502.1|1875747_1876134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008257501.1|1876693_1876984_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_011725525.1|1877344_1878577_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_075362241.1|1878615_1879950_-	PPE family protein	NA	NA	NA	NA	NA
WP_033717556.1|1880582_1881179_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
1878584:1880001	attR	CCACAGAGCCACACGCGGACACGCGACCGCTCTTACACCACTCCACGGGACGTGACCCGCAGCGACGCCAGCTCGCGCAGCTCGGCAGCGATGTTGATCGCTCCGACCGGCGAAACCTGCGGGGCGATTGCTGGGGCGTTTGTCTTGTCCTTCTTGTTCGGGTCGCGGGGGGCCTTCGCCGTCTCGGCCCGGCTTCGCTCCCGACCCAACGCGCTCGTGCCGGCCATCGCGCGCCCGGCCATGCTCGCCACCGCCATCTCGCCGAACAGACTCCCGGTGCCGCTGGGGGCGGCCGCGGCGGCGGCTTCCGCGGCGGCGCCGGCGCTGGTCGCCGGCAACGCCAAAGCGGCCGGCCGTATCGCCGGGGCGGCGGCCGTCCACCCGGGCGGTACCGACAGGCCGCCGACGGTGTTGGCCTCACCGAGCCCCGCTGACGCCAGAGTTCCGAATCCACCCGCCGGGTTCGTGATGACCGGGAATGGCGATGGCGGCACCGCGCCCGCCCCCGGCCAGGACTGCACACCGGCCCACCCGCTGACGATGTCATCGGTGTGGAAACCGGTCAGCGCGCCGGCAATGTTGAAGGGAAGAGTCGTCGCACCGAAGGGGGTTACCACGCCGAGTCCAGCGACGCTGGCGGGCCCGTTCAGAAAGACCGTGATCAGATCGCTCTCCACGCCCAGCACGTCCGTCACCGACGGGTCGACGGCAGTTGGCCCCACTGCGGTTCTGGTCAACATGTTGGGTACCGCCGAGAACGGTTGCTGGGCAACCGCGTTGCGTGTGCTCCCGGCGGCGGTGCCGGTGGCCTGCGCTACGGCTCCGGATTGGTCCGCCCCGGGGTTGGTGGTCTGATCCGGCTGGACGAACGGTGTCAGCGTGGTCGCCGACGCCGTGGAACCCGCGTAGCCGAACATCGCCGCGGTGTCACGCGCCCACATCTCCGCATACTCGGTCTCGGTGGTGGCGATCGCCGGCGTGTTCTGCCCGAGGAAGTTCGTCGCGACGAGGGACGCCAGCAGGGTGCGGTTCGCCGTGATCACCGGCGGCGGCACCGTCTGGGCGAAGGCCGTCTCGTAGGCGAACGCCGCGGCCCGGGCCTTGGTGGCGGTTTCTTCGGCCTGGGCGCCGGTGGTCCGCATCCACTCCAGATAGGGGGCGATCGCCGCGGTCATGGCCGCAGCCGACGGGCCGACCCACGGGCCGGAGGTCAGGGCGGTGATCTCGGCCTGGTAGGAGTCCGCCGTCGACTGCAGCGCGGCGGCCAATTCGTCCCAGGCCATGGCGGCGGCCAGCATTGGTCCCGACCCCGGACCGGCGTACATCCGCGCGGAGTTAACCTCCGGCGGTAGTACTGCGAAGTCCACGTTCTCCTCCGATCGCTCTCATGGCCGCGAGGGCATCGACGGCTCCGGTGC	NA	NA	NA	NA
WP_008257498.1|1881199_1883455_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.3	3.6e-104
WP_033717539.1|1883535_1883742_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_014942255.1|1884032_1887134_-	nocobactin polyketide synthase NbtC	NA	NA	NA	NA	NA
WP_008257493.1|1887137_1888436_-	polyketide synthase	NA	NA	NA	NA	NA
WP_008257491.1|1888432_1889191_-	thioesterase	NA	NA	NA	NA	NA
WP_014942254.1|1889356_1889914_-	acetyltransferase	NA	NA	NA	NA	NA
WP_008257486.1|1890172_1895203_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.2	4.4e-94
WP_075362242.1|1895222_1899770_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	23.3	7.8e-34
WP_008257481.1|1899892_1901188_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_008257479.1|1901668_1902376_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_008257477.1|1902884_1903112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008257475.1|1903128_1904463_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_008257473.1|1904680_1906096_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_008257471.1|1906088_1906814_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	32.1	9.0e-09
WP_008257468.1|1907701_1908361_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008257465.1|1908357_1909296_+	alpha/beta fold hydrolase	NA	A0A0B5A484	Mycobacterium_phage	38.4	4.7e-10
WP_008257463.1|1909292_1910267_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_033717552.1|1910263_1910680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008257454.1|1910676_1911987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008257453.1|1911983_1913867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008257450.1|1914044_1915415_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_008257447.1|1915448_1916723_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	33.0	8.6e-31
WP_008257445.1|1916916_1917183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075362378.1|1917964_1918987_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_008257440.1|1920023_1921070_-	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_031349784.1|1922178_1923426_+|transposase	IS256-like element IS1601 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.9	9.8e-80
WP_008257437.1|1924460_1925657_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.5	3.9e-25
WP_008257435.1|1926379_1927231_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	8.3e-38
WP_011725525.1|1928340_1929573_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_008257434.1|1930044_1931448_-	NADH-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
WP_008257432.1|1931466_1932957_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_008257430.1|1932959_1934792_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_008257429.1|1934809_1935112_-	NADH-quinone oxidoreductase subunit K	NA	NA	NA	NA	NA
WP_008257421.1|1935108_1935672_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_008257418.1|1935675_1936614_-	NADH-quinone oxidoreductase subunit H	NA	NA	NA	NA	NA
WP_099459180.1|1936606_1937470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008257416.1|1937886_1938231_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_011725525.1|1938775_1940008_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_008257415.1|1940418_1940799_-	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014942237.1|1940921_1944287_-	AAA family ATPase	NA	A0A218MLZ2	uncultured_virus	25.6	4.3e-13
WP_145929615.1|1944415_1945123_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_031349784.1|1945005_1946253_-|transposase	IS256-like element IS1601 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.9	9.8e-80
>prophage 109
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1953528	1954761	5626623	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_011725525.1|1953528_1954761_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
>prophage 110
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1962612	1965290	5626623		Lactococcus_phage(50.0%)	3	NA	NA
WP_008257392.1|1962612_1963758_-	PLP-dependent cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	32.4	1.2e-36
WP_008257390.1|1963869_1964268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033717528.1|1964633_1965290_-	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	30.0	5.6e-10
>prophage 111
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1971162	1977409	5626623		Streptococcus_phage(100.0%)	5	NA	NA
WP_033720679.1|1971162_1973484_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	39.6	2.1e-99
WP_008257377.1|1973564_1973846_-	DUF1490 family protein	NA	NA	NA	NA	NA
WP_008257374.1|1973896_1974256_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008257371.1|1974518_1974968_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_033720678.1|1975126_1977409_-	manganese-exporting P-type ATPase CtpC	NA	E4ZFI9	Streptococcus_phage	34.4	1.7e-82
>prophage 112
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1981128	1982361	5626623	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_011725525.1|1981128_1982361_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
>prophage 113
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	1990013	1992359	5626623		Streptococcus_phage(100.0%)	1	NA	NA
WP_008257346.1|1990013_1992359_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.0	1.7e-93
>prophage 114
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2033433	2035239	5626623		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_023899930.1|2033433_2035239_+	N-acetylglutaminylglutamine amidotransferase	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	26.4	8.8e-29
>prophage 115
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2047872	2049591	5626623		Lactobacillus_phage(100.0%)	1	NA	NA
WP_075362245.1|2047872_2049591_-	3-ketosteroid-delta-1-dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	25.3	7.1e-20
>prophage 116
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2060373	2061297	5626623		Moumouvirus(100.0%)	1	NA	NA
WP_033720667.1|2060373_2061297_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	28.7	3.3e-32
>prophage 117
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2075299	2077888	5626623		Pithovirus(100.0%)	1	NA	NA
WP_033711708.1|2075299_2077888_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.9	6.5e-25
>prophage 118
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2099040	2100315	5626623	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_011724668.1|2099040_2100315_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.0	2.9e-34
>prophage 119
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2113559	2114789	5626623	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_042907884.1|2113559_2114789_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	38.8	5.0e-36
>prophage 120
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2124111	2124921	5626623		Bacillus_phage(100.0%)	1	NA	NA
WP_011725162.1|2124111_2124921_-	RNA polymerase sigma factor SigF	NA	A0A0E3T5M9	Bacillus_phage	30.6	4.1e-18
>prophage 121
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2132848	2134216	5626623		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_033726127.1|2132848_2134216_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	27.1	7.8e-38
>prophage 122
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2138613	2140137	5626623		Catovirus(100.0%)	1	NA	NA
WP_019732378.1|2138613_2140137_-	acyl-CoA synthetase	NA	A0A1V0SBX8	Catovirus	20.1	1.4e-06
>prophage 123
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2156086	2161770	5626623		Mycobacterium_phage(100.0%)	2	NA	NA
WP_003876467.1|2156086_2157604_+	type VII secretion protein EccB	NA	V5UN45	Mycobacterium_phage	36.8	2.0e-71
WP_033720640.1|2157600_2161770_+	type VII secretion protein EccC	NA	V5UPA0	Mycobacterium_phage	26.3	2.0e-113
>prophage 124
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2174301	2182775	5626623	protease	Mycobacterium_phage(100.0%)	7	NA	NA
WP_075362248.1|2174301_2176131_+|protease	type VII secretion system ESX-5 serine protease mycosin MycP5	protease	A0A0A7HDD8	Mycobacterium_phage	35.3	3.2e-71
WP_019733543.1|2176150_2177359_+	type VII secretion protein EccE	NA	NA	NA	NA	NA
WP_019733544.1|2177355_2179188_+	type VII secretion system ESX-5 AAA family ATPase EccA5	NA	V5UQM2	Mycobacterium_phage	32.6	2.8e-67
WP_019733545.1|2179739_2180039_+	PE family protein	NA	NA	NA	NA	NA
WP_033719964.1|2180057_2181188_+	PPE family protein	NA	NA	NA	NA	NA
WP_075362249.1|2181207_2182422_+	PPE family protein	NA	V5UPR1	Mycobacterium_phage	30.4	4.5e-05
WP_019733090.1|2182439_2182775_+	DUF732 domain-containing protein	NA	A0A1D8EQ49	Mycobacterium_phage	41.3	4.3e-06
>prophage 125
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2190628	2191348	5626623		Bacillus_virus(100.0%)	1	NA	NA
WP_003876491.1|2190628_2191348_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	36.7	1.9e-11
>prophage 126
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2196600	2198520	5626623		Bacillus_virus(100.0%)	1	NA	NA
WP_019732890.1|2196600_2198520_-	ABC transporter ATP-binding protein/permease	NA	G3M9Y6	Bacillus_virus	24.5	2.6e-07
>prophage 127
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2209301	2212127	5626623		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_033720632.1|2209301_2212127_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.8	1.3e-257
>prophage 128
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2223258	2228152	5626623		Staphylococcus_phage(33.33%)	4	NA	NA
WP_033719908.1|2223258_2224824_-	long-chain-fatty acid--ACP ligase MbtM	NA	A0A2H4PQM9	Staphylococcus_phage	23.3	3.8e-12
WP_009977006.1|2224816_2225122_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_011725105.1|2225206_2226643_-	GuaB1 family IMP dehydrogenase-related protein	NA	A0A1V0SHK8	Klosneuvirus	29.2	2.6e-44
WP_031344201.1|2226682_2228152_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	27.0	8.7e-35
>prophage 129
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2237652	2238768	5626623		Planktothrix_phage(100.0%)	1	NA	NA
WP_033720626.1|2237652_2238768_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.6e-17
>prophage 130
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2256641	2260791	5626623		Moraxella_phage(50.0%)	3	NA	NA
WP_075362251.1|2256641_2258975_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.5	1.5e-142
WP_023899831.1|2259072_2260335_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_033720615.1|2260353_2260791_+	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	40.7	1.0e-15
>prophage 131
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2280484	2286093	5626623		Macacine_betaherpesvirus(66.67%)	6	NA	NA
WP_033706294.1|2280484_2280922_-	transglycosylase family protein	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	67.6	5.7e-51
WP_009976935.1|2281027_2281591_-	chorismate mutase	NA	NA	NA	NA	NA
WP_003876576.1|2281701_2282694_-	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	85.4	4.2e-166
WP_033712984.1|2283261_2284413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033712982.1|2284429_2284996_-	YceI family protein	NA	NA	NA	NA	NA
WP_023899814.1|2285079_2286093_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	34.5	1.3e-29
>prophage 132
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2296366	2298996	5626623		Pseudomonas_phage(50.0%)	2	NA	NA
WP_033720605.1|2296366_2297671_+	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	41.4	2.3e-15
WP_033720608.1|2297748_2298996_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.1	2.5e-14
>prophage 133
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2306109	2307357	5626623	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_031349784.1|2306109_2307357_-|transposase	IS256-like element IS1601 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.9	9.8e-80
>prophage 134
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2321828	2322599	5626623		Megavirus(100.0%)	1	NA	NA
WP_009976882.1|2321828_2322599_-	SDR family oxidoreductase	NA	L7Y2R3	Megavirus	34.6	1.2e-08
>prophage 135
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2339040	2339856	5626623		Gordonia_phage(100.0%)	1	NA	NA
