The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018175	Corynebacterium glutamicum strain XV chromosome, complete genome	3333639	449268	486969	3333639	transposase	Catovirus(20.0%)	22	NA	NA
WP_065366598.1|449268_450534_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	97.6	7.8e-234
WP_075348072.1|451837_454489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155761551.1|454528_455395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075348073.1|455432_456809_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_060563805.1|457027_457912_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077311031.1|458039_458762_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_075348074.1|460705_461128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089158484.1|461515_466045_-	glycosyltransferase	NA	A0A1V0SAE6	Catovirus	31.6	2.3e-33
WP_060563814.1|466375_467629_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	25.0	8.8e-20
WP_081302975.1|470945_473138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060563823.1|473180_474089_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060563825.1|474367_475555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075348077.1|475589_478817_+	glycosyltransferase	NA	A0A1V0SAE6	Catovirus	28.3	6.8e-32
WP_081299819.1|479075_479360_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060563542.1|479407_480718_-|transposase	ISL3-like element IS13869 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	44.2	2.5e-86
WP_089158485.1|481227_481566_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_152024167.1|481379_482162_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.6	5.9e-14
WP_152024168.1|482139_483341_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	1.2e-26
WP_075348078.1|483399_483579_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	49.1	2.4e-08
WP_075348079.1|483718_484054_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075348475.1|484489_485899_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.2	1.1e-45
WP_075348476.1|486090_486969_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.9	9.4e-45
>prophage 2
NZ_CP018175	Corynebacterium glutamicum strain XV chromosome, complete genome	3333639	1492302	1554787	3333639	transposase,integrase	Shigella_phage(18.18%)	57	1545411:1545462	1560331:1560382
WP_081378006.1|1492302_1493550_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_075348190.1|1495659_1496895_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_065366844.1|1496891_1499978_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	29.3	1.8e-58
WP_081299843.1|1499961_1500708_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_075348191.1|1500749_1502381_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060564452.1|1502377_1503475_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060564454.1|1504369_1505335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564455.1|1505335_1505617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155762128.1|1506485_1507325_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_060564456.1|1507405_1508329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366846.1|1508462_1509875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564458.1|1509969_1511196_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_080506418.1|1511861_1512119_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060564459.1|1512226_1513381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011014272.1|1513377_1513704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366847.1|1513700_1515464_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_107111918.1|1515802_1516093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060565493.1|1516632_1516962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034983522.1|1517240_1518551_+|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
WP_065366848.1|1518636_1521024_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	47.7	6.4e-19
WP_003861489.1|1521219_1521378_-	hypothetical protein	NA	A0A1V0SKJ6	Klosneuvirus	60.0	8.2e-08
WP_065366849.1|1521435_1522845_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_075348192.1|1522952_1523705_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_060564463.1|1523754_1524234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564464.1|1524294_1524861_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	36.8	1.6e-08
WP_003861499.1|1524843_1525551_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060564465.1|1525804_1527250_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_060564466.1|1527268_1527862_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_075348193.1|1528208_1529288_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003858852.1|1529296_1529455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858849.1|1529496_1530495_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_060564468.1|1530519_1531602_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_060564469.1|1531658_1532639_-	DUF3515 domain-containing protein	NA	NA	NA	NA	NA
WP_060564470.1|1532706_1533696_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_060564471.1|1533695_1534445_+	uracil-DNA glycosylase	NA	S4VZ65	Pandoravirus	35.7	1.2e-29
WP_075348492.1|1534576_1536160_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_065366851.1|1536164_1538288_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_003858832.1|1538307_1538523_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003858829.1|1538522_1539107_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_060564475.1|1539110_1539593_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	30.8	1.9e-15
WP_065532560.1|1540164_1540929_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	1.2e-27
WP_060564477.1|1540932_1541883_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003858822.1|1541925_1542930_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060564478.1|1543029_1543839_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_003858816.1|1543921_1544902_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
1545411:1545462	attL	GTTTCCGCTGGTAGTGGTGCCCCTGGTGAGACTCGAACTCACACTGGACGGG	NA	NA	NA	NA
WP_011014293.1|1545549_1546308_-|integrase	site-specific integrase	integrase	G9FH48	Rhodococcus_phage	32.1	1.8e-15
WP_011014294.1|1546293_1546704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003861519.1|1546700_1547447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075348194.1|1547639_1548074_+	metallopeptidase	NA	NA	NA	NA	NA
WP_155762129.1|1548752_1549954_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.2	2.5e-27