WP_033726938.1|2339040_2339856_+	DUF1906 domain-containing protein	NA	A0A2D1GEF2	Gordonia_phage	48.6	9.3e-55
>prophage 136
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2347604	2348777	5626623		Shahe_endorna-like_virus(100.0%)	1	NA	NA
WP_019732650.1|2347604_2348777_-	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	42.9	3.0e-06
>prophage 137
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2364242	2365760	5626623		Cyanophage(100.0%)	1	NA	NA
WP_033719836.1|2364242_2365760_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	4.9e-73
>prophage 138
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2370792	2371554	5626623		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_023861590.1|2370792_2371554_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.2	8.0e-16
>prophage 139
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2376483	2487256	5626623	tRNA,integrase,transposase	Streptococcus_phage(15.79%)	107	2457964:2457982	2483063:2483081
WP_023861586.1|2376483_2377713_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_023861585.1|2377709_2378885_-	serine hydrolase	NA	NA	NA	NA	NA
WP_062887792.1|2378881_2380357_-	biotin carboxylase	NA	NA	NA	NA	NA
WP_019732287.1|2381008_2381329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011724993.1|2381396_2381708_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_033711481.1|2381858_2382260_-	glyoxalase	NA	NA	NA	NA	NA
WP_011724991.1|2382213_2383056_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023861579.1|2383279_2383717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085989547.1|2384438_2385699_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.5	7.2e-70
WP_003876695.1|2386002_2386656_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_024636750.1|2388637_2389522_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011724988.1|2389542_2390136_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011724987.1|2390243_2391062_+	CoA transferase	NA	NA	NA	NA	NA
WP_011724986.1|2391064_2392228_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011724985.1|2392238_2393450_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_009976795.1|2393456_2395589_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_009976793.1|2395579_2396419_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011724984.1|2396600_2397209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003876705.1|2397235_2397691_-	DUF1942 domain-containing protein	NA	NA	NA	NA	NA
WP_009976790.1|2397819_2398434_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031354787.1|2398512_2399436_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_128971821.1|2399545_2399959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019734530.1|2400045_2400231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009979999.1|2400282_2401077_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	1.6e-30
WP_011724852.1|2401073_2402654_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_033710826.1|2403831_2404425_-	cytochrome b561	NA	NA	NA	NA	NA
WP_019732062.1|2404421_2405450_-	catalase family peroxidase	NA	NA	NA	NA	NA
WP_019732061.1|2406040_2406643_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023899757.1|2406736_2407642_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_007172498.1|2408924_2409974_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_007172497.1|2409970_2411914_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_033725375.1|2412934_2413354_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	34.5	5.4e-06
WP_033725373.1|2413350_2414391_+	cation transporter	NA	NA	NA	NA	NA
WP_033725371.1|2414452_2414866_-	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_088304394.1|2414892_2415366_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033725366.1|2416087_2417200_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_033725365.1|2417196_2417562_-	helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	39.7	3.2e-07
WP_033725364.1|2417669_2418158_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_033725383.1|2418261_2418621_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_074340001.1|2418684_2419236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033725363.1|2420557_2420905_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044524626.1|2420901_2421981_-|integrase	site-specific integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	31.8	1.8e-05
WP_007172497.1|2422808_2424752_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007172498.1|2424748_2425798_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_095762090.1|2425866_2426979_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.5	5.9e-60
WP_081385946.1|2427283_2427778_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046363725.1|2428058_2428673_-	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_073917133.1|2428806_2429088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044524626.1|2429495_2430575_+|integrase	site-specific integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	31.8	1.8e-05
WP_033725363.1|2430571_2430919_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_074340001.1|2432240_2432792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033725383.1|2432855_2433215_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033725364.1|2433318_2433807_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_033725365.1|2433914_2434280_+	helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	39.7	3.2e-07
WP_033725366.1|2434276_2435389_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_033725367.1|2435385_2436054_+	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	38.0	1.6e-12
WP_088304394.1|2436112_2436586_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033725371.1|2436612_2437026_+	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_033725373.1|2437087_2438128_-	cation transporter	NA	NA	NA	NA	NA
WP_033725375.1|2438124_2438544_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	34.5	5.4e-06
WP_145929618.1|2439130_2439457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011725525.1|2440199_2441432_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_075362258.1|2441489_2442248_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_043988166.1|2442390_2443284_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_043988167.1|2444032_2444710_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_043988168.1|2445319_2446057_+	cutinase family protein	NA	NA	NA	NA	NA
WP_079635425.1|2446322_2446853_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_079635426.1|2446996_2447671_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_043988169.1|2447795_2448644_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_074325339.1|2448749_2449418_-	RraA family protein	NA	NA	NA	NA	NA
WP_043988170.1|2449712_2450663_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052765310.1|2450683_2451721_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	3.1e-10
WP_046365434.1|2451910_2453347_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046365433.1|2453343_2454579_-	OsmC family protein	NA	NA	NA	NA	NA
WP_046365431.1|2455307_2456219_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075362259.1|2456327_2457662_-	MFS transporter	NA	NA	NA	NA	NA
WP_075362260.1|2457680_2459066_-	phosphonoacetate hydrolase	NA	NA	NA	NA	NA
2457964:2457982	attL	CCGATGCGGTCGGCGGGCA	NA	NA	NA	NA
WP_081385947.1|2459754_2459940_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_075362386.1|2460128_2460719_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075362261.1|2460858_2461680_+	NmrA family NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_081385948.1|2461676_2462330_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046363721.1|2462491_2463085_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075362262.1|2463081_2463816_+	oxidoreductase	NA	NA	NA	NA	NA
WP_046363723.1|2463812_2464070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046363745.1|2464259_2464496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081385949.1|2464540_2465239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046363747.1|2466160_2466631_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_129560167.1|2467674_2468037_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_089150873.1|2468024_2470394_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.2	1.7e-85
WP_033718771.1|2470449_2470746_-	DUF1490 family protein	NA	NA	NA	NA	NA
WP_007170246.1|2470867_2471299_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_007170247.1|2471302_2472073_+	DUF2182 domain-containing protein	NA	NA	NA	NA	NA
WP_007170248.1|2472513_2472846_+	YnfA family protein	NA	NA	NA	NA	NA
WP_007170249.1|2473088_2473502_-	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	34.7	2.5e-08
WP_007170250.1|2473501_2474596_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_007170251.1|2474697_2475498_-	arsenite methyltransferase	NA	NA	NA	NA	NA
WP_007170252.1|2475586_2475973_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033718775.1|2476026_2478315_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.3	4.3e-89
WP_033718759.1|2478379_2478676_-	DUF1490 family protein	NA	NA	NA	NA	NA
WP_007170255.1|2478757_2479114_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065018912.1|2479185_2480007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085981751.1|2480086_2481103_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033719466.1|2481099_2483058_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_099459185.1|2483180_2483921_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
2483063:2483081	attR	TGCCCGCCGACCGCATCGG	NA	NA	NA	NA
WP_023861566.1|2484154_2484886_-	haloacid dehalogenase type II	NA	NA	NA	NA	NA
WP_023861565.1|2485226_2486039_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	41.7	4.5e-49
WP_023870547.1|2486038_2487256_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.0	1.1e-14
>prophage 140
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2502970	2505272	5626623		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_003878018.1|2502970_2503753_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	1.3e-13
WP_019732506.1|2503859_2505272_-	PAS domain S-box protein	NA	A0A1V0SL97	Klosneuvirus	21.7	9.0e-05
>prophage 141
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2515709	2516681	5626623		Staphylococcus_phage(100.0%)	1	NA	NA
WP_033710842.1|2515709_2516681_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	26.1	2.9e-10
>prophage 142
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2528331	2530379	5626623		Faustovirus(50.0%)	2	NA	NA
WP_003876738.1|2528331_2529300_-	patatin-like phospholipase family protein	NA	A0A0H3TN97	Faustovirus	28.2	3.7e-18
WP_029248479.1|2529293_2530379_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.2	9.6e-23
>prophage 143
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2535810	2536371	5626623		Indivirus(100.0%)	1	NA	NA
WP_155267635.1|2535810_2536371_-	pyrazinamidase PncA	NA	A0A1V0SEH9	Indivirus	27.0	1.7e-07
>prophage 144
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2541139	2542657	5626623		Mollivirus(100.0%)	1	NA	NA
WP_011724808.1|2541139_2542657_-	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	31.0	8.1e-28
>prophage 145
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2556204	2570800	5626623		Paenibacillus_phage(50.0%)	4	NA	NA
WP_033720563.1|2556204_2568717_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	29.0	2.5e-29
WP_003878051.1|2569132_2569483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003872122.1|2569653_2569989_+	RNA polymerase-binding protein RbpA	NA	NA	NA	NA	NA
WP_023861529.1|2569996_2570800_-	polyprenol monophosphomannose synthase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	39.8	4.5e-25
>prophage 146
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2585458	2586214	5626623		Planktothrix_phage(100.0%)	1	NA	NA
WP_019733948.1|2585458_2586214_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	2.7e-24
>prophage 147
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2606044	2610640	5626623		Rhodococcus_phage(50.0%)	3	NA	NA
WP_019733596.1|2606044_2607001_+	5'-3' exonuclease	NA	A0A2P1JXG8	Rhodococcus_phage	33.6	1.2e-21
WP_033712597.1|2607005_2607767_-	DUF4333 domain-containing protein	NA	NA	NA	NA	NA
WP_033720557.1|2607832_2610640_-	RNA helicase	NA	M1ILW8	Acanthocystis_turfacea_Chlorella_virus	34.0	5.5e-70
>prophage 148
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2620004	2621831	5626623		Tupanvirus(100.0%)	1	NA	NA
WP_031347904.1|2620004_2621831_-	proteasome ATPase	NA	A0A2K9L596	Tupanvirus	35.4	2.7e-33
>prophage 149
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2639659	2648168	5626623		Dickeya_phage(50.0%)	4	NA	NA
WP_019732245.1|2639659_2643448_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	58.1	2.6e-14
WP_003878095.1|2643914_2644766_+	PAC2 family protein	NA	NA	NA	NA	NA
WP_019732194.1|2644800_2645700_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019732196.1|2646431_2648168_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	19.8	2.0e-06
>prophage 150
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2657300	2676685	5626623		Mycobacterium_phage(50.0%)	2	NA	NA
WP_019732200.1|2657300_2658785_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	32.8	5.9e-39
WP_075362271.1|2658781_2676685_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.0	4.7e-159
>prophage 151
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2685995	2687243	5626623		Catovirus(100.0%)	1	NA	NA
WP_023861632.1|2685995_2687243_-	cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase	NA	A0A1V0SAQ2	Catovirus	24.7	3.7e-26
>prophage 152
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2705356	2707729	5626623		Streptococcus_phage(100.0%)	1	NA	NA
WP_019734272.1|2705356_2707729_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.2	5.3e-90
>prophage 153
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2713117	2715373	5626623		Streptococcus_phage(100.0%)	1	NA	NA
WP_033712784.1|2713117_2715373_+	manganese-exporting P-type ATPase CtpC	NA	E4ZFI9	Streptococcus_phage	32.2	7.7e-75
>prophage 154
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2718854	2719904	5626623	integrase	Gordonia_phage(100.0%)	1	2713593:2713609	2726558:2726574
2713593:2713609	attL	GCGCGGGCACCGACGCG	NA	NA	NA	NA
WP_007172498.1|2718854_2719904_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_007172498.1|2718854_2719904_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
2726558:2726574	attR	GCGCGGGCACCGACGCG	NA	NA	NA	NA
>prophage 155
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2723410	2725738	5626623		Streptococcus_phage(100.0%)	1	NA	NA
WP_085989686.1|2723410_2725738_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.7	6.7e-90
>prophage 156
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2761586	2765356	5626623	integrase	Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	2758528:2758544	2768517:2768533
2758528:2758544	attL	GATCGCCGCGCTGGAAG	NA	NA	NA	NA
WP_080708759.1|2761586_2762777_+	serine/threonine protein kinase	NA	M1HZT4	Acanthocystis_turfacea_Chlorella_virus	30.7	4.3e-16
WP_075362274.1|2762910_2763144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172498.1|2764306_2765356_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
2768517:2768533	attR	GATCGCCGCGCTGGAAG	NA	NA	NA	NA
>prophage 157
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2770403	2770892	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_009976539.1|2770403_2770892_-	polyadenylate-specific 3'-exoribonuclease AS	NA	A0A249XQ39	Mycobacterium_phage	44.3	9.9e-28
>prophage 158
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2776764	2785394	5626623		Catovirus(33.33%)	7	NA	NA
WP_019733478.1|2776764_2778567_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	26.1	4.8e-51
WP_033726007.1|2778707_2779841_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003878136.1|2779877_2780708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033726005.1|2780739_2781897_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	43.2	2.6e-18
WP_011724714.1|2782077_2782272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033720518.1|2782484_2784416_+	DEDD exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_031344124.1|2784290_2785394_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	37.0	1.1e-42
>prophage 159
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2794076	2799418	5626623		Ostreococcus_lucimarinus_virus(50.0%)	5	NA	NA
WP_023899133.1|2794076_2796008_+	asparagine synthase (glutamine-hydrolyzing)	NA	I3UKG6	Ostreococcus_lucimarinus_virus	27.2	8.0e-20
WP_009976513.1|2796029_2797004_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_003872273.1|2797183_2797861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003872274.1|2797887_2798244_-	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_003878146.1|2798341_2799418_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	30.4	8.6e-16
>prophage 160
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2805196	2809743	5626623		Mycoplasma_phage(50.0%)	4	NA	NA
WP_033713316.1|2805196_2806744_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	33.6	5.9e-34
WP_019733891.1|2806979_2807429_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_003878156.1|2807577_2807919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019733892.1|2807964_2809743_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.7	4.6e-06
>prophage 161
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2837124	2838276	5626623		Agrobacterium_phage(100.0%)	1	NA	NA
WP_011724658.1|2837124_2838276_-	bifunctional RNase H/acid phosphatase	NA	A0A2L0V0T1	Agrobacterium_phage	30.8	6.6e-06
>prophage 162
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2867765	2868851	5626623		Synechococcus_phage(100.0%)	1	NA	NA
WP_023868993.1|2867765_2868851_+	S-(hydroxymethyl)mycothiol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.7	1.4e-29
>prophage 163
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2887932	2888982	5626623	integrase	Gordonia_phage(100.0%)	1	2882563:2882577	2900671:2900685
2882563:2882577	attL	GGTATGGGCAGCCGG	NA	NA	NA	NA
WP_007172498.1|2887932_2888982_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_007172498.1|2887932_2888982_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
2900671:2900685	attR	GGTATGGGCAGCCGG	NA	NA	NA	NA
>prophage 164
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2895050	2905567	5626623	transposase	Staphylococcus_phage(25.0%)	6	NA	NA
WP_075362277.1|2895050_2896307_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	32.4	3.6e-13
WP_085989547.1|2897011_2898273_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.5	7.2e-70
WP_080576411.1|2899077_2901672_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	27.6	1.1e-08
WP_023898821.1|2902021_2902474_-	VOC family protein	NA	NA	NA	NA	NA
WP_023898819.1|2902639_2903908_+	cytochrome P450	NA	NA	NA	NA	NA
WP_033713266.1|2904106_2905567_-	serine/threonine protein kinase	NA	M1HUJ3	Paramecium_bursaria_Chlorella_virus	27.5	1.6e-12
>prophage 165
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2912876	2913233	5626623		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003878228.1|2912876_2913233_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CZV4	Paenibacillus_phage	38.6	6.4e-08
>prophage 166
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2916919	2918104	5626623		Escherichia_phage(100.0%)	1	NA	NA
WP_033713261.1|2916919_2918104_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	35.2	1.1e-56
>prophage 167
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2940222	2942157	5626623		Catovirus(100.0%)	1	NA	NA
WP_033725977.1|2940222_2942157_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	35.7	4.4e-111
>prophage 168
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2968474	2973337	5626623	integrase,transposase	Mycobacterium_phage(50.0%)	5	2956677:2956691	2972597:2972611
2956677:2956691	attL	CTCGACGCCACCTAC	NA	NA	NA	NA
WP_075362279.1|2968474_2969701_-|integrase	site-specific integrase	integrase	A0A068F1P9	Mycobacterium_phage	44.5	1.8e-81
WP_075362280.1|2969742_2969952_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033725955.1|2970081_2971542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062908115.1|2971544_2971970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011725525.1|2972104_2973337_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
2972597:2972611	attR	CTCGACGCCACCTAC	NA	NA	NA	NA
>prophage 169
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2977372	2978605	5626623	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_011725525.1|2977372_2978605_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
>prophage 170
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2982769	2984002	5626623	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_011725525.1|2982769_2984002_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
>prophage 171
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2988086	2990381	5626623		Streptococcus_phage(100.0%)	1	NA	NA
WP_120314060.1|2988086_2990381_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.5	9.9e-94
>prophage 172
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	2999071	3001633	5626623		uncultured_virus(100.0%)	1	NA	NA
WP_033725901.1|2999071_3001633_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.7	3.0e-83
>prophage 173
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3006228	3007461	5626623	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_011725525.1|3006228_3007461_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
>prophage 174
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3016618	3027190	5626623		Klosneuvirus(25.0%)	8	NA	NA
WP_033725892.1|3016618_3017857_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	21.8	1.7e-15
WP_033725890.1|3017853_3018723_-	N-dimethylarginine dimethylaminohydrolase	NA	NA	NA	NA	NA
WP_003872469.1|3018844_3019291_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033725889.1|3019315_3020170_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_033725921.1|3020166_3022128_-	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	27.7	4.3e-05
WP_075362283.1|3022865_3023420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075362284.1|3023428_3025189_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.1	3.0e-18
WP_011724581.1|3025237_3027190_+	acyl-CoA oxidase	NA	A0A2K9L6M4	Tupanvirus	30.5	1.2e-55
>prophage 175
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3047609	3050532	5626623		environmental_halophage(50.0%)	2	NA	NA
WP_011724564.1|3047609_3049622_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.6	5.8e-98
WP_003872495.1|3049608_3050532_-	hypothetical protein	NA	A0A2K9L690	Tupanvirus	34.9	2.8e-39
>prophage 176
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3053761	3054694	5626623		Streptococcus_phage(100.0%)	1	NA	NA
WP_003872497.1|3053761_3054694_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	53.7	6.4e-84
>prophage 177
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3060432	3062385	5626623		Abalone_shriveling_syndrome-associated_virus(100.0%)	1	NA	NA
WP_011724556.1|3060432_3062385_-	DNA primase	NA	B8Q5B5	Abalone_shriveling_syndrome-associated_virus	31.9	1.8e-35
>prophage 178
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3068769	3072585	5626623	tRNA	Orpheovirus(50.0%)	5	NA	NA
WP_019732215.1|3068769_3070161_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	29.5	2.5e-47
WP_011724553.1|3070352_3070784_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011724552.1|3070780_3071188_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_011724551.1|3071266_3071695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011724550.1|3071694_3072585_-	decaprenyl diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.5	1.2e-15
>prophage 179
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3080658	3083808	5626623		Pseudomonas_phage(50.0%)	3	NA	NA
WP_011724544.1|3080658_3081717_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	43.6	3.0e-45
WP_033725885.1|3081877_3082639_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_019731900.1|3082662_3083808_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	28.4	4.3e-29
>prophage 180
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3089988	3101000	5626623		Tupanvirus(100.0%)	2	NA	NA
WP_033725882.1|3089988_3094431_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.9	3.4e-50
WP_011724535.1|3094427_3101000_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.5	7.4e-126
>prophage 181
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3106140	3112571	5626623		Tupanvirus(33.33%)	3	NA	NA
WP_033719611.1|3106140_3109638_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.0	3.8e-44
WP_023898337.1|3109744_3111400_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	37.6	6.0e-08
WP_019734591.1|3111509_3112571_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	48.6	1.4e-82
>prophage 182
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3124060	3125140	5626623		Bordetella_phage(100.0%)	1	NA	NA
WP_023864604.1|3124060_3125140_-	GGDEF domain-containing protein	NA	A0A2D0W9B6	Bordetella_phage	45.9	3.5e-09
>prophage 183
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3129090	3129723	5626623		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_019732302.1|3129090_3129723_+	membrane protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	43.9	1.3e-27
>prophage 184
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3137654	3140631	5626623	integrase	Mycobacterium_phage(50.0%)	2	3131158:3131171	3141799:3141812
3131158:3131171	attL	CTCATGGTCGCCGT	NA	NA	NA	NA
WP_075362172.1|3137654_3138758_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K1Y646	Mycobacterium_phage	29.0	3.6e-09
WP_075362192.1|3138705_3140631_+|integrase	tyrosine-type recombinase/integrase	integrase	G8C7K6	Escherichia_phage	26.8	6.5e-06
3141799:3141812	attR	ACGGCGACCATGAG	NA	NA	NA	NA
>prophage 185
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3161267	3162356	5626623		Bacillus_virus(100.0%)	1	NA	NA
WP_009976059.1|3161267_3162356_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	6.5e-27
>prophage 186
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3168617	3170525	5626623		Tupanvirus(100.0%)	1	NA	NA
WP_044088770.1|3168617_3170525_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	39.0	4.6e-20
>prophage 187
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3183561	3194601	5626623		Paenibacillus_phage(100.0%)	1	NA	NA
WP_033720430.1|3183561_3194601_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	29.6	3.7e-29
>prophage 188
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3200095	3203011	5626623		Mycobacterium_phage(50.0%)	2	NA	NA
WP_019733233.1|3200095_3201226_+	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	34.6	4.5e-23
WP_023898260.1|3201274_3203011_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	18.5	8.5e-05
>prophage 189
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3214155	3215385	5626623		Streptococcus_phage(100.0%)	1	NA	NA
WP_033711372.1|3214155_3215385_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.8	8.2e-95
>prophage 190
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3231353	3232457	5626623		Streptococcus_phage(100.0%)	1	NA	NA
WP_033719567.1|3231353_3232457_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.0	1.1e-53
>prophage 191
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3238008	3244857	5626623	tRNA	Anguillid_herpesvirus(33.33%)	6	NA	NA
WP_003875860.1|3238008_3238419_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	50.8	2.9e-28
WP_003875859.1|3238459_3238837_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_003875858.1|3238833_3240291_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_023898180.1|3240287_3242936_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	40.6	1.5e-146
WP_023898178.1|3242994_3244254_-	enoyl reductase	NA	NA	NA	NA	NA
WP_033711368.1|3244323_3244857_-	transglycosylase family protein	NA	A0A1J0GVU2	Streptomyces_phage	77.6	7.0e-27
>prophage 192