WP_003858803.1|1550059_1550674_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_003858801.1|1550676_1550898_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_038583885.1|1551546_1551981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858799.1|1551996_1552212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858795.1|1552650_1553022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011014297.1|1553042_1553360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107111897.1|1553600_1554787_-|transposase	IS3-like element IS1206 family transposase	transposase	U5P429	Shigella_phage	33.7	5.4e-27
1560331:1560382	attR	GTTTCCGCTGGTAGTGGTGCCCCTGGTGAGACTCGAACTCACACTGGACGGG	NA	NA	NA	NA
>prophage 3
NZ_CP018175	Corynebacterium glutamicum strain XV chromosome, complete genome	3333639	1792672	1798083	3333639	integrase	Corynephage(33.33%)	7	1786878:1786891	1797541:1797554
1786878:1786891	attL	TCGCCGCCACCAAC	NA	NA	NA	NA
WP_081299849.1|1792672_1792984_+	TM2 domain-containing protein	NA	A0A1B0T6B3	Bacillus_phage	42.7	4.4e-05
WP_060564601.1|1793022_1793613_+	hypothetical protein	NA	A0A1P8D5Q9	Corynebacterium_phage	53.3	2.6e-22
WP_060564602.1|1794345_1795104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564603.1|1795208_1795541_+	hypothetical protein	NA	Q9ZWV7	Corynephage	45.0	2.8e-18
WP_060564604.1|1795571_1796114_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9ZWV7	Corynephage	31.0	2.7e-10
WP_060564605.1|1796217_1796448_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L6BZH2	Pasteurella_phage	43.1	1.3e-06
WP_065532569.1|1796451_1798083_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	26.9	1.3e-36
1797541:1797554	attR	GTTGGTGGCGGCGA	NA	NA	NA	NA
>prophage 4
NZ_CP018175	Corynebacterium glutamicum strain XV chromosome, complete genome	3333639	3185723	3243382	3333639	transposase,integrase	Streptococcus_phage(13.33%)	56	3212855:3212875	3255681:3255701
WP_040968032.1|3185723_3186014_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075348427.1|3186557_3186764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075348428.1|3187039_3188602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003860174.1|3189386_3190013_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	36.4	1.9e-23
WP_011013963.1|3190362_3190722_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046552205.1|3190721_3191318_+	cadmium transporter	NA	NA	NA	NA	NA
WP_003859023.1|3191576_3192998_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.0	1.2e-44
WP_003859021.1|3193096_3193486_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_060565376.1|3193976_3194687_-|transposase	IS6-like element ISCef5 family transposase	transposase	A0A077SL39	Escherichia_phage	59.8	3.6e-79
WP_040968043.1|3195099_3195342_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_003862071.1|3195578_3196880_-	APC family permease	NA	NA	NA	NA	NA
WP_075348429.1|3196945_3198427_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_003862069.1|3198423_3198690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081302982.1|3199359_3199908_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	54.2	9.7e-40
WP_075348430.1|3199868_3200153_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_075348431.1|3200238_3200979_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_011015535.1|3201134_3201371_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011015536.1|3201576_3201894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075348432.1|3202537_3204415_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.2	4.6e-105
WP_003861174.1|3205622_3205997_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	38.7	4.5e-12
WP_075348433.1|3206182_3206389_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011015541.1|3206561_3207908_+	MFS transporter	NA	NA	NA	NA	NA
WP_003861180.1|3207867_3208050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075348434.1|3208060_3208663_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060565382.1|3208869_3210402_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	42.3	1.1e-88
WP_003855068.1|3211009_3211462_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_060565383.1|3211518_3212196_-	single-stranded DNA-binding protein	NA	A0A1P8D5R5	Corynebacterium_phage	52.7	2.9e-49
WP_003855074.1|3212232_3212520_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
3212855:3212875	attL	GGGAGACGTCGAAAAGCAAAA	NA	NA	NA	NA
WP_075348435.1|3212879_3213071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011015546.1|3213067_3214528_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_075348436.1|3214573_3216736_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_060565385.1|3216827_3217220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003855083.1|3217411_3217885_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011015549.1|3217912_3218857_+	universal stress protein	NA	NA	NA	NA	NA
WP_003861203.1|3218888_3219386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038586445.1|3219453_3219777_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_060565387.1|3219797_3220736_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_075348437.1|3220783_3222049_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003855103.1|3222045_3222738_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.1	1.0e-38
WP_060565535.1|3222741_3224580_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003855107.1|3224946_3226038_+	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	42.4	8.6e-72
WP_075348539.1|3226113_3226668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060565390.1|3226733_3228221_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_006285365.1|3228589_3229003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006285366.1|3229179_3230085_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	27.5	3.4e-13
WP_081299886.1|3230398_3231604_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.7	2.1e-31
WP_060565391.1|3232112_3232610_-	DNA starvation/stationary phase protection protein Dps	NA	NA	NA	NA	NA
WP_075348438.1|3232755_3233571_+	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_060565393.1|3233807_3234959_+	RtcB family protein	NA	A0A0M5M6X2	Mycobacterium_phage	63.2	1.4e-136
WP_003855120.1|3234965_3235442_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	42.7	5.0e-16
WP_075348439.1|3235456_3236470_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075348440.1|3236627_3237551_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011898098.1|3237854_3239033_+	MFS transporter	NA	NA	NA	NA	NA
WP_038586475.1|3239308_3240487_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_065532602.1|3240617_3241991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075348441.1|3242071_3243382_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.7e-82
3255681:3255701	attR	TTTTGCTTTTCGACGTCTCCC	NA	NA	NA	NA