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3249905	3253645	5626623	protease	Bacillus_virus(33.33%)	4	NA	NA
WP_003875851.1|3249905_3251186_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.2	1.9e-142
WP_033710490.1|3251519_3252401_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_003875849.1|3252422_3253058_-|protease	ATP-dependent CLP protease proteolytic subunit ClpP2	protease	A0A2H4JEX1	uncultured_Caudovirales_phage	32.0	6.7e-08
WP_009975941.1|3253054_3253645_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	47.5	3.6e-40
>prophage 193
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3257209	3263286	5626623		Kaumoebavirus(33.33%)	7	NA	NA
WP_009975935.1|3257209_3258016_-	Fpg/Nei family DNA glycosylase	NA	A0A1V0CNR6	Kaumoebavirus	27.2	4.8e-11
WP_085978483.1|3258034_3258523_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_009975933.1|3258569_3259193_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_009975931.1|3259300_3261892_+	aminopeptidase N	NA	A0A2K9L1R3	Tupanvirus	31.6	5.6e-45
WP_085978482.1|3261888_3262425_-	DUF5130 domain-containing protein	NA	NA	NA	NA	NA
WP_003877446.1|3262342_3262573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003875839.1|3262638_3263286_-	HNH endonuclease	NA	H6WG01	Cyanophage	34.9	1.5e-18
>prophage 194
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3272586	3274824	5626623		Tupanvirus(50.0%)	2	NA	NA
WP_033719553.1|3272586_3274263_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	28.0	1.1e-44
WP_009975923.1|3274341_3274824_-	single-stranded DNA-binding protein	NA	A0A1D8ETH0	Propionibacterium_phage	36.7	1.9e-15
>prophage 195
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3282931	3284179	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_033719550.1|3282931_3284179_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	39.1	5.1e-36
>prophage 196
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3297418	3299020	5626623		Pike_perch_iridovirus(100.0%)	1	NA	NA
WP_003873088.1|3297418_3299020_-	acetyl-CoA carboxylase subunit beta	NA	A0A1B2ITV7	Pike_perch_iridovirus	62.5	1.2e-18
>prophage 197
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3303086	3305425	5626623		Klebsiella_phage(50.0%)	2	NA	NA
WP_011724281.1|3303086_3304652_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	36.6	8.3e-60
WP_009975893.1|3304777_3305425_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	40.9	1.6e-25
>prophage 198
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3327143	3327866	5626623		Rhodococcus_phage(100.0%)	1	NA	NA
WP_009975877.1|3327143_3327866_-	DUF1906 domain-containing protein	NA	A0A2P1JXS5	Rhodococcus_phage	49.3	8.6e-52
>prophage 199
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3334494	3336060	5626623		Staphylococcus_phage(100.0%)	1	NA	NA
WP_009975862.1|3334494_3336060_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.0	3.9e-17
>prophage 200
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3348076	3349573	5626623		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011724256.1|3348076_3349573_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.7	5.8e-26
>prophage 201
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3361992	3363150	5626623		Synechococcus_phage(100.0%)	1	NA	NA
WP_009975821.1|3361992_3363150_+	Zn-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.8	1.2e-34
>prophage 202
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3376882	3378535	5626623		Tupanvirus(100.0%)	1	NA	NA
WP_033717924.1|3376882_3378535_+	acyl-CoA synthetase	NA	A0A2K9L3I8	Tupanvirus	20.7	9.5e-06
>prophage 203
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3400866	3402423	5626623		Hepacivirus(100.0%)	1	NA	NA
WP_033717917.1|3400866_3402423_+	acyl--CoA ligase	NA	Q75ZG1	Hepacivirus	23.3	1.8e-14
>prophage 204
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3407168	3407918	5626623		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_015632616.1|3407168_3407918_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.3	5.5e-09
>prophage 205
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3411736	3416079	5626623		Bacillus_phage(100.0%)	2	NA	NA
WP_011724227.1|3411736_3413473_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	2.1e-24
WP_024637120.1|3413469_3416079_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.9	1.7e-33
>prophage 206
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3419205	3492139	5626623	tRNA,protease,integrase,transposase	Gordonia_phage(20.0%)	60	3447663:3447722	3492140:3492466
WP_011724221.1|3419205_3419820_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	32.0	1.3e-08
WP_139808063.1|3419948_3420221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011724220.1|3420298_3421078_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_003877370.1|3421111_3421939_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_009975745.1|3421966_3422794_-	glutamate racemase	NA	NA	NA	NA	NA
WP_009975744.1|3422790_3423462_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011724218.1|3423512_3424553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009975741.1|3424563_3425151_-	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_010949598.1|3425175_3425493_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_009975739.1|3425560_3426895_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	34.9	3.9e-42
WP_033712534.1|3426928_3428941_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	26.7	8.5e-49
WP_023881211.1|3428924_3431540_-	alpha-glucan family phosphorylase	NA	NA	NA	NA	NA
WP_009975734.1|3431839_3433930_+	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_023861307.1|3433964_3436160_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011724214.1|3436185_3437097_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011724213.1|3437287_3438469_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_003873207.1|3438550_3439015_+	methylmalonyl-CoA epimerase	NA	NA	NA	NA	NA
WP_023861306.1|3439025_3439322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010949602.1|3439345_3440026_-	endonuclease NucS	NA	NA	NA	NA	NA
WP_009975725.1|3440062_3441697_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.3	2.5e-14
WP_009975723.1|3441802_3442138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023870934.1|3442159_3443407_-	MFS transporter	NA	NA	NA	NA	NA
WP_007172498.1|3444673_3445723_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
3447663:3447722	attL	ACATCCCACCCCGACGGGTTGACCCGCCCCGAGGGCCGGATAATGGAGCGATTGAACAAG	NA	NA	NA	NA
WP_023870933.1|3448049_3448943_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011724208.1|3449028_3450528_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_010949605.1|3450524_3451022_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.6	1.3e-19
WP_011724207.1|3451068_3451566_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_019733492.1|3451667_3453134_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_003877298.1|3458954_3460208_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_019732348.1|3460292_3460886_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003873218.1|3460882_3461326_-	DUF2550 domain-containing protein	NA	NA	NA	NA	NA
WP_003873219.1|3461343_3461709_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_011724205.1|3461748_3463206_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003873221.1|3463234_3464149_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_003877295.1|3464155_3465820_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_011724204.1|3465887_3467228_-	F0F1 ATP synthase subunit B/delta	NA	NA	NA	NA	NA
WP_003873224.1|3467235_3467769_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_024636915.1|3467778_3468027_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_003873226.1|3468111_3468870_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_011724202.1|3468862_3469345_-	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_003873228.1|3469560_3470784_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_009975706.1|3470810_3471470_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	35.5	1.3e-17
WP_019732347.1|3471469_3472417_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003873231.1|3472430_3473504_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_003873232.1|3473600_3473843_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_029248424.1|3473944_3475798_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_009975702.1|3476065_3477013_-	homoserine kinase	NA	NA	NA	NA	NA
WP_011724197.1|3477042_3478125_-	threonine synthase	NA	NA	NA	NA	NA
WP_003873236.1|3478121_3479447_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_011724196.1|3479450_3480869_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_023881202.1|3480865_3482518_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024636927.1|3482762_3483077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011724194.1|3483073_3484606_-	hypothetical protein	NA	G8I4L0	Mycobacterium_phage	53.6	2.9e-134
WP_023882656.1|3484938_3485466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011724192.1|3485665_3485971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011724191.1|3485967_3486783_-	hypothetical protein	NA	W8ECM5	Mycobacterium_phage	50.9	6.7e-61
WP_011724190.1|3486792_3487512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011724189.1|3487508_3487769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172498.1|3489149_3490199_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_007172497.1|3490195_3492139_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3492140:3492466	attR	ACATCCCACCCCGACGGGTTGACCCGCCCCGAGGGCCGGATAATGGAGCGATTGAACAAGGAAATCAAACGCCGCACCGACGTCGTCGGCGTGTTCCCCAACCCCGCCGCGCTGTTACGGCTGGCCGGCTCGGTACTCGTTGAGGCCCACGACGAATGGCAGGTCGCCGACAAGCGCTACCTCTCCGAGACCAGCCTCGCTCTGCTCGACGTCAGTGACCAAAGTGCCGAAACCATTGCCCCCACAGCCGCTCTCACGGCATAGTGGCTACCACAGAGCCACACGCGGACACGCGACCGCTCTTACACCACTCCACGGGACGTGACC	NA	NA	NA	NA
>prophage 207
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3496441	3497167	5626623		Streptomyces_phage(100.0%)	1	NA	NA
WP_019732226.1|3496441_3497167_+	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	34.5	2.4e-09
>prophage 208
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3510708	3516018	5626623		Klosneuvirus(33.33%)	4	NA	NA
WP_011725324.1|3510708_3512025_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	8.4e-13
WP_011725325.1|3512087_3512555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011725326.1|3512886_3513756_+	NlpC/P60 family peptidoglycan-binding protein RipD	NA	A0A1J0GW44	Streptomyces_phage	37.4	2.7e-07
WP_011725327.1|3513855_3516018_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	30.2	1.7e-58
>prophage 209
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3530173	3536588	5626623		Catovirus(50.0%)	4	NA	NA
WP_011725335.1|3530173_3531994_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	26.3	2.4e-42
WP_011725336.1|3532015_3532432_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011725337.1|3532490_3532937_+	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011725338.1|3533054_3536588_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	59.7	0.0e+00
>prophage 210
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3545342	3548504	5626623	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_050485458.1|3545342_3548504_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	36.4	7.3e-164
>prophage 211
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3570611	3571873	5626623	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_145929620.1|3570611_3571873_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.2	1.0e-68
>prophage 212
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3577984	3597500	5626623	transposase	Tupanvirus(66.67%)	3	NA	NA
WP_011725525.1|3577984_3579217_+|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
WP_033717266.1|3579597_3587256_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	20.6	1.8e-99
WP_062899819.1|3587252_3597500_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.6	6.9e-70
>prophage 213
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3608375	3613048	5626623	integrase,transposase	uncultured_virus(50.0%)	2	3577865:3577924	3614236:3615368
3577865:3577924	attL	GGGGAGCGTCCCGGGGAGTGGTGTAAGTGATGGCGGCGTGTCGGTCCCTGACGTAAGAGG	NA	NA	NA	NA
WP_011724668.1|3608375_3609650_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.0	2.9e-34
WP_007172498.1|3611998_3613048_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
3614236:3615368	attR	CCTCTTACGTCAGGGACCGACACGCCGCCATCACTTACACCACTCCCCGGGACGCTCCCCACGCCCTCACGCGGTGGCCGCTTTACGTCCATCACCGACACGATGACGAACCCAGCAACCGCGCTACACCACTATGCGGGACTCAACTTGCAGTGTTCGCAAGTCGATGACAGGATATTTCTCTACCGCGTGGAGGCAACCGGCGCGCGGAGGAGAGGCTCGCAATGACCGCCACAACCAGGGCAGCGGACGCACCCAAGGTCAGCGTGGTGTCAACCACCCACAACCAGCAGGCCTATGTCCGCGACACGTTGGACGGCTTCCTCGCCCAGCGGGTCGACTTTCCGATGGAGGTCATCGTCGCCGACGATGCCTCGACCGATGCCACACCCCGAATCATCCAGGACTACGCCGACCGCCATCCGAACCTCTTCCGGCCCATCCTGCGGTCGAGAAACGTCGGCCTCAACGCCAACCTCACCGGTGCCCTGTCCGCCGCGCGTGGCGAGTACATCGCGCTGTGCGAGGGCGACGACTACTGGGTCGCCCCGTTGAAACTGACCAAACAAGTGGCGTTGCTGGACGAAGATCCCGACACCACGGTGTGTTTCCACCCGGTGCAGGTGGTCTGGACCCACGAGTGCGCGGAGGACGAGAAACTCGTCCACACCCTGTATCGCAAGTTCGAAGAGATCTTCCTGCCCAAGTTTCCGCCGCCCTTTCGGGCGGGTGACCTCAGCTTCGAGACGCTGATCTCGCGCAACTTCATCCAGACCAACTCGGTGATGTACCGCCGCCTCCCCCGCTACGACGACATCCCGGCCGATGTCATGCCCCTGGACTGGTACCTGCACGTCCGGCATGCCGCCGAAGGCGCCATCGCCATGCTGCCGGAGACGATGGCGGTCTATCGCCGCCACCCGCGCGGCATGTGGTACAAGTCGATCACCGATCCGGCCACCTTCTGGCGGATGCAGGGTCCCGGGCATGCGGCGACATTGGACGCCATGCTCGACGTCGTCTCCGGCGACCCCGTGCACGAATCCATCGTGGCCAAAAACGCCGACTGGGTGCTGGGGGCAATCGCCAAGCAGGTCCCGGACCCCGAGGGCCAGCAAGTCCTGACGCAGACC	NA	NA	NA	NA
>prophage 214
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3617385	3631984	5626623		Shahe_endorna-like_virus(42.86%)	12	NA	NA
WP_033720074.1|3617385_3618642_+	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	38.7	5.6e-06
WP_023864511.1|3618648_3619428_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033718281.1|3619501_3620257_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_031354168.1|3620419_3621226_-	macrocin O-methyltransferase	NA	A0A2R8FDY2	Brazilian_cedratvirus	51.7	2.1e-54
WP_075362297.1|3621323_3622610_-	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	39.5	3.6e-08
WP_019732392.1|3623013_3624291_-	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	38.7	5.6e-06
WP_033718280.1|3624413_3625220_-	macrocin O-methyltransferase	NA	A0A2R8FDY2	Brazilian_cedratvirus	49.8	2.3e-53
WP_033726231.1|3625501_3626608_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_033718279.1|3626897_3627947_-	NAD-dependent epimerase/dehydratase family protein	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	23.5	1.4e-15
WP_019732388.1|3628078_3629104_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_033718313.1|3629551_3630466_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_033718278.1|3630811_3631984_-	acyltransferase	NA	A9YX16	Burkholderia_phage	28.4	6.5e-17
>prophage 215
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3641115	3642570	5626623		Bacillus_phage(100.0%)	1	NA	NA
WP_033710656.1|3641115_3642570_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	1.2e-15
>prophage 216
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3649277	3650045	5626623		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003876102.1|3649277_3650045_-	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	4.0e-07
>prophage 217
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3654372	3656545	5626623		Gordonia_phage(50.0%)	2	NA	NA
WP_003876096.1|3654372_3655107_-	NlpC/P60 family peptidoglycan endopeptidase RipB	NA	A0A0K0NL58	Gordonia_phage	37.6	9.1e-17
WP_023861230.1|3655132_3656545_-	NlpC/P60 family peptidoglycan endopeptidase RipA	NA	Q9T1E7	Lactobacillus_phage	44.6	1.3e-11
>prophage 218
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3661286	3664132	5626623		Tupanvirus(50.0%)	3	NA	NA
WP_003876090.1|3661286_3662924_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	23.7	8.2e-34
WP_023866263.1|3662946_3663756_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003877663.1|3663778_3664132_-	thioredoxin	NA	A0A2H4P7M6	Pseudomonas_phage	33.7	8.5e-13
>prophage 219
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3668170	3670686	5626623		Mycobacterium_phage(33.33%)	3	NA	NA
WP_031344234.1|3668170_3668635_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0K1LSF9	Mycobacterium_phage	47.8	1.8e-23
WP_033710643.1|3668653_3669901_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.6	9.8e-104
WP_003876081.1|3669903_3670686_-	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	26.7	1.0e-05
>prophage 220
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3675892	3676801	5626623		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003877656.1|3675892_3676801_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	3.3e-16
>prophage 221
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3684910	3689534	5626623		Synechococcus_phage(50.0%)	5	NA	NA
WP_009977591.1|3684910_3686455_+	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	36.0	5.0e-73
WP_033718310.1|3686483_3687395_+	glucose-6-phosphate dehydrogenase assembly protein OpcA	NA	NA	NA	NA	NA
WP_019732675.1|3687391_3688147_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_003876065.1|3688187_3688586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019732674.1|3688604_3689534_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.1	2.2e-44
>prophage 222
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3703462	3705082	5626623		Staphylococcus_phage(100.0%)	1	NA	NA
WP_033718252.1|3703462_3705082_+	bile acid CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.4	7.9e-29
>prophage 223
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3716054	3718024	5626623		Streptococcus_phage(50.0%)	2	NA	NA
WP_024637268.1|3716054_3717119_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	36.2	1.7e-35
WP_009977630.1|3717127_3718024_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	32.3	3.8e-09
>prophage 224
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3722065	3727998	5626623		Staphylococcus_phage(75.0%)	6	NA	NA
WP_009977644.1|3722065_3722548_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.5	1.1e-13
WP_003872539.1|3722597_3723875_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.9	3.9e-92
WP_003872540.1|3723996_3724596_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.7	1.5e-30
WP_003877628.1|3724715_3725423_+	LppX_LprAFG lipoprotein	NA	NA	NA	NA	NA
WP_003872542.1|3725419_3726976_+	MFS transporter	NA	NA	NA	NA	NA
WP_011725427.1|3726972_3727998_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	5.3e-39
>prophage 225
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3735702	3736665	5626623		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_011725433.1|3735702_3736665_+	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	33.0	2.0e-24
>prophage 226
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3740874	3744551	5626623		Staphylococcus_phage(33.33%)	4	NA	NA
WP_008258192.1|3740874_3742086_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	54.7	8.6e-113
WP_011725438.1|3742180_3743455_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.7	3.0e-39
WP_009977666.1|3743476_3743803_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_023861214.1|3743879_3744551_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	32.6	1.3e-14
>prophage 227
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3750031	3753969	5626623		Halovirus(50.0%)	4	NA	NA
WP_009977672.1|3750031_3751153_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.8	8.4e-38
WP_009977674.1|3751149_3751662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009977676.1|3751723_3753016_-	dihydroorotase	NA	NA	NA	NA	NA
WP_003872564.1|3753012_3753969_-	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	33.6	2.3e-28
>prophage 228
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3759155	3759884	5626623		Bacillus_virus(100.0%)	1	NA	NA
WP_033710755.1|3759155_3759884_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	7.9e-29
>prophage 229
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3775332	3778203	5626623		Pandoravirus(50.0%)	2	NA	NA
WP_011725453.1|3775332_3776538_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.7	2.1e-47
WP_011725454.1|3776595_3778203_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.3e-20
>prophage 230
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3789364	3795088	5626623	tRNA	Klosneuvirus(50.0%)	5	NA	NA
WP_003872646.1|3789364_3792067_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.8	3.3e-64
WP_011725463.1|3792150_3792552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009977718.1|3792705_3793329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009977719.1|3793403_3793739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033720743.1|3793735_3795088_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.5	6.7e-82
>prophage 231
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3809207	3810086	5626623		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003872663.1|3809207_3810086_+	zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	49.8	7.0e-56
>prophage 232
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3819630	3820768	5626623	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_095762103.1|3819630_3820768_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.8	8.2e-33
>prophage 233
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3834279	3835026	5626623		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_023870431.1|3834279_3835026_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	35.9	1.7e-18
>prophage 234
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3845751	3850781	5626623		Streptococcus_phage(50.0%)	4	NA	NA
WP_033720768.1|3845751_3847341_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	23.3	7.7e-21
WP_023870417.1|3847488_3848589_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023870416.1|3848608_3849103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023870415.1|3849341_3850781_-	recombinase family protein	NA	A0A2D1GQ20	Mycobacterium_phage	37.4	3.0e-64
>prophage 235
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3855463	3863982	5626623		Indivirus(33.33%)	5	NA	NA
WP_031354192.1|3855463_3856351_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	34.6	6.5e-09
WP_009977758.1|3858036_3860403_-	RelA/SpoT family protein	NA	A0A2I2L310	Orpheovirus	37.9	5.7e-12
WP_019733885.1|3860446_3860989_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_081385951.1|3860996_3862670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023861193.1|3862674_3863982_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.6	1.3e-21
>prophage 236
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3867963	3873763	5626623		Catovirus(50.0%)	3	NA	NA
WP_033717270.1|3867963_3871485_+	carboxylic acid reductase	NA	A0A1V0SBX8	Catovirus	21.9	7.5e-16
WP_019733000.1|3871550_3872228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003872684.1|3872707_3873763_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	22.9	1.0e-05
>prophage 237
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3877218	3878790	5626623		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_033720784.1|3877218_3878790_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	30.1	1.8e-06
>prophage 238
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3886439	3888494	5626623	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_009977800.1|3886439_3888494_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	1.5e-104
>prophage 239
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3913369	3914917	5626623		Staphylococcus_phage(100.0%)	1	NA	NA
WP_033720802.1|3913369_3914917_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.9	3.8e-33
>prophage 240
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3940130	3940889	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_075362307.1|3940130_3940889_+	hypothetical protein	NA	A0A249XSS8	Mycobacterium_phage	37.1	1.0e-15
>prophage 241
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3948465	3949218	5626623		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_023861155.1|3948465_3949218_-	class I SAM-dependent methyltransferase	NA	A0A1B1IS97	uncultured_Mediterranean_phage	27.8	2.5e-06
>prophage 242
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3966708	3967173	5626623		Streptomyces_phage(100.0%)	1	NA	NA
WP_003875248.1|3966708_3967173_-	dUTP diphosphatase	NA	A0A2L1IVN2	Streptomyces_phage	51.8	6.8e-26
>prophage 243
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3970806	3986407	5626623		Cyanophage(33.33%)	19	NA	NA
WP_023861150.1|3970806_3972336_+	RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	34.3	4.5e-42
WP_033712701.1|3972439_3972847_+	endoribonuclease L-PSP	NA	NA	NA	NA	NA
WP_009977956.1|3972801_3973161_-	DUF952 domain-containing protein	NA	NA	NA	NA	NA
WP_003878617.1|3973284_3973470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003875238.1|3973535_3974537_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_085978474.1|3974537_3974786_-	DUF3039 domain-containing protein	NA	A0A059VGG3	Mycobacterium_phage	43.8	7.8e-13
WP_010949740.1|3974857_3975319_+	DUF3099 domain-containing protein	NA	NA	NA	NA	NA
WP_024637055.1|3975439_3976429_+	sigma-70 family RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	36.9	6.7e-39
WP_003875234.1|3976558_3977248_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_075362308.1|3977292_3978354_-	DUF4192 domain-containing protein	NA	NA	NA	NA	NA
WP_003878620.1|3978467_3979883_+	Si-specific NAD(P)(+) transhydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	1.1e-42
WP_011725564.1|3979887_3980724_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_011725565.1|3980953_3981928_+	PAC2 family protein	NA	NA	NA	NA	NA
WP_003875228.1|3981983_3983015_+	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	28.9	1.7e-16
WP_019732874.1|3983053_3983740_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_011725567.1|3983761_3984247_-	FABP family protein	NA	NA	NA	NA	NA
WP_003875225.1|3984285_3984750_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_011725568.1|3984901_3985396_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009977973.1|3985708_3986407_+	repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	49.2	6.0e-10
>prophage 244
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	3999541	4000594	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003875210.1|3999541_4000594_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	73.7	2.7e-131
>prophage 245
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4007529	4009854	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_033712756.1|4007529_4009854_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	59.7	4.3e-113
>prophage 246
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4014992	4022176	5626623		Gordonia_phage(50.0%)	8	NA	NA
WP_003878641.1|4014992_4015745_-	FAD-dependent thymidylate synthase	NA	A0A166Y9A6	Gordonia_phage	54.4	1.4e-49
WP_033720838.1|4015964_4017173_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019734301.1|4017203_4017938_-	cell division protein DivIVA	NA	NA	NA	NA	NA
WP_033720836.1|4018007_4018553_-	dihydrofolate reductase	NA	A0A1L7N103	Ralstonia_phage	42.9	2.0e-21
WP_019734500.1|4018549_4019350_-	thymidylate synthase	NA	A0A1B3AY68	Gordonia_phage	69.7	2.5e-108
WP_019734499.1|4019392_4020133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033725508.1|4020121_4021339_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_003875185.1|4021396_4022176_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.1	6.9e-07
>prophage 247
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4033232	4034228	5626623		Aureococcus_anophage(100.0%)	1	NA	NA
WP_019732521.1|4033232_4034228_-	Rieske 2Fe-2S domain-containing protein	NA	A0A076FFT9	Aureococcus_anophage	25.3	1.3e-05
>prophage 248
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4041816	4043139	5626623		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_085989681.1|4041816_4043139_-	insulinase family protein	NA	J3IZ03	Acanthamoeba_polyphaga_lentillevirus	23.8	8.4e-29
>prophage 249
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4059545	4062323	5626623		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003875145.1|4059545_4062323_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	5.0e-23
>prophage 250
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4068842	4070459	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003875137.1|4068842_4070459_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	32.4	8.1e-42
>prophage 251
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4078885	4080265	5626623		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_019734486.1|4078885_4080265_+	mycothione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	3.2e-31
>prophage 252
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4084349	4087200	5626623		Mollivirus(50.0%)	3	NA	NA
WP_003875123.1|4084349_4085123_-	3-oxoacyl-ACP reductase	NA	A0A0M4JSW6	Mollivirus	29.4	7.3e-09
WP_033720863.1|4085122_4086490_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_019734339.1|4086486_4087200_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A2P9FI75	Pseudomonas_phage	43.9	1.3e-07
>prophage 253
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4107874	4108714	5626623		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_033711953.1|4107874_4108714_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.7	4.5e-60
>prophage 254
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4113790	4114696	5626623		Brevibacillus_phage(100.0%)	1	NA	NA
WP_003875091.1|4113790_4114696_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	27.0	4.1e-19
>prophage 255
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4121275	4124418	5626623		Eastern_grey_kangaroopox_virus(50.0%)	4	NA	NA
WP_003878714.1|4121275_4122265_-	SDR family oxidoreductase	NA	A0A2C9DTC1	Eastern_grey_kangaroopox_virus	29.7	2.8e-05
WP_003875078.1|4122553_4123324_+	GAF and ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_003875077.1|4123330_4123636_-	DUF2469 domain-containing protein	NA	NA	NA	NA	NA
WP_009978160.1|4123698_4124418_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	36.8	1.5e-19
>prophage 256
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4136861	4138601	5626623		Saccharomonospora_phage(100.0%)	1	NA	NA
WP_011725666.1|4136861_4138601_+	DEAD/DEAH box helicase	NA	I4AZM6	Saccharomonospora_phage	38.3	5.9e-91
>prophage 257
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4143021	4144308	5626623		uncultured_phage(100.0%)	1	NA	NA
WP_009978180.1|4143021_4144308_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	36.4	1.6e-13
>prophage 258
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4149708	4151294	5626623		Bacillus_phage(50.0%)	2	NA	NA
WP_009978189.1|4149708_4150560_-	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	26.1	2.8e-17
WP_009978190.1|4150580_4151294_-	ribonuclease III	NA	A0A2K9R4Y7	Dishui_lake_phycodnavirus	36.2	4.5e-21
>prophage 259
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4157647	4164909	5626623	transposase	uncultured_virus(25.0%)	7	NA	NA
WP_011724668.1|4157647_4158922_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.0	2.9e-34
WP_003875043.1|4159945_4160428_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	30.6	1.6e-17
WP_033710562.1|4160549_4161104_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_023868348.1|4161114_4161750_-	vitamin K epoxide reductase family protein	NA	NA	NA	NA	NA
WP_023868347.1|4161746_4162514_-	DsbA family protein	NA	NA	NA	NA	NA
WP_075362312.1|4162609_4163731_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	32.0	1.8e-32
WP_009978202.1|4164120_4164909_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	6.1e-51
>prophage 260
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4175585	4176269	5626623		Pandoravirus(100.0%)	1	NA	NA
WP_011725701.1|4175585_4176269_-	uracil-DNA glycosylase	NA	S4VZ65	Pandoravirus	40.0	4.8e-36
>prophage 261
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4184315	4184954	5626623		Streptomyces_phage(100.0%)	1	NA	NA
WP_009978231.1|4184315_4184954_-	HU family DNA-binding protein	NA	A0A2P1N0A2	Streptomyces_phage	45.4	6.3e-14
>prophage 262
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4193748	4195335	5626623		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_033720891.1|4193748_4195335_-	phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	36.2	1.3e-36
>prophage 263
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4199027	4200905	5626623		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_145929623.1|4199027_4200905_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	28.1	4.8e-54
>prophage 264
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4206691	4207723	5626623		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_003874997.1|4206691_4207723_-	6-phosphofructokinase	NA	H8ZJH0	Ostreococcus_tauri_virus	28.5	4.0e-10
>prophage 265
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4216724	4222895	5626623	tRNA	Ralstonia_phage(50.0%)	5	NA	NA
WP_003874986.1|4216724_4218806_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	37.2	2.6e-101
WP_033712630.1|4218860_4219889_-	methionine synthase	NA	NA	NA	NA	NA
WP_003874984.1|4219987_4220632_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_023896132.1|4220639_4221716_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_033712627.1|4221716_4222895_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.2	8.5e-33
>prophage 266
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4235316	4236549	5626623	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_011725525.1|4235316_4236549_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
>prophage 267
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4247973	4249302	5626623		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_033717665.1|4247973_4249302_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	29.5	3.0e-50
>prophage 268
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4256454	4257297	5626623		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_033717668.1|4256454_4257297_-	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	28.4	9.8e-07
>prophage 269
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4261751	4264259	5626623		Tupanvirus(50.0%)	3	NA	NA
WP_023896001.1|4261751_4262792_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	42.2	3.9e-74
WP_011725751.1|4262802_4263216_-	DUF3349 domain-containing protein	NA	NA	NA	NA	NA
WP_003874940.1|4263296_4264259_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	84.6	4.2e-155
>prophage 270
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4267967	4274539	5626623		Bacillus_phage(33.33%)	7	NA	NA
WP_024636978.1|4267967_4270133_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.6	7.4e-208
WP_003874934.1|4270102_4270555_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	37.7	1.7e-13
WP_003874933.1|4270597_4270837_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	64.5	2.0e-21
WP_003874932.1|4271366_4271921_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.6	5.4e-06
WP_033712612.1|4272014_4272629_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023895998.1|4272628_4273672_+	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	28.2	8.6e-21
WP_023895997.1|4273606_4274539_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	35.9	4.6e-05
>prophage 271
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4289712	4291230	5626623		Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_011725767.1|4289712_4291230_+	Hsp70 family protein	NA	M4R062	Micromonas_pusilla_virus	29.7	3.1e-19
>prophage 272
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4304383	4308558	5626623		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_033712601.1|4304383_4307266_+	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	26.6	7.5e-06
WP_023868298.1|4307274_4308558_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	36.0	3.4e-67
>prophage 273
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4311700	4313259	5626623		Diadromus_pulchellus_ascovirus(50.0%)	2	NA	NA
WP_009978371.1|4311700_4312441_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	32.7	3.7e-18
WP_009978372.1|4312437_4313259_-	iron-sulfur cluster-binding domain-containing protein	NA	A0A1D7SNA5	Cyanophage	39.0	7.8e-09
>prophage 274
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4318921	4319305	5626623		Gordonia_phage(100.0%)	1	NA	NA
WP_009978380.1|4318921_4319305_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	51.2	2.2e-22
>prophage 275
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4322734	4323133	5626623		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_011725788.1|4322734_4323133_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	35.6	9.6e-05
>prophage 276
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4327648	4329124	5626623		Microcystis_phage(100.0%)	1	NA	NA
WP_033710390.1|4327648_4329124_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.5	7.4e-50
>prophage 277
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4334399	4338306	5626623		Mycobacterium_phage(50.0%)	4	NA	NA
WP_033710385.1|4334399_4335893_-	serine hydrolase	NA	G1DHW3	Mycobacterium_phage	26.8	2.1e-12
WP_033710384.1|4335912_4336596_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011725800.1|4336622_4337129_+	DUF2505 domain-containing protein	NA	NA	NA	NA	NA
WP_033710382.1|4337139_4338306_+	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	42.2	5.5e-08
>prophage 278
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4346947	4349043	5626623		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003874853.1|4346947_4347457_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.7	2.2e-33
WP_003874852.1|4347459_4348353_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003874851.1|4348353_4349043_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.1	7.9e-31
>prophage 279
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4358119	4358917	5626623		Niemeyer_virus(100.0%)	1	NA	NA
WP_003874841.1|4358119_4358917_+	slipin family protein	NA	A0A0U2UF06	Niemeyer_virus	29.2	2.0e-25
>prophage 280
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4407485	4408436	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_011725850.1|4407485_4408436_-	alpha/beta hydrolase	NA	A0A249XPN5	Mycobacterium_phage	28.0	1.9e-06
>prophage 281
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4415692	4417813	5626623		Tupanvirus(100.0%)	1	NA	NA
WP_031343697.1|4415692_4417813_+	catalase	NA	A0A2K9L0T1	Tupanvirus	49.2	1.5e-141
>prophage 282
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4428498	4438747	5626623		Tupanvirus(20.0%)	9	NA	NA
WP_033725529.1|4428498_4429641_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9KZK0	Tupanvirus	39.2	4.8e-57
WP_075362320.1|4429652_4431293_+	carbamoyltransferase	NA	A0A1B1IVF2	uncultured_Mediterranean_phage	30.1	1.4e-49
WP_062886735.1|4431289_4432780_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_009978544.1|4432788_4433808_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011725868.1|4433804_4434374_+	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	30.1	1.9e-09
WP_062887170.1|4434370_4435780_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A0F7LBI5	uncultured_marine_virus	34.4	1.1e-10
WP_033720948.1|4435794_4436490_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033720959.1|4436480_4437446_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_023864986.1|4437442_4438747_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	M1I9L6	Paramecium_bursaria_Chlorella_virus	29.6	1.7e-26
>prophage 283
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4468923	4472175	5626623		Catovirus(100.0%)	1	NA	NA
WP_062886744.1|4468923_4472175_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	24.5	1.9e-10
>prophage 284
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4478888	4482402	5626623	transposase	Bordetella_phage(50.0%)	4	NA	NA
WP_033720962.1|4478888_4479836_+	GGDEF domain-containing protein	NA	A0A2D0WBV8	Bordetella_phage	35.1	3.1e-09
WP_033725343.1|4479897_4481106_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_033725531.1|4481353_4481890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023895912.1|4481913_4482402_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	35.5	1.7e-11
>prophage 285
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4491588	4500301	5626623		Mycobacterium_phage(33.33%)	6	NA	NA
WP_011725907.1|4491588_4491861_-	WhiB family transcriptional regulator	NA	A0A2P1JRB7	Mycobacterium_phage	49.0	3.1e-07
WP_033718500.1|4492297_4494418_-	ATP-dependent DNA helicase UvrD2	NA	A0A1V0SDG5	Indivirus	21.5	1.5e-11
WP_003874629.1|4494654_4494909_+	mycoredoxin Mrx1	NA	NA	NA	NA	NA
WP_009978652.1|4494917_4495850_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_009978654.1|4495849_4496920_-	potassium channel family protein	NA	NA	NA	NA	NA
WP_033725748.1|4497010_4500301_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	20.8	9.1e-08
>prophage 286
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4511236	4514939	5626623		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	3	NA	NA
WP_033725533.1|4511236_4512754_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.5	3.8e-41
WP_033720973.1|4512771_4513998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003874613.1|4514138_4514939_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	28.0	2.9e-16
>prophage 287
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4519038	4522581	5626623		Mycobacterium_phage(50.0%)	6	NA	NA
WP_003874607.1|4519038_4519293_+	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	43.9	1.5e-11
WP_011725921.1|4519362_4520862_-	ATPase	NA	NA	NA	NA	NA
WP_003874604.1|4520890_4521106_-	biotin/lipoyl-binding carrier protein	NA	NA	NA	NA	NA
WP_085976515.1|4521382_4521457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010949924.1|4521463_4521778_-	mycothiol system anti-sigma-R factor	NA	NA	NA	NA	NA
WP_011725922.1|4521774_4522581_-	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	26.5	6.5e-08
>prophage 288
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4525864	4526614	5626623		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_011725926.1|4525864_4526614_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.9	5.1e-15
>prophage 289
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4558968	4563701	5626623		Bacillus_phage(66.67%)	4	NA	NA
WP_080576384.1|4558968_4560666_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.2	6.5e-18
WP_033725540.1|4560724_4561411_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	1.2e-39
WP_019733463.1|4561491_4562124_-	dTMP kinase	NA	NA	NA	NA	NA
WP_003874564.1|4562210_4563701_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	28.6	4.1e-40
>prophage 290
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4574092	4574431	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_011725952.1|4574092_4574431_-	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	77.5	2.4e-28
>prophage 291
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4579390	4580467	5626623		Enterobacteria_phage(100.0%)	1	NA	NA
WP_011725957.1|4579390_4580467_-	NDP-sugar synthase	NA	I7I009	Enterobacteria_phage	26.5	1.1e-15
>prophage 292
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4584954	4597846	5626623		Streptococcus_phage(25.0%)	10	NA	NA
WP_023895857.1|4584954_4587135_+	manganese-exporting P-type ATPase CtpC	NA	E4ZFI9	Streptococcus_phage	31.5	1.2e-72
WP_033718468.1|4587291_4588206_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_019733485.1|4588217_4589438_+	CoA transferase	NA	NA	NA	NA	NA
WP_019733486.1|4589441_4591412_-	protein kinase	NA	A0A285PXP1	Cedratvirus	29.0	4.9e-09
WP_023895854.1|4591463_4592561_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_003874535.1|4592695_4593136_-	response regulator	NA	NA	NA	NA	NA
WP_033718466.1|4593132_4594740_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.3	2.3e-12
WP_031353825.1|4594736_4595882_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_003878960.1|4596136_4597306_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003874531.1|4597324_4597846_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	47.7	1.0e-22
>prophage 293
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4609373	4613334	5626623		Bacillus_phage(50.0%)	5	NA	NA
WP_003878969.1|4609373_4610162_-	RNA polymerase sigma factor SigF	NA	A0A218KDJ1	Bacillus_phage	25.0	4.1e-15
WP_003878970.1|4610158_4610596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003874516.1|4611041_4611353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003874515.1|4611413_4611797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075362326.1|4611993_4613334_-	L-lysine 6-transaminase	NA	A0A1V0SKB7	Klosneuvirus	46.0	2.0e-115
>prophage 294
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4622035	4622788	5626623		Bacillus_virus(100.0%)	1	NA	NA
WP_023895848.1|4622035_4622788_+	Fpg/Nei family DNA glycosylase	NA	G3MA33	Bacillus_virus	26.7	3.7e-05
>prophage 295
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4625866	4627003	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_075362331.1|4625866_4627003_-	PPE family protein	NA	V5UPR1	Mycobacterium_phage	28.9	1.8e-08
>prophage 296
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4637078	4638659	5626623		Streptococcus_phage(100.0%)	1	NA	NA
WP_009978812.1|4637078_4638659_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	29.4	1.9e-43
>prophage 297
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4643765	4645013	5626623	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_031349784.1|4643765_4645013_-|transposase	IS256-like element IS1601 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.9	9.8e-80
>prophage 298
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4648275	4649559	5626623		Geobacillus_virus(100.0%)	1	NA	NA
WP_019733601.1|4648275_4649559_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	43.1	3.0e-76
>prophage 299
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4655333	4658365	5626623		Klosneuvirus(50.0%)	3	NA	NA
WP_009978831.1|4655333_4656665_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.4	4.5e-14
WP_003874473.1|4656639_4656891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033721007.1|4657105_4658365_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	31.7	2.2e-10
>prophage 300
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4668234	4669605	5626623		Pandoravirus(100.0%)	1	NA	NA
WP_009978841.1|4668234_4669605_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	25.7	2.3e-13
>prophage 301
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4676363	4681476	5626623		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_033726039.1|4676363_4678979_+	FHA domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	35.7	5.3e-27
WP_031348302.1|4679016_4681476_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.6	9.8e-23
>prophage 302
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4688193	4691475	5626623		Streptomyces_phage(100.0%)	1	NA	NA
WP_033712587.1|4688193_4691475_-	error-prone DNA polymerase	NA	A0A1C9LWS4	Streptomyces_phage	32.3	5.7e-119
>prophage 303
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4705136	4706714	5626623		Hokovirus(100.0%)	1	NA	NA
WP_003879026.1|4705136_4706714_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	26.0	7.2e-11
>prophage 304
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4718034	4719630	5626623		Klosneuvirus(100.0%)	1	NA	NA
WP_003874394.1|4718034_4719630_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.0	2.6e-85
>prophage 305
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4722873	4723182	5626623		Mycobacterium_virus(100.0%)	1	NA	NA
WP_003874400.1|4722873_4723182_+	WhiB family transcriptional regulator	NA	I6XD27	Mycobacterium_virus	42.9	2.6e-10
>prophage 306
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4726858	4731718	5626623	tRNA	uncultured_virus(50.0%)	4	NA	NA
WP_019732444.1|4726858_4728385_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	31.2	8.2e-20
WP_003873390.1|4728479_4730096_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	51.3	6.0e-138
WP_019732443.1|4730184_4730487_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	3.3e-21
WP_019732442.1|4730692_4731718_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A291ATS8	Pandoravirus	36.2	2.5e-33
>prophage 307
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4740358	4742233	5626623		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003879511.1|4740358_4742233_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	36.1	1.3e-96
>prophage 308
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4751225	4757602	5626623	protease	Mycobacterium_phage(100.0%)	3	NA	NA
WP_033725557.1|4751225_4754819_-	type VII secretion protein EccCb	NA	V5UPA0	Mycobacterium_phage	31.1	8.3e-63
WP_033712966.1|4754948_4756307_+	type VII secretion integral membrane protein EccD	NA	NA	NA	NA	NA
WP_104123821.1|4756303_4757602_+|protease	type VII secretion system ESX-4 serine protease mycosin MycP4	protease	V5UPA7	Mycobacterium_phage	35.7	4.8e-45
>prophage 309
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4767139	4772517	5626623		Burkholderia_phage(60.0%)	5	NA	NA
WP_003873450.1|4767139_4768135_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.5	9.9e-75
WP_003873451.1|4768136_4768742_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	41.9	1.9e-28
WP_003873452.1|4768974_4770099_+	acyltransferase	NA	A9YX16	Burkholderia_phage	29.3	1.3e-17
WP_009979002.1|4770198_4771344_+	acyltransferase	NA	A9YX16	Burkholderia_phage	28.9	2.5e-21
WP_033721058.1|4771428_4772517_+	acyltransferase	NA	A9YX16	Burkholderia_phage	31.0	1.1e-21
>prophage 310
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4781193	4782252	5626623		Faustovirus(100.0%)	1	NA	NA
WP_003873466.1|4781193_4782252_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X7QHI1	Faustovirus	28.1	9.1e-10
>prophage 311
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4785765	4786461	5626623		Planktothrix_phage(100.0%)	1	NA	NA
WP_019734455.1|4785765_4786461_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	1.5e-32
>prophage 312
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4793583	4794129	5626623		Tupanvirus(100.0%)	1	NA	NA
WP_003873479.1|4793583_4794129_-	adenylate kinase	NA	A0A2K9L833	Tupanvirus	33.8	1.4e-14
>prophage 313
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4798657	4799638	5626623		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_019732539.1|4798657_4799638_+	3-phosphoglycerate dehydrogenase	NA	M1GWB3	Acanthocystis_turfacea_Chlorella_virus	27.6	1.1e-20
>prophage 314
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4814343	4815234	5626623		Microcystis_virus(100.0%)	1	NA	NA
WP_019734369.1|4814343_4815234_-	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	31.5	4.0e-19
>prophage 315
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4826639	4828079	5626623		Catovirus(100.0%)	1	NA	NA
WP_075362338.1|4826639_4828079_-	mycofactocin system GMC family oxidoreductase MftG	NA	A0A1V0S9J5	Catovirus	26.5	6.6e-11
>prophage 316
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4834969	4835830	5626623		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011726085.1|4834969_4835830_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	3.3e-50
>prophage 317
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4841118	4844585	5626623		Hokovirus(50.0%)	2	NA	NA
WP_003873538.1|4841118_4842309_-	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	27.4	1.1e-30
WP_003879424.1|4842479_4844585_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	3.1e-62
>prophage 318
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4852604	4861515	5626623		Vibrio_phage(33.33%)	3	NA	NA
WP_011726094.1|4852604_4856555_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.6	2.1e-51
WP_085978600.1|4856599_4860109_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	22.7	7.4e-40
WP_003873552.1|4860504_4861515_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.8e-24
>prophage 319
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4872235	4876415	5626623		Micromonas_pusilla_virus(33.33%)	4	NA	NA
WP_003879413.1|4872235_4873570_+	AarF/ABC1/UbiB kinase family protein	NA	G8DDN0	Micromonas_pusilla_virus	28.3	1.3e-32
WP_033721111.1|4873578_4874484_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003873564.1|4874573_4875434_+	methyltransferase domain-containing protein	NA	A0A2K9L4K8	Tupanvirus	29.1	1.1e-24
WP_003873565.1|4875518_4876415_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	28.9	2.7e-23
>prophage 320
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4889068	4891944	5626623		Tupanvirus(33.33%)	4	NA	NA
WP_019732801.1|4889068_4890091_-	patatin-like phospholipase family protein	NA	A0A2K9L3A4	Tupanvirus	23.4	5.9e-06
WP_019732802.1|4890091_4890559_-	cyanase	NA	NA	NA	NA	NA
WP_033710822.1|4890627_4891377_-	methyltransferase domain-containing protein	NA	A0A097BYE1	Leuconostoc_phage	33.7	7.3e-22
WP_003873585.1|4891428_4891944_-	nitroreductase	NA	A0A1V0E011	Clostridioides_phage	27.2	1.7e-09
>prophage 321
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4896402	4901426	5626623		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_011726111.1|4896402_4899705_+	exodeoxyribonuclease V subunit beta	NA	E3T5J8	Cafeteria_roenbergensis_virus	20.2	3.5e-07
WP_023862214.1|4899701_4901426_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.3	2.0e-14
>prophage 322
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4927284	4928154	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003873613.1|4927284_4928154_-	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	29.4	5.9e-15
>prophage 323
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4933448	4937363	5626623	transposase	Burkholderia_virus(50.0%)	3	NA	NA
WP_085989547.1|4933448_4934709_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.5	7.2e-70
WP_023900665.1|4934914_4935856_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011725525.1|4936130_4937363_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
>prophage 324
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4955122	4956724	5626623		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011726142.1|4955122_4956724_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.4	8.9e-25
>prophage 325
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4970911	4971940	5626623		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_019734045.1|4970911_4971940_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4UUK0	Bodo_saltans_virus	26.2	4.7e-19
>prophage 326
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	4990949	4995353	5626623		Gordonia_phage(50.0%)	3	NA	NA
WP_033721160.1|4990949_4993070_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	33.9	1.2e-72
WP_003873686.1|4993259_4993949_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_023900637.1|4994039_4995353_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	25.7	1.1e-15
>prophage 327
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5010436	5011486	5626623	integrase	Gordonia_phage(100.0%)	1	5007380:5007439	5013701:5013808
5007380:5007439	attL	CCAGCGAGCCCGCCCGGCCGCCGAACCGTCAACGCCCCCACGCCGTCTGCCCGATAGGGT	NA	NA	NA	NA
WP_007172498.1|5010436_5011486_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_007172498.1|5010436_5011486_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
5013701:5013808	attR	CCAGCGAGCCCGCCCGGCCGCCGAACCGTCAACGCCCCCACGCCGTCTGCCCGATAGGGTTGGATATCGGGCACCCGCTGGGTCGCCAGGCAGCACAGCGATCTAGGA	NA	NA	NA	NA
>prophage 328
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5015295	5020044	5626623		Tupanvirus(50.0%)	6	NA	NA
WP_003873706.1|5015295_5016195_+	methyltransferase domain-containing protein	NA	A0A2K9L4K8	Tupanvirus	30.8	1.7e-25
WP_023900633.1|5016275_5017340_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003873708.1|5017345_5018473_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003402602.1|5018524_5018626_-	AURKAIP1/COX24 domain-containing protein	NA	NA	NA	NA	NA
WP_010950195.1|5018760_5019018_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033721168.1|5019156_5020044_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.1	3.5e-23
>prophage 329
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5026143	5028212	5626623		Bacillus_phage(100.0%)	2	NA	NA
WP_003873718.1|5026143_5026827_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	2.6e-42
WP_023900628.1|5026982_5028212_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.1	4.7e-26
>prophage 330
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5043466	5045212	5626623		Tupanvirus(100.0%)	2	NA	NA
WP_009979325.1|5043466_5044333_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	32.9	2.0e-31
WP_003873739.1|5044351_5045212_-	methyltransferase domain-containing protein	NA	A0A2K9L4K8	Tupanvirus	34.2	3.4e-31
>prophage 331
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5051177	5052575	5626623		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003873752.1|5051177_5052575_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	5.5e-47
>prophage 332
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5071352	5072978	5626623		uncultured_virus(100.0%)	1	NA	NA
WP_009979353.1|5071352_5072978_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	56.2	5.4e-155
>prophage 333
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5079398	5081567	5626623		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_011726205.1|5079398_5081567_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	40.1	3.1e-36
>prophage 334
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5087725	5088034	5626623		Gordonia_phage(100.0%)	1	NA	NA
WP_003873790.1|5087725_5088034_-	DUF3263 domain-containing protein	NA	A0A1B3AZ99	Gordonia_phage	44.9	4.2e-08
>prophage 335
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5103080	5103848	5626623		Gordonia_phage(100.0%)	1	NA	NA
WP_011726220.1|5103080_5103848_-	SGNH/GDSL hydrolase family protein	NA	A0A160DD06	Gordonia_phage	34.5	4.7e-08
>prophage 336
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5109730	5112022	5626623		Myeloproliferative_sarcoma_virus(100.0%)	1	NA	NA
WP_023862161.1|5109730_5112022_+	protein kinase	NA	Q83745	Myeloproliferative_sarcoma_virus	28.7	3.0e-10
>prophage 337
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5137135	5142159	5626623	protease	Pandoravirus(50.0%)	5	NA	NA
WP_003873842.1|5137135_5138434_-	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	35.3	1.8e-68
WP_019734062.1|5138541_5139483_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_033710584.1|5139779_5140430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011726245.1|5140439_5141222_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_019732919.1|5141262_5142159_+	cation transporter	NA	A0A1V0SED0	Indivirus	32.5	2.6e-05
>prophage 338
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5148478	5153394	5626623		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_033717752.1|5148478_5149018_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	45.6	2.5e-16
WP_023869989.1|5149004_5149778_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003873856.1|5149834_5150707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003873857.1|5150847_5153394_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.5	4.0e-120
>prophage 339
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5163354	5171981	5626623		uncultured_virus(33.33%)	5	NA	NA
WP_075362404.1|5163354_5167653_-	AAA family ATPase	NA	A0A218MLZ2	uncultured_virus	33.3	2.5e-13
WP_003873870.1|5167795_5168191_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003879233.1|5168190_5169369_-	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	27.4	3.6e-15
WP_011726264.1|5169429_5170113_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_009979480.1|5170109_5171981_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.3	1.9e-143
>prophage 340
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5189522	5193006	5626623		Enterobacteria_phage(50.0%)	4	NA	NA
WP_003879222.1|5189522_5190398_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	55.6	2.3e-91
WP_009979496.1|5190425_5190800_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_024637549.1|5190829_5191585_-	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
WP_023866914.1|5191680_5193006_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.5	2.2e-69
>prophage 341
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5199870	5201060	5626623		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_003873894.1|5199870_5200443_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	77.4	1.3e-79
WP_088294917.1|5200472_5201060_-	hypothetical protein	NA	A0A1J0MBM2	Mycobacterium_phage	45.7	1.1e-20
>prophage 342
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5206907	5207612	5626623	integrase	Rhodococcus_phage(100.0%)	1	5201283:5201324	5207642:5207683
5201283:5201324	attL	GCCGATGTAGTTCAATGGCAGAACATCAGCTTCCCAAGCTGA	NA	NA	NA	NA
WP_080576389.1|5206907_5207612_+|integrase	site-specific integrase	integrase	G9FGY1	Rhodococcus_phage	54.9	4.7e-55
WP_080576389.1|5206907_5207612_+|integrase	site-specific integrase	integrase	G9FGY1	Rhodococcus_phage	54.9	4.7e-55
5207642:5207683	attR	GCCGATGTAGTTCAATGGCAGAACATCAGCTTCCCAAGCTGA	NA	NA	NA	NA
>prophage 343
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5234510	5235917	5626623	protease	Mycobacterium_phage(100.0%)	1	NA	NA
WP_011726295.1|5234510_5235917_-|protease	type VII secretion system ESX-3 serine protease mycosin MycP3	protease	V5UPA7	Mycobacterium_phage	40.2	1.0e-69
>prophage 344
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5240803	5248229	5626623		Mycobacterium_phage(100.0%)	3	NA	NA
WP_023866890.1|5240803_5244769_-	type VII secretion protein EccC	NA	V5UPA0	Mycobacterium_phage	26.6	1.2e-94
WP_011726301.1|5244765_5246400_-	type VII secretion protein EccB	NA	NA	NA	NA	NA
WP_085989582.1|5246396_5248229_-	type VII secretion system ESX-3 AAA family ATPase EccA3	NA	V5UQM2	Mycobacterium_phage	41.6	3.9e-101
>prophage 345
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5268048	5269734	5626623		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011726316.1|5268048_5269734_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	27.9	7.9e-24
>prophage 346
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5280842	5282075	5626623	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_011725525.1|5280842_5282075_-|transposase	IS256-like element IS1245 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	51.5	2.5e-112
>prophage 347
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5286940	5288881	5626623		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_033710768.1|5286940_5288881_+	fumarate reductase/succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	27.6	3.8e-22
>prophage 348
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5307352	5314392	5626623		Tupanvirus(75.0%)	5	NA	NA
WP_033710772.1|5307352_5309149_-	GMC family oxidoreductase	NA	A0A2K9L353	Tupanvirus	24.3	4.6e-30
WP_023895710.1|5309369_5310824_-	catalase	NA	A0A2K9L0T1	Tupanvirus	42.5	1.7e-83
WP_023895711.1|5310849_5312307_-	catalase	NA	A0A2K9L0T1	Tupanvirus	42.4	2.7e-89
WP_033710773.1|5312386_5312686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033710780.1|5313237_5314392_+	NAD-dependent formate dehydrogenase	NA	M1H214	Paramecium_bursaria_Chlorella_virus	32.1	2.0e-18
>prophage 349
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5318433	5320080	5626623		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_009979643.1|5318433_5320080_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	24.3	7.5e-35
>prophage 350
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5335611	5340804	5626623		Hepacivirus(50.0%)	4	NA	NA
WP_009979659.1|5335611_5337141_-	long-chain fatty acid--CoA ligase	NA	Q75ZG1	Hepacivirus	29.4	7.2e-32
WP_024637113.1|5337228_5338014_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011726348.1|5338153_5339563_-	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003874080.1|5339607_5340804_-	alpha/beta hydrolase	NA	A0A088FQA2	Mycobacterium_phage	40.1	6.6e-49
>prophage 351
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5369019	5374273	5626623	holin	Klosneuvirus(100.0%)	4	NA	NA
WP_011726364.1|5369019_5371008_+	peptidase M13	NA	A0A1V0SHG2	Klosneuvirus	27.7	3.2e-80
WP_011726365.1|5371041_5371557_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_024637103.1|5371704_5372580_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031347595.1|5372761_5374273_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.4	7.3e-53
>prophage 352
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5386742	5387396	5626623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_019733626.1|5386742_5387396_-	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	48.3	5.0e-43
>prophage 353
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5414020	5421726	5626623		Staphylococcus_phage(33.33%)	7	NA	NA
WP_033721296.1|5414020_5415607_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.6	1.1e-32
WP_003874167.1|5416476_5416917_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_023879447.1|5416960_5417446_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_033721277.1|5417460_5418573_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	29.9	3.1e-32
WP_003879085.1|5418569_5419487_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023860793.1|5419483_5420998_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011726476.1|5420979_5421726_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.2	1.1e-12
>prophage 354
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5435403	5436144	5626623		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003874189.1|5435403_5436144_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.4	9.2e-17
>prophage 355
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5458267	5459584	5626623		Cotesia_sesamiae_Mombasa_bracovirus(100.0%)	1	NA	NA
WP_033712344.1|5458267_5459584_-	cytochrome P450	NA	I6WI04	Cotesia_sesamiae_Mombasa_bracovirus	23.8	6.4e-21
>prophage 356
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5468076	5468682	5626623		Human_cytomegalovirus(100.0%)	1	NA	NA
WP_019733143.1|5468076_5468682_-	GNAT family N-acetyltransferase	NA	C5MKY6	Human_cytomegalovirus	34.0	2.5e-20
>prophage 357
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5475575	5478509	5626623		Staphylococcus_phage(50.0%)	3	NA	NA
WP_019732430.1|5475575_5476418_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	9.8e-15
WP_019732431.1|5476407_5477226_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_033725682.1|5477459_5478509_+	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	68.4	7.1e-124
>prophage 358
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5482617	5483703	5626623	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_033712334.1|5482617_5483703_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	23.9	3.7e-06
>prophage 359
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5489931	5491674	5626623		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_033712313.1|5489931_5491674_+	oxalyl-CoA decarboxylase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	26.6	1.1e-28
>prophage 360
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5499321	5501316	5626623		Gordonia_phage(100.0%)	1	NA	NA
WP_033717517.1|5499321_5501316_-	acyltransferase	NA	A0A166XZF2	Gordonia_phage	32.5	2.8e-36
>prophage 361
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5513628	5525322	5626623		Tupanvirus(25.0%)	8	NA	NA
WP_019733566.1|5513628_5515245_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	24.2	3.5e-05
WP_010949992.1|5515237_5516020_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_031343567.1|5516028_5517171_-	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	8.8e-27
WP_009979864.1|5517256_5517751_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_031343569.1|5517837_5518209_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_029245110.1|5518252_5518474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023860836.1|5518905_5523750_+	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	26.8	2.5e-38
WP_033721293.1|5523756_5525322_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.4	4.6e-26
>prophage 362
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5547283	5549572	5626623		uncultured_virus(100.0%)	1	NA	NA
WP_033712260.1|5547283_5549572_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.4	6.0e-83
>prophage 363
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5575290	5576184	5626623		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_011726574.1|5575290_5576184_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	28.6	3.2e-08
>prophage 364
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5594443	5596770	5626623		Mycobacterium_phage(50.0%)	2	NA	NA
WP_009979957.1|5594443_5595931_-	type VII secretion protein EccB	NA	V5UN45	Mycobacterium_phage	36.7	2.6e-71
WP_033724977.1|5595933_5596770_-	DUF4226 domain-containing protein	NA	G9FHI5	Rhodococcus_phage	39.2	8.2e-14
>prophage 365
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5604551	5605994	5626623	tRNA	Mycobacterium_phage(100.0%)	1	NA	NA
WP_023862108.1|5604551_5605994_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A249XS88	Mycobacterium_phage	36.9	3.1e-61
>prophage 366
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5616783	5618144	5626623		Orpheovirus(50.0%)	2	NA	NA
WP_033712217.1|5616783_5617794_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	48.5	6.3e-69
WP_003874359.1|5617790_5618144_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	57.7	3.3e-25
>prophage 367
NZ_CP018363	Mycobacterium avium subsp. hominissuis strain H87 chromosome, complete genome	5626623	5621551	5622544	5626623		Natrialba_phage(100.0%)	1	NA	NA
WP_088295280.1|5621551_5622544_-	ParA family protein	NA	Q8JL10	Natrialba_phage	33.9	1.6e-24
